ID: 903879993

View in Genome Browser
Species Human (GRCh38)
Location 1:26501606-26501628
Sequence AGGTCCAAGCCCTTGTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903879993_903880001 25 Left 903879993 1:26501606-26501628 CCAGGTCACAAGGGCTTGGACCT No data
Right 903880001 1:26501654-26501676 TCGTGCAGTCTTTGCAAAAGAGG No data
903879993_903879997 -6 Left 903879993 1:26501606-26501628 CCAGGTCACAAGGGCTTGGACCT No data
Right 903879997 1:26501623-26501645 GGACCTGAGGGCACCTCGGCTGG No data
903879993_903879996 -10 Left 903879993 1:26501606-26501628 CCAGGTCACAAGGGCTTGGACCT No data
Right 903879996 1:26501619-26501641 GCTTGGACCTGAGGGCACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903879993 Original CRISPR AGGTCCAAGCCCTTGTGACC TGG (reversed) Intergenic
No off target data available for this crispr