ID: 903879985

View in Genome Browser
Species Human (GRCh38)
Location 1:26501573-26501595
Sequence CCATGTGGCTTGAGGTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903879985_903879997 27 Left 903879985 1:26501573-26501595 CCTTGGGACCTCAAGCCACATGG No data
Right 903879997 1:26501623-26501645 GGACCTGAGGGCACCTCGGCTGG No data
903879985_903879996 23 Left 903879985 1:26501573-26501595 CCTTGGGACCTCAAGCCACATGG No data
Right 903879996 1:26501619-26501641 GCTTGGACCTGAGGGCACCTCGG No data
903879985_903879991 1 Left 903879985 1:26501573-26501595 CCTTGGGACCTCAAGCCACATGG No data
Right 903879991 1:26501597-26501619 GAAAGAGCTCCAGGTCACAAGGG No data
903879985_903879989 -8 Left 903879985 1:26501573-26501595 CCTTGGGACCTCAAGCCACATGG No data
Right 903879989 1:26501588-26501610 CCACATGGAGAAAGAGCTCCAGG No data
903879985_903879990 0 Left 903879985 1:26501573-26501595 CCTTGGGACCTCAAGCCACATGG No data
Right 903879990 1:26501596-26501618 AGAAAGAGCTCCAGGTCACAAGG No data
903879985_903879995 15 Left 903879985 1:26501573-26501595 CCTTGGGACCTCAAGCCACATGG No data
Right 903879995 1:26501611-26501633 TCACAAGGGCTTGGACCTGAGGG No data
903879985_903879992 6 Left 903879985 1:26501573-26501595 CCTTGGGACCTCAAGCCACATGG No data
Right 903879992 1:26501602-26501624 AGCTCCAGGTCACAAGGGCTTGG No data
903879985_903879994 14 Left 903879985 1:26501573-26501595 CCTTGGGACCTCAAGCCACATGG No data
Right 903879994 1:26501610-26501632 GTCACAAGGGCTTGGACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903879985 Original CRISPR CCATGTGGCTTGAGGTCCCA AGG (reversed) Intergenic