ID: 903879988

View in Genome Browser
Species Human (GRCh38)
Location 1:26501588-26501610
Sequence CCTGGAGCTCTTTCTCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903879988_903879995 0 Left 903879988 1:26501588-26501610 CCACATGGAGAAAGAGCTCCAGG No data
Right 903879995 1:26501611-26501633 TCACAAGGGCTTGGACCTGAGGG No data
903879988_903879992 -9 Left 903879988 1:26501588-26501610 CCACATGGAGAAAGAGCTCCAGG No data
Right 903879992 1:26501602-26501624 AGCTCCAGGTCACAAGGGCTTGG No data
903879988_903879997 12 Left 903879988 1:26501588-26501610 CCACATGGAGAAAGAGCTCCAGG No data
Right 903879997 1:26501623-26501645 GGACCTGAGGGCACCTCGGCTGG No data
903879988_903879994 -1 Left 903879988 1:26501588-26501610 CCACATGGAGAAAGAGCTCCAGG No data
Right 903879994 1:26501610-26501632 GTCACAAGGGCTTGGACCTGAGG No data
903879988_903879996 8 Left 903879988 1:26501588-26501610 CCACATGGAGAAAGAGCTCCAGG No data
Right 903879996 1:26501619-26501641 GCTTGGACCTGAGGGCACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903879988 Original CRISPR CCTGGAGCTCTTTCTCCATG TGG (reversed) Intergenic
No off target data available for this crispr