ID: 903879994

View in Genome Browser
Species Human (GRCh38)
Location 1:26501610-26501632
Sequence GTCACAAGGGCTTGGACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903879987_903879994 6 Left 903879987 1:26501581-26501603 CCTCAAGCCACATGGAGAAAGAG No data
Right 903879994 1:26501610-26501632 GTCACAAGGGCTTGGACCTGAGG No data
903879985_903879994 14 Left 903879985 1:26501573-26501595 CCTTGGGACCTCAAGCCACATGG No data
Right 903879994 1:26501610-26501632 GTCACAAGGGCTTGGACCTGAGG No data
903879988_903879994 -1 Left 903879988 1:26501588-26501610 CCACATGGAGAAAGAGCTCCAGG No data
Right 903879994 1:26501610-26501632 GTCACAAGGGCTTGGACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903879994 Original CRISPR GTCACAAGGGCTTGGACCTG AGG Intergenic
No off target data available for this crispr