ID: 903879996

View in Genome Browser
Species Human (GRCh38)
Location 1:26501619-26501641
Sequence GCTTGGACCTGAGGGCACCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903879993_903879996 -10 Left 903879993 1:26501606-26501628 CCAGGTCACAAGGGCTTGGACCT No data
Right 903879996 1:26501619-26501641 GCTTGGACCTGAGGGCACCTCGG No data
903879987_903879996 15 Left 903879987 1:26501581-26501603 CCTCAAGCCACATGGAGAAAGAG No data
Right 903879996 1:26501619-26501641 GCTTGGACCTGAGGGCACCTCGG No data
903879985_903879996 23 Left 903879985 1:26501573-26501595 CCTTGGGACCTCAAGCCACATGG No data
Right 903879996 1:26501619-26501641 GCTTGGACCTGAGGGCACCTCGG No data
903879988_903879996 8 Left 903879988 1:26501588-26501610 CCACATGGAGAAAGAGCTCCAGG No data
Right 903879996 1:26501619-26501641 GCTTGGACCTGAGGGCACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903879996 Original CRISPR GCTTGGACCTGAGGGCACCT CGG Intergenic
No off target data available for this crispr