ID: 903884474

View in Genome Browser
Species Human (GRCh38)
Location 1:26532807-26532829
Sequence CAGAACTGGGGGCAGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 361}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903884468_903884474 -8 Left 903884468 1:26532792-26532814 CCATTTCTGACATCTCAGAACTG 0: 1
1: 0
2: 2
3: 27
4: 321
Right 903884474 1:26532807-26532829 CAGAACTGGGGGCAGTGGTCTGG 0: 1
1: 0
2: 3
3: 35
4: 361
903884467_903884474 -7 Left 903884467 1:26532791-26532813 CCCATTTCTGACATCTCAGAACT 0: 1
1: 0
2: 0
3: 24
4: 291
Right 903884474 1:26532807-26532829 CAGAACTGGGGGCAGTGGTCTGG 0: 1
1: 0
2: 3
3: 35
4: 361
903884466_903884474 3 Left 903884466 1:26532781-26532803 CCAGTTGGAACCCATTTCTGACA 0: 1
1: 0
2: 1
3: 15
4: 156
Right 903884474 1:26532807-26532829 CAGAACTGGGGGCAGTGGTCTGG 0: 1
1: 0
2: 3
3: 35
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903884474 Original CRISPR CAGAACTGGGGGCAGTGGTC TGG Intronic
900120872 1:1048190-1048212 CACGGCTGGGGGCAGTGGTGGGG - Exonic
900403066 1:2480556-2480578 CAGCTCTGGGGAAAGTGGTCGGG + Intronic
900413270 1:2523341-2523363 CAGCACTGGGGGCAGGGGAGGGG - Intronic
900429218 1:2594035-2594057 CAGACCGGGAGGCAGAGGTCAGG + Intronic
900599279 1:3496206-3496228 CAGAGCAGGCGGCAGTGGCCTGG - Intronic
900731827 1:4267177-4267199 CCAAGCTGGGGGCAGTGGCCTGG - Intergenic
901293956 1:8146419-8146441 CAGATCTGCAGGCAGTGGCCCGG - Intergenic
902138243 1:14329566-14329588 CAGAACTGGGATCAGTGGGTGGG + Intergenic
902260408 1:15220963-15220985 CAGTTCTGGGGGCAGAGGACAGG - Intergenic
902938244 1:19780326-19780348 TAGAACAGGAGGCAGAGGTCAGG + Intronic
903333344 1:22608790-22608812 TAGGAGTGGGGGCAGTAGTCTGG + Intergenic
903884474 1:26532807-26532829 CAGAACTGGGGGCAGTGGTCTGG + Intronic
903930319 1:26858197-26858219 CAGAGCTCGGGGCAGAGATCAGG - Intergenic
904023646 1:27488730-27488752 TACAAATGGGGGCAGAGGTCTGG - Intronic
904499181 1:30904380-30904402 CAGGAGTGGTGGCAGTGGTGGGG - Intronic
904631785 1:31848167-31848189 CAGAAGTGGGGCCAGGGGTAGGG + Intergenic
904911981 1:33941552-33941574 GTGATCTGGGGGCAGTGGGCAGG + Intronic
905174554 1:36127426-36127448 CAGAATTGGGGGCAATTGCCAGG + Intergenic
905416603 1:37808368-37808390 CCGAAAGGGGGGCGGTGGTCGGG + Exonic
905907212 1:41627094-41627116 CAGCACTGGGGCCAGAGGGCAGG + Intronic
906044476 1:42817270-42817292 CAGCGCTGGGTCCAGTGGTCGGG - Intronic
907220915 1:52906487-52906509 CAGGACTGGGGGCAGGGGGTGGG - Intronic
907238781 1:53069326-53069348 TAGAACTGGGGGCAGTTGAGGGG + Intronic
909095196 1:71277669-71277691 CAGAATTGGGAGCAGAGATCAGG + Intergenic
910976144 1:92908204-92908226 CAGAACTGGAGGTAGAGGTTTGG + Intronic
911799058 1:102110473-102110495 CAGTACTGGGGGCCTGGGTCAGG + Intergenic
913975521 1:143451655-143451677 AAGGACTGGGGGCGGTGGTGGGG - Intergenic
914069914 1:144277271-144277293 AAGGACTGGGGGCGGTGGTGGGG - Intergenic
914109241 1:144689083-144689105 AAGGACTGGGGGCGGTGGTGGGG + Intergenic
915096602 1:153466909-153466931 CTGAAGTGGGGGCAGTGTTGTGG + Intergenic
915313332 1:155015389-155015411 CAGCAGTGGGGGCAGTGGGCCGG + Exonic
915591558 1:156873973-156873995 CAGGAGTGGGGGCAGGGTTCAGG - Intronic
915604749 1:156943517-156943539 CAGAGCTGGGTCCAGTGGACAGG - Intronic
915631247 1:157155303-157155325 CAGGCCTGGGGGAAGTGGGCAGG - Intergenic
915911835 1:159920267-159920289 CAGGACTGGGTCCAGTGGACTGG - Intronic
916244249 1:162671156-162671178 AGGAGCTGGGGGCAGTGGTCGGG + Intronic
916503815 1:165409580-165409602 CAGCACTGTGGGCACTGCTCCGG + Exonic
917755436 1:178093919-178093941 CAGAAGTGGGGGCCGAGGACAGG + Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919683010 1:200454706-200454728 CAGGACTGGGGGAAATGTTCTGG - Intergenic
919748183 1:201021510-201021532 CTGAACTGGGTGCAGAGGGCAGG + Intronic
919782440 1:201229504-201229526 GAGTTCTGGGGGCAGTGGTGGGG - Intergenic
919896711 1:202013561-202013583 GAGAACTGGAGTCAGTGGACAGG - Intronic
920312827 1:205058550-205058572 CAGAACTGGAGGCAGAGACCAGG - Exonic
921117517 1:212107658-212107680 CAGAGCTGGGGGCAGCAGTCAGG - Intergenic
921297642 1:213719729-213719751 CAGAAGCGGGGGCAGTGGCATGG + Intergenic
921959715 1:221022072-221022094 AAGGACTGGTGGCAGTGGTTGGG - Intergenic
922096538 1:222447770-222447792 CAGCACTGTGGGCAGTGGGAAGG - Intergenic
1063126025 10:3137375-3137397 CAGAAATGGGGGCAGAGAGCTGG + Intronic
1064186959 10:13170205-13170227 GGGAAGTGGGGGCAGTGGTCAGG + Intronic
1064568462 10:16668263-16668285 GAGATGTGGGGGCAGTGATCAGG + Intronic
1066475362 10:35741654-35741676 CAGAACTGGTCACAGTGGTCTGG + Intergenic
1067063438 10:43089900-43089922 CAGGACTTGGGGCAGAGATCGGG + Intronic
1067349641 10:45464337-45464359 CAGACCTGTGGTCAGTGTTCAGG + Intronic
1067956454 10:50796277-50796299 CAGAACTGGGGCCAGAATTCTGG + Intronic
1067959313 10:50830180-50830202 CAGGGCTGGGGGCAGAGGTATGG - Intronic
1068668864 10:59704284-59704306 GAAGACTGGGGGCAGTGGTTGGG - Intronic
1070640141 10:78162566-78162588 CAGAACTGTAGGCAGAGGCCTGG + Intergenic
1072242941 10:93514225-93514247 CAGAAATGGGGTCTGTGGGCTGG - Intronic
1072419494 10:95277834-95277856 CAGGACTGGCAGCAGTGGACAGG - Intronic
1072629696 10:97136797-97136819 CATGCCTGGGGGCAGTGGCCGGG + Intronic
1072686766 10:97542260-97542282 CATAACTCGGGGCTGTGGGCAGG - Intronic
1073073157 10:100807497-100807519 CAGTACCGTGGGCTGTGGTCGGG - Intronic
1075016392 10:118912794-118912816 CAGAACTGGGGGCAGTTGAGGGG - Intergenic
1076522732 10:131091020-131091042 CAGTACTGTGGGCAGGGGTGGGG + Intergenic
1076614454 10:131746672-131746694 CAGAGCTGGGGGGAGGGGACAGG + Intergenic
1076639064 10:131901465-131901487 CCGAGCTGGGGGCCGTGATCGGG + Intronic
1077055690 11:591715-591737 CACATCTGGGAGCAGTGCTCTGG + Intronic
1077328019 11:1971995-1972017 GAGAACTGGGGGCAGAGGAAGGG + Intronic
1077995664 11:7450069-7450091 CAGCACTGAGCACAGTGGTCTGG - Intronic
1078451691 11:11445208-11445230 CAGAGCTGGGGCAGGTGGTCTGG - Intronic
1078587926 11:12610169-12610191 CAGAATCGGGGGCAGTGGGGGGG + Intergenic
1079019160 11:16894774-16894796 CAAAACTGGGGGCAGGGGAGGGG + Intronic
1080299869 11:30772058-30772080 CAAAAAAGGGGGCAGAGGTCGGG - Intergenic
1080412365 11:32037885-32037907 CAGAAATGGGAGCAGCTGTCAGG - Intronic
1080496899 11:32829748-32829770 CAGAACTGGCGGCAGGCGGCTGG + Intergenic
1080616509 11:33949223-33949245 AAGAGCTGGGGGGAGTGGGCAGG + Intergenic
1082691243 11:56307726-56307748 CAGTATTGGGGCCAGTGGACTGG - Intergenic
1084116341 11:67044999-67045021 CAGGGCTGGGGGCACTGGGCAGG + Intronic
1084644960 11:70451160-70451182 TAGAACTGGGGGCTGTGTGCAGG + Intergenic
1084694621 11:70746171-70746193 CAGATCTGGGGGCAGAGCCCAGG + Intronic
1085077751 11:73606821-73606843 GAGATCTGGGGGCAGGGGACAGG + Intergenic
1085270117 11:75265270-75265292 CAGAGATGGGGGCAGGGGGCGGG - Exonic
1085348021 11:75780650-75780672 CAAAGCAGGGGGCAGTGGTGGGG - Intronic
1087588374 11:100151914-100151936 CAGAACTGAGGCCAGAGGACTGG - Intronic
1088920287 11:114255557-114255579 CACAACTCGGGGAAGTGGGCTGG - Intergenic
1089781073 11:120873666-120873688 CAGATAGGGGGGCAGTGGCCAGG + Intronic
1090228124 11:125083705-125083727 CGGAAAAGGGGGCAGTGGTCTGG + Intronic
1090280412 11:125451515-125451537 CAGAACAGGCTGCAGTGGGCGGG + Intronic
1090875791 11:130787595-130787617 CAGAACTGGTGCCAGCGGCCAGG + Intergenic
1091016145 11:132052455-132052477 CAGAGCTGGGGGCTGTTGACAGG - Intronic
1202810998 11_KI270721v1_random:27175-27197 GAGAACTGGGGGCAGAGGAAGGG + Intergenic
1091600334 12:1914085-1914107 CAGGCCTGGGGGCTGTGGGCAGG + Intronic
1091761908 12:3093170-3093192 CAGAACTGGGGGCAATTCTGTGG - Intronic
1092730450 12:11527923-11527945 CAGAAATGGGGGAAGTCGCCGGG - Intergenic
1096100738 12:48969375-48969397 CAGAGATGGGGGCAGTGCTCTGG - Intronic
1096258455 12:50076704-50076726 CAGAGCTGGGGGCAGGGTTAAGG + Intronic
1098238958 12:68446585-68446607 CAGCACTGGGGGAGGTGGGCAGG - Intergenic
1098570944 12:71986684-71986706 CAGAACTGGGTGCAGGGGTAGGG - Intronic
1098979820 12:76944371-76944393 CTGAAGTGGGGGCAGTCCTCTGG - Intergenic
1099993533 12:89752567-89752589 CAGAGCTGTGAGCAGTGGTGAGG - Intergenic
1100221203 12:92506205-92506227 CAGAAGTGGGGGTAGGGGTGAGG + Intergenic
1101980282 12:109399967-109399989 CAGAACAGTGGGCAGTGGGAAGG - Intronic
1102057594 12:109908273-109908295 CAGGACTGTGGGCCTTGGTCAGG - Intronic
1102462151 12:113106488-113106510 GTGAACTGGGGGCAGTGGGGAGG - Intronic
1104156328 12:126136453-126136475 CAGAAGTGGGGCCACTGGCCTGG + Intergenic
1104376712 12:128269434-128269456 CAGTGCTGGGGGCAGTGATTTGG + Intronic
1104674029 12:130700574-130700596 CAGAGGTGGGGGCAGGGGGCTGG + Intronic
1105064373 12:133183780-133183802 GAGAACTGAGGACAGTGGTCAGG + Intronic
1105463321 13:20611900-20611922 CAGAACTGGTGAAAGTGGGCCGG - Intronic
1109052315 13:57499617-57499639 GAAAACTGGGGGCAGGGGTGGGG + Intergenic
1109525580 13:63570464-63570486 CAGAACTAAGGAAAGTGGTCAGG - Intergenic
1110227118 13:73131398-73131420 CAGAAGTGGAGGCTGTGGTGGGG - Intergenic
1112760594 13:102690012-102690034 CTGAAATGGGGGCAGTCCTCTGG - Intronic
1114635690 14:24185549-24185571 CAGCAGTGGGGGCAGCAGTCTGG + Exonic
1115188465 14:30719949-30719971 CAGAATTGGGGGCAGGGGGGTGG + Intronic
1116230031 14:42203984-42204006 CATGACTGGAGGCAGTAGTCGGG - Intergenic
1116964220 14:50997953-50997975 CAGGAATGTGGGCAGTGGTGGGG + Intronic
1117075901 14:52104029-52104051 CAGAACTGGAGGAAGAGGTTAGG - Intergenic
1118772117 14:68949182-68949204 AAGAACTGGAGGCAGGGGTGGGG + Intronic
1119416355 14:74472668-74472690 CTGATCTGGGGGAGGTGGTCAGG + Intergenic
1119524457 14:75311050-75311072 CAGCCCGGGGGGCAGTGGGCTGG + Intergenic
1119718364 14:76874521-76874543 CAGCACTGGGGGGTGTGGTGTGG + Intergenic
1119726547 14:76924967-76924989 CACATCTGGGGGCAGTGATCTGG - Intergenic
1119861689 14:77940584-77940606 CTGAACTGGGGACAGAGGTCAGG + Intergenic
1120188323 14:81417276-81417298 CAGAGCTGGGGGCCGGGGGCGGG - Intronic
1120747937 14:88168581-88168603 CAGGGCTGGGGGCAGGGGTAGGG - Intergenic
1120847834 14:89141564-89141586 CTGATCTGGGTGCAGTGGTTTGG + Intronic
1121303450 14:92890088-92890110 CAGAGCTGGAGGCAGTGGAGGGG - Intergenic
1121807531 14:96843299-96843321 CAGAACTAGAGGCAGAGGTCAGG + Intronic
1122771149 14:104098533-104098555 CAGGGTTGGGGGCAGTGGGCAGG + Intronic
1122775671 14:104116098-104116120 CAGATCTGGTGGCTGTGTTCTGG + Intergenic
1122823506 14:104358808-104358830 TGGAATTGGGGGCAGTGGCCTGG + Intergenic
1122864776 14:104598726-104598748 CGGGACTGGGGCCAGTGGACGGG - Intronic
1122969821 14:105147979-105148001 CAGACCCGGGGGCAGGGGGCAGG + Intronic
1124226644 15:27900914-27900936 CTGAAGTGGTGGCAGAGGTCAGG + Intronic
1124692979 15:31841121-31841143 CAGAGGTGGGGGCTGTGGTGTGG + Intronic
1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG + Intergenic
1126465255 15:48955849-48955871 CAGAACTGGGAGCTCTTGTCTGG + Intronic
1128673679 15:69593741-69593763 CAGAACTGCGGGGTGTGGTTGGG + Intergenic
1128706827 15:69842784-69842806 CAGCACTGGGGGCAGAGGGGAGG - Intergenic
1129798785 15:78397720-78397742 CTGAACTGTGGCAAGTGGTCAGG + Intergenic
1130907200 15:88249167-88249189 GAGGACTGGGGGCAGAGGTGAGG + Intronic
1130985532 15:88842339-88842361 CAGAGCTGGGGGCAGTGGAGAGG + Intronic
1131250862 15:90829201-90829223 CAGACCTGGGGGCTGGGATCAGG - Intergenic
1131873036 15:96780051-96780073 CAGGACAGGGGCCAGTTGTCAGG + Intergenic
1132672348 16:1106994-1107016 CAGAACCGGCGGCAGTGGCCTGG + Intergenic
1133046188 16:3089599-3089621 CCGCACTGGGTGCAGTGGTGGGG + Exonic
1133107334 16:3521019-3521041 CAGACCTCGGGACAGTGGGCAGG - Intronic
1136117553 16:28104482-28104504 CAGGACTCGCTGCAGTGGTCAGG + Intronic
1136347886 16:29688170-29688192 CAGAGTTGGGGGCAGTGGATGGG + Intronic
1136421317 16:30135317-30135339 CAGAGCTGGAGGCTGTGGGCTGG + Intergenic
1136673440 16:31878028-31878050 CTGAAGTGGGGGCAGTGTTGTGG + Intronic
1137695756 16:50460972-50460994 CAGAGCTGCGGGCAGAGGGCAGG - Intergenic
1138320335 16:56105959-56105981 CAGGGCTGGGGGCACTGGTAAGG + Intergenic
1138374310 16:56552150-56552172 CTGAACTGGGGAAAGTGGTTCGG + Intergenic
1139440513 16:66964339-66964361 CAGTGCTGGGGGCAGTGTTGGGG - Exonic
1139777980 16:69329240-69329262 CAGGACCGGGGGCAGGGGTAGGG - Intronic
1140609113 16:76577014-76577036 CAGAACTGGAGTCAGTGGCTTGG + Intronic
1141444264 16:84047904-84047926 CAGGGCTGGGGGCAGAGGGCAGG + Intergenic
1142102930 16:88285194-88285216 CAGCTCTGGGGGCAGTTCTCCGG - Intergenic
1142336051 16:89490209-89490231 CTGGTCTGGGGGCGGTGGTCGGG - Intronic
1142586775 17:979174-979196 GGGGACTGGGGGCAGGGGTCGGG + Intronic
1143018737 17:3905251-3905273 CAGACCTGGGGGCCGAGGCCAGG + Exonic
1143020084 17:3912979-3913001 AAGACCTGGGGGCTGTGGGCTGG - Intronic
1144050746 17:11495407-11495429 AAGAACTGGGGACACTGGACAGG + Intronic
1144244051 17:13345733-13345755 CAGAACTGGAAGCAGTGAACTGG + Intergenic
1144848186 17:18230828-18230850 CAGGACTGGGGGCACTGATCAGG + Intronic
1145994234 17:29096427-29096449 CAGAGCTGGGGGCTGAGGGCAGG + Intronic
1147979671 17:44266735-44266757 CAAAACTTGGGGCAGCGATCTGG - Intronic
1151450920 17:74197813-74197835 CACAACTGGCCGCAGTGGCCTGG + Intergenic
1151729044 17:75900203-75900225 CAGGCCAGGGGGCAGAGGTCAGG - Intronic
1152007595 17:77692128-77692150 CAACACTGAGGGCAGTGGTGTGG - Intergenic
1152579376 17:81159362-81159384 CAGTCCTGGGGGCAGTGGCGGGG + Intronic
1152863536 17:82709423-82709445 CAGGCATGGGGGCAGTGGGCGGG - Intergenic
1152920501 17:83064257-83064279 CAGGGCTGGGGGCTGTGGTGGGG - Intergenic
1154197536 18:12277431-12277453 ATGAAGTGGGGGCAGTGGGCAGG + Intronic
1154315459 18:13300335-13300357 CAGAACAGATGGCAGTGGTGAGG + Intronic
1154393851 18:13969117-13969139 CTGAATTTGGGGCAGAGGTCGGG + Intergenic
1156555732 18:38065968-38065990 CAGAAATAGGGGCAGTGGTTTGG + Intergenic
1157224750 18:45852771-45852793 CAGAACTGAGGCCAGGAGTCCGG + Intronic
1157517352 18:48320451-48320473 GAGAACTGGGGGCAGAGGCTGGG + Intronic
1157662656 18:49459766-49459788 GTGAACTGGGGGCAGTAGTGGGG - Intronic
1158330599 18:56358274-56358296 AAGAAGTGGGGGCAATGTTCTGG - Intergenic
1158411309 18:57208451-57208473 CAGGGCTGTGGGCAGTGGTGGGG - Intergenic
1160568964 18:79803754-79803776 CGGGACTGGGGCCTGTGGTCGGG - Intergenic
1160820082 19:1053852-1053874 CTGGACTGGGGTCAGGGGTCAGG - Intronic
1161316257 19:3618985-3619007 TAGACCTGGGGGCAGGGGGCAGG + Exonic
1161319360 19:3633875-3633897 CAGGATTGGGGGCTGTGGTGGGG - Intronic
1161849387 19:6730868-6730890 CAGCCCTGGGGGCAGTGTTAGGG - Intronic
1162430651 19:10626073-10626095 CAGAACTGGGGGCTTGGGTGTGG + Intronic
1162922250 19:13910017-13910039 CAGAACTGGGGGCACTGGGTAGG + Intronic
1163103556 19:15110811-15110833 CAGGCCTGGGGGTAGGGGTCTGG - Intronic
1163440410 19:17319958-17319980 GAGAACTGGGGGCAGGAATCGGG - Exonic
1163492901 19:17627473-17627495 CAGGGCTGGGGGCAGTGGGGAGG - Intronic
1163676589 19:18658403-18658425 CAGAAATGGTGGCAGGGGTGGGG - Intronic
1164479718 19:28602117-28602139 CAGAGCTGGTGGCAATGGTTGGG + Intergenic
1164599170 19:29549459-29549481 CAGCACTGGGGGCAGCGTTGGGG - Intronic
1164612076 19:29639342-29639364 CAGAAGTGGAGGCAGTGTTGGGG - Intergenic
1164694861 19:30235835-30235857 CAAAACTGGGGGCCCTGGCCGGG - Intronic
1164793694 19:31009145-31009167 CTGAGCTAAGGGCAGTGGTCAGG + Intergenic
1165104270 19:33459817-33459839 CAGGACTCGGGGCAGGAGTCAGG - Intronic
1167271995 19:48511190-48511212 GAGAATTGGGGGCAGAGGACAGG - Intronic
1168258171 19:55178599-55178621 CAGAAATGGGGGGCGGGGTCGGG - Intronic
1168408195 19:56121402-56121424 CAGAGCTGGGGGCGGTGGCCGGG - Intergenic
925779606 2:7370155-7370177 CAGGACTGGGGGCAGTCAGCAGG + Intergenic
925968327 2:9087317-9087339 CTGACCTGGGGGCTGTGGCCAGG - Intergenic
927152767 2:20205275-20205297 CATGCCTGTGGGCAGTGGTCAGG - Intronic
927809285 2:26172920-26172942 CAGGGCTGGGGGCGGAGGTCCGG + Intergenic
927809310 2:26172978-26173000 CAGAGCAGGGGGCGGGGGTCCGG + Intergenic
928024783 2:27730469-27730491 CGGGACAGGGGACAGTGGTCAGG + Intergenic
930376007 2:50567410-50567432 CAGAACTTGGGTGAGGGGTCAGG + Intronic
931640761 2:64379218-64379240 CAGTCCTGAGGGCACTGGTCTGG + Intergenic
931732388 2:65164830-65164852 GAGAGCTGGGGGAAGTGGGCAGG + Intergenic
932337876 2:70941351-70941373 CAGAAAGAGGGGCAGTGGGCTGG - Exonic
932462416 2:71891495-71891517 CAGAGCTGGGGTCAGAAGTCAGG + Intergenic
932614709 2:73224550-73224572 CAGAACTGAGTTAAGTGGTCTGG + Intronic
932625984 2:73296141-73296163 CAGACCTGGGGGCAGGGCTCGGG + Intergenic
932759724 2:74431287-74431309 CAGAACTTGGGGCACTAGTAGGG - Intronic
933778785 2:85787525-85787547 GAGAACTGGGGCCAGTGGCCTGG - Exonic
934153336 2:89171273-89171295 CAGAACAGGGGGTTGTGCTCTGG + Intergenic
934165545 2:89291033-89291055 TAGAAGTCGGGGGAGTGGTCAGG - Intergenic
934180221 2:89612628-89612650 AAGGACTGGGGGCGGTGGTGGGG - Intergenic
934201731 2:89891429-89891451 TAGAAGTCGGGGGAGTGGTCAGG + Intergenic
934213899 2:90010658-90010680 CAGAACAGGGGGTTGTGCTCTGG - Intergenic
934290513 2:91686888-91686910 AAGGACTGGGGGCGGTGGTGGGG - Intergenic
934561890 2:95317802-95317824 CAGAGCTGAGGGCAGGAGTCGGG + Intronic
934608532 2:95717012-95717034 CAGAACTAGGGGTAGGGGTGAGG - Intergenic
935658211 2:105443001-105443023 CAGGACTTGGGGCTGTGGTCAGG + Intergenic
936167934 2:110140033-110140055 CAGGGCTGGGGGCTGTAGTCAGG - Intronic
937690177 2:124746690-124746712 CAGAACTGAGGACAGAGGTCAGG + Intronic
937978655 2:127597433-127597455 CAGCACTGGGGGCAGGTGTGAGG - Intronic
938172080 2:129088265-129088287 CAGAGCTGGCAGCAGTGCTCAGG - Intergenic
939866200 2:147475432-147475454 CAAAACTGGGGGCAGTGGCGGGG - Intergenic
941635649 2:167932405-167932427 CAGCCATGGGGGCAGTGGACTGG - Intergenic
941698852 2:168582131-168582153 CAGAATTGGGGGTAGAGGTAGGG + Intronic
944003749 2:194876549-194876571 CAGCAATTGGGGCAGTGGTGGGG - Intergenic
946306028 2:218857565-218857587 CAGAATTGGGAGCAGTGGCAGGG - Intergenic
947535695 2:230939431-230939453 CAGAAGGGGTGACAGTGGTCTGG + Intronic
947952649 2:234161405-234161427 CAGAAGTGGAGGCACTGGCCTGG + Intergenic
948216993 2:236239455-236239477 CAGAACTGGGACCAGAGGGCGGG - Intronic
948217009 2:236239534-236239556 CAGAACTGGGACCAGAGGGCGGG - Intronic
1169017646 20:2304814-2304836 CTGAAGTGGGGGCAGTGTTGTGG - Intronic
1169791104 20:9411810-9411832 CAGGCCTTTGGGCAGTGGTCTGG - Intronic
1169867919 20:10219674-10219696 CAGCACCGGGGACAGCGGTCCGG + Intronic
1169947005 20:10999777-10999799 CAGAACTGGCAGAAGTGGACAGG - Intergenic
1170569717 20:17625808-17625830 CAGCTCTGGGGTCAGTGCTCTGG - Intronic
1171095052 20:22324931-22324953 CAGAAATTGGTGCATTGGTCGGG + Intergenic
1173469205 20:43309540-43309562 CAGAGCTTGGGCCAGGGGTCAGG - Intergenic
1173861233 20:46285004-46285026 CAGCACTGGGTACAGTGGTCAGG - Intronic
1174167024 20:48592357-48592379 CAGACCAGGGGGCAGGGGTAGGG + Intergenic
1174386047 20:50189296-50189318 CAGGGCTGGGGTCAGTGGGCTGG + Intergenic
1174403171 20:50286893-50286915 CAGTTCTGGGGGCAGTGACCAGG + Intergenic
1175709669 20:61209259-61209281 CAGAAGTGGAGGAAGGGGTCGGG - Intergenic
1175980825 20:62737838-62737860 GAGGACCGGGGGCAGGGGTCAGG - Intronic
1176039521 20:63056845-63056867 TAGCACTGGGGGCGGTGGGCGGG - Intergenic
1179584323 21:42365263-42365285 CAGAGCTGGGGGCTGGGGTGGGG + Intronic
1182066357 22:27434286-27434308 CTGAAGTGGAGGCAGTGGGCTGG - Intergenic
1183332426 22:37228713-37228735 CAGAGCTGGGGGGAGAAGTCGGG + Intronic
1183512875 22:38246096-38246118 TAGATCTGGGGGCAGAGGTGTGG + Exonic
1183600983 22:38840541-38840563 CAGAACTGGGGGGAGAGGGAGGG + Intronic
1183622910 22:38985193-38985215 CAGAACTGTGGGAAGTGGCCAGG - Intronic
1183706568 22:39478217-39478239 CAGGGCTGGGGGCAGTGGATGGG + Intronic
1184334216 22:43843942-43843964 CAGAACTGGGGGCAGTCTTGTGG + Intronic
1184835661 22:47019591-47019613 CAGCAGTGGGGGCTGTGGGCAGG + Intronic
1185241475 22:49749729-49749751 CAGAAATGTGAGCAGTGCTCTGG + Intergenic
949785261 3:7733469-7733491 CAGACAAGGGGGCAGTGGACTGG - Intronic
952286282 3:31972585-31972607 TAGAACTGGGGGCTCTGTTCTGG - Intronic
953688872 3:45100449-45100471 CAGAACTGGGGGCAAATGTGGGG - Intronic
954755615 3:52837881-52837903 CAGATCAGAGGGCTGTGGTCAGG - Exonic
956068235 3:65419559-65419581 CAGAAATGTAGGCAGTTGTCTGG - Intronic
956441399 3:69284070-69284092 CAGTACTGGGGGCAGTCATAGGG - Intronic
961734677 3:128993932-128993954 CCGAGGTGGGGGCAGGGGTCGGG + Intronic
965835991 3:172853318-172853340 CAGAACTGGGTTCGGTGGACTGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966875004 3:184316441-184316463 GAGAATTGGGGGCAGTGCTTTGG + Intronic
967997952 3:195180720-195180742 CAGGGGTGGGGGCAGTGGGCAGG - Intronic
968178248 3:196569319-196569341 CGGGACTGGGGGCAGCGGTGTGG - Intronic
968574853 4:1360889-1360911 GAGCACTGGGTGCAGTGCTCAGG - Intronic
968642035 4:1719834-1719856 AAGAACTGGAGGCAGGTGTCGGG - Intronic
969121463 4:4914467-4914489 CAGAACTGTGGGCAGGGTTAAGG + Intergenic
969248883 4:5954352-5954374 CAGGGCTGAGGGCAGGGGTCGGG - Intronic
969475954 4:7422528-7422550 CAGAGCTGGGGGCAGAGGTGGGG + Intronic
969577780 4:8046544-8046566 CTGCAGTGGGGGCTGTGGTCGGG - Intronic
969696236 4:8736603-8736625 GAGACCTGGGGGGTGTGGTCAGG + Intergenic
969829053 4:9781001-9781023 AAGGACTGGGGGCGGTGGTGGGG + Intronic
970208250 4:13678730-13678752 CAGAACAGGGGTCAGTGAACTGG - Intergenic
975741450 4:77433056-77433078 TAGAACTGGGGACAGTGGTCTGG - Intronic
977113987 4:92997609-92997631 CTGAAATGAAGGCAGTGGTCTGG + Intronic
977745532 4:100542429-100542451 CTGCACTGGGGCCAATGGTCTGG - Intronic
978331437 4:107617270-107617292 AAGAACTGACAGCAGTGGTCAGG - Intronic
981704670 4:147646794-147646816 CAGAACTGGGGGCATTCATGTGG - Intronic
985155388 4:186982609-186982631 CAGAAATGGGGTCAGTCGTAGGG - Intergenic
985490074 5:174139-174161 CACAGCTAGGGGCAGGGGTCGGG + Intronic
985830008 5:2221299-2221321 CATAGCAGGGGGCAGTGGTTCGG + Intergenic
986220860 5:5767365-5767387 CAGAACTGTGGCCTGTGGTGGGG - Intergenic
988852454 5:35193139-35193161 TAGAGATGGGGGCAGTGGTTGGG - Intronic
993735948 5:91477034-91477056 AAGACTTGGGGGCAGTGGACAGG - Intergenic
994709223 5:103246123-103246145 CGGAACTGGGGGCAGTGGAGGGG - Intergenic
995751386 5:115456661-115456683 CAGAACTGTGGACAGGTGTCAGG + Intergenic
996144407 5:119955961-119955983 CTGAAGTGGGGGCAGTTTTCAGG + Intergenic
996404130 5:123089982-123090004 TCGAACTGGGGGCAGAGGGCAGG - Exonic
997517908 5:134503932-134503954 CAGAACTGGGGTGGCTGGTCAGG - Intergenic
997605395 5:135172386-135172408 CTGAGGTGGGGGCAGTGGGCAGG - Intronic
998383318 5:141741460-141741482 CAGAACTGGGGCCAGGGGGCTGG - Intergenic
999194661 5:149773866-149773888 GAGAACTGGGGACTGTGGGCGGG + Intronic
999712864 5:154333754-154333776 GAGAAAAGGGGGCAGTGATCAGG - Intronic
1001098416 5:168794351-168794373 CAGAACTGATGGCAATGGTTGGG + Intronic
1001719394 5:173844180-173844202 CTGAACTGGGGGCAGGGTTGGGG + Intergenic
1003419635 6:5945442-5945464 CAAAACTTGGGACAGTTGTCAGG + Intergenic
1003479707 6:6519750-6519772 CAAAACTGGACACAGTGGTCAGG + Intergenic
1004590946 6:17050978-17051000 CTGAAGTGGGGGCAGTCTTCTGG + Intergenic
1004605851 6:17194511-17194533 CTGAAGTGGGGGCAGTCCTCTGG + Intergenic
1005118803 6:22368082-22368104 AAGAACTGGTTGCATTGGTCTGG - Intergenic
1006536555 6:34703862-34703884 CTGAGTTGGGGACAGTGGTCCGG + Intergenic
1007134342 6:39507165-39507187 CAGAAGTGGTGGCAGTGTTGTGG + Intronic
1007485534 6:42178446-42178468 CAGGGCTGGGGGCAGCGGTCTGG + Intronic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1007698164 6:43747000-43747022 CAGGAGTTGGGGCAGGGGTCAGG + Intergenic
1008063891 6:47026977-47026999 CAGAACTAGGGGCAGGGACCAGG - Intronic
1009848177 6:69160907-69160929 AAGAACTGGAGGCAATGTTCTGG + Intronic
1011160126 6:84380770-84380792 CAGCAGTGGCGGCAGTGGGCTGG + Intergenic
1011719013 6:90135895-90135917 CAGACCTGGCGGCAGTGGAAAGG - Intronic
1014246985 6:119079221-119079243 CTGAACTGGGGGCAGTGGCCGGG - Intronic
1016004512 6:139075685-139075707 CAGAGCTGGGGTCAGTGCCCAGG + Intergenic
1017085613 6:150710299-150710321 GACGGCTGGGGGCAGTGGTCAGG - Intronic
1017114758 6:150966525-150966547 CAGAAATGGGGGGATTGGCCAGG + Intronic
1017797938 6:157864664-157864686 CAGAAATGCGGGCAGGGGACGGG - Intronic
1017891108 6:158640081-158640103 CAGAACTGGGAACAGTGGAGGGG - Intronic
1018430559 6:163718401-163718423 CACAACTCGAGGCACTGGTCAGG - Intergenic
1018765895 6:166932440-166932462 CAGAGCTGGGGGCTGGGGGCTGG - Intronic
1019316568 7:389702-389724 CAGAACTCAGGGCAGAGGGCGGG - Intergenic
1019606318 7:1911973-1911995 CAGAAGTGGTGGGAGTGGGCTGG + Intronic
1019626546 7:2018781-2018803 CAGCACTGGTGGCAGAGGCCGGG - Intronic
1021016853 7:15546599-15546621 CAGAGCTGGGGCTAGAGGTCTGG + Intronic
1021029726 7:15716558-15716580 TAGAATTGGGGGCAGTGTTAGGG + Intergenic
1021669666 7:23022670-23022692 CAGGGCTGGGGGCAGAGGGCAGG + Intergenic
1022402012 7:30047515-30047537 CAGAACTGGGAGCAGAGCTAAGG - Intronic
1025174665 7:56792556-56792578 CAGATCTGGTGGCAAAGGTCAGG + Intergenic
1025697138 7:63783858-63783880 CAGATCTGGTGGCAAAGGTCAGG - Intergenic
1026735179 7:72944773-72944795 CAGGAGTGGTGGCAGGGGTCGGG + Intronic
1026785520 7:73299702-73299724 CAGGAGTGGTGGCAGGGGTCGGG + Intergenic
1026931241 7:74224076-74224098 CAGAAGTGGGGCCAGTCTTCAGG - Exonic
1027108552 7:75420234-75420256 CAGGAGTGGTGGCAGGGGTCGGG - Intronic
1029658610 7:101944187-101944209 CAGAAAGGGGCGCAGTGGGCTGG + Intronic
1030152219 7:106419125-106419147 CTGTCCTGGTGGCAGTGGTCTGG - Intergenic
1030205498 7:106948827-106948849 CAGAACTGGCGGTAGCAGTCTGG - Intergenic
1031598450 7:123673964-123673986 GAGATCTGGCGGCAGAGGTCAGG + Intergenic
1032614644 7:133454590-133454612 AAGAAATGAAGGCAGTGGTCAGG - Intronic
1032748411 7:134811313-134811335 CTTCACTGGGGGCAGGGGTCTGG + Intronic
1033644749 7:143292568-143292590 CAGACCTTAGGGAAGTGGTCCGG - Intronic
1035474452 7:159132247-159132269 CAGCAGTGGGTGCAGTGGCCCGG - Intronic
1035478803 7:159164641-159164663 CAGCAGTGGGTGCAGTGGCCCGG + Intergenic
1038904760 8:31887600-31887622 CAGAACTGGGAGCAGTCCTAAGG + Intronic
1039341949 8:36660068-36660090 CAGAACTCTGGACAGTGGTTAGG + Intergenic
1039478074 8:37851741-37851763 AAGAACTGGGAGCAGTGGAGAGG - Intergenic
1040413818 8:47180589-47180611 CAGTGTTGGGGGCAGTGATCAGG + Intergenic
1041017773 8:53608770-53608792 CATAACTGGGCACAGTGGCCTGG + Intergenic
1041893803 8:62901313-62901335 CTGAACTGGGAGCAGTGGTGTGG + Intronic
1042047590 8:64671246-64671268 TAGAGCTTGGGGCAGTGGTGGGG + Intronic
1042175617 8:66034784-66034806 CAGAGGTGGGGGCAGGTGTCTGG + Intronic
1043784977 8:84387507-84387529 CAGAGCTGGAGGCAGGAGTCAGG - Intronic
1044891184 8:96837684-96837706 TAGAGCTGGCGGCAGTGGTATGG - Intronic
1044926372 8:97212616-97212638 CTGATCTGGGTGCAGTGGTTTGG + Intergenic
1047225896 8:122955219-122955241 GAGAAATGGGGGCAGTGGCAGGG + Intronic
1048000791 8:130377891-130377913 GAGAAGTGTGGGCAGTGGGCAGG - Intronic
1048265227 8:132979868-132979890 CTGAAGTGGGGGCAGTCTTCTGG - Intronic
1048265366 8:132980658-132980680 CTGAAGTGGGGGCAGTCTTCTGG + Intronic
1048379834 8:133855649-133855671 TAGCACTGGGGGCCGTGCTCTGG - Intergenic
1049280663 8:141742518-141742540 CAGAGCTGGGTGCAGTGGGCTGG + Intergenic
1049470668 8:142773837-142773859 CAGAGCTGGGAGCACTGGTCAGG + Intronic
1049587905 8:143440479-143440501 CAGAGCTGGAGGCACAGGTCAGG + Intronic
1051361515 9:16285522-16285544 CAGAGTTGTGGGCAGTGGTAAGG - Intergenic
1056378487 9:86036384-86036406 CGGAACTGGGGGCTGGTGTCTGG + Exonic
1060278573 9:122200435-122200457 CAGGACTGGGCACAGTGATCAGG - Intergenic
1060539626 9:124420737-124420759 CAGCCTTGGGGGCATTGGTCTGG + Intergenic
1060695657 9:125707049-125707071 CAGAGCTCGGGGCAGGGGCCGGG - Exonic
1061112408 9:128583975-128583997 GTGAACTGGGGGCTGTGGTTGGG + Intronic
1061497060 9:130981230-130981252 AAGAACTGTGGGCAGTGGTCGGG - Intergenic
1061877130 9:133549861-133549883 CAGCTCTGGGGTCTGTGGTCTGG - Intronic
1062034392 9:134376431-134376453 CAGCAGTGGGGGCTGTGGTTGGG - Intronic
1062129944 9:134886902-134886924 AAGAACAGGAGGCAGGGGTCAGG - Intronic
1062525328 9:136975956-136975978 CAGAGCTGGGGGCTGCCGTCAGG - Intergenic
1186649050 X:11539619-11539641 CAGAAGTGGGAGCTGTGGTCTGG - Intronic
1186841060 X:13485049-13485071 AAGAGCTGGGGGCAGTGTTGGGG - Intergenic
1187105338 X:16236134-16236156 CTGCTCTGGGGTCAGTGGTCAGG + Intergenic
1188003152 X:25000888-25000910 CCGAACTGTGGACAGTAGTCAGG - Intergenic
1190292062 X:48999765-48999787 CCTGACTGGGGGCAGTGCTCTGG - Intronic
1190332992 X:49247401-49247423 CCGCACTGGGGGCAGTTCTCAGG + Intronic
1190394885 X:49971716-49971738 CAGAGCTGGGGAAAGTGGTAAGG + Intronic
1191736101 X:64389564-64389586 AAGCCCTGGTGGCAGTGGTCTGG - Intronic
1192144151 X:68669739-68669761 CAGAGCTTGGGGGAGGGGTCTGG - Intronic
1195285887 X:103383303-103383325 CAGAACTGGGAGAAGTGGGTGGG - Intergenic
1196228637 X:113195069-113195091 CAGAACTGGGGTAACTGGCCTGG - Intergenic
1196645802 X:118116649-118116671 CAGGACAGGGTGAAGTGGTCGGG - Intronic
1197089905 X:122523831-122523853 CAGCCCTGGGAGAAGTGGTCAGG - Intergenic
1197303448 X:124809983-124810005 CACATGTTGGGGCAGTGGTCTGG - Intronic
1197796526 X:130304801-130304823 CAGTACTGGAAGCAGTGGACTGG + Intergenic
1198161267 X:134010970-134010992 CAGAGCAGGGGGCAGGTGTCTGG + Intergenic
1198415406 X:136414797-136414819 CAGAACTGGGGCCAGAATTCAGG + Intronic