ID: 903879987

View in Genome Browser
Species Human (GRCh38)
Location 1:26501581-26501603
Sequence CTCTTTCTCCATGTGGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903879987_903879994 6 Left 903879987 1:26501581-26501603 CCTCAAGCCACATGGAGAAAGAG No data
Right 903879994 1:26501610-26501632 GTCACAAGGGCTTGGACCTGAGG No data
903879987_903879990 -8 Left 903879987 1:26501581-26501603 CCTCAAGCCACATGGAGAAAGAG No data
Right 903879990 1:26501596-26501618 AGAAAGAGCTCCAGGTCACAAGG No data
903879987_903879995 7 Left 903879987 1:26501581-26501603 CCTCAAGCCACATGGAGAAAGAG No data
Right 903879995 1:26501611-26501633 TCACAAGGGCTTGGACCTGAGGG No data
903879987_903879997 19 Left 903879987 1:26501581-26501603 CCTCAAGCCACATGGAGAAAGAG No data
Right 903879997 1:26501623-26501645 GGACCTGAGGGCACCTCGGCTGG No data
903879987_903879992 -2 Left 903879987 1:26501581-26501603 CCTCAAGCCACATGGAGAAAGAG No data
Right 903879992 1:26501602-26501624 AGCTCCAGGTCACAAGGGCTTGG No data
903879987_903879991 -7 Left 903879987 1:26501581-26501603 CCTCAAGCCACATGGAGAAAGAG No data
Right 903879991 1:26501597-26501619 GAAAGAGCTCCAGGTCACAAGGG No data
903879987_903879996 15 Left 903879987 1:26501581-26501603 CCTCAAGCCACATGGAGAAAGAG No data
Right 903879996 1:26501619-26501641 GCTTGGACCTGAGGGCACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903879987 Original CRISPR CTCTTTCTCCATGTGGCTTG AGG (reversed) Intergenic
No off target data available for this crispr