ID: 903888396

View in Genome Browser
Species Human (GRCh38)
Location 1:26554500-26554522
Sequence CCCCGTGCCCAGAGGCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 274}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903888396_903888405 5 Left 903888396 1:26554500-26554522 CCTTCTGGCCTCTGGGCACGGGG 0: 1
1: 0
2: 2
3: 28
4: 274
Right 903888405 1:26554528-26554550 GTGTGCAAAGGGTGGCAGCAAGG 0: 1
1: 0
2: 1
3: 24
4: 291
903888396_903888409 15 Left 903888396 1:26554500-26554522 CCTTCTGGCCTCTGGGCACGGGG 0: 1
1: 0
2: 2
3: 28
4: 274
Right 903888409 1:26554538-26554560 GGTGGCAGCAAGGAAGGCAGGGG 0: 1
1: 0
2: 12
3: 113
4: 1131
903888396_903888407 13 Left 903888396 1:26554500-26554522 CCTTCTGGCCTCTGGGCACGGGG 0: 1
1: 0
2: 2
3: 28
4: 274
Right 903888407 1:26554536-26554558 AGGGTGGCAGCAAGGAAGGCAGG 0: 1
1: 0
2: 7
3: 229
4: 5097
903888396_903888403 -6 Left 903888396 1:26554500-26554522 CCTTCTGGCCTCTGGGCACGGGG 0: 1
1: 0
2: 2
3: 28
4: 274
Right 903888403 1:26554517-26554539 ACGGGGGTTGGGTGTGCAAAGGG 0: 1
1: 0
2: 1
3: 27
4: 180
903888396_903888402 -7 Left 903888396 1:26554500-26554522 CCTTCTGGCCTCTGGGCACGGGG 0: 1
1: 0
2: 2
3: 28
4: 274
Right 903888402 1:26554516-26554538 CACGGGGGTTGGGTGTGCAAAGG 0: 1
1: 0
2: 1
3: 6
4: 170
903888396_903888404 -3 Left 903888396 1:26554500-26554522 CCTTCTGGCCTCTGGGCACGGGG 0: 1
1: 0
2: 2
3: 28
4: 274
Right 903888404 1:26554520-26554542 GGGGTTGGGTGTGCAAAGGGTGG 0: 1
1: 0
2: 10
3: 48
4: 448
903888396_903888410 23 Left 903888396 1:26554500-26554522 CCTTCTGGCCTCTGGGCACGGGG 0: 1
1: 0
2: 2
3: 28
4: 274
Right 903888410 1:26554546-26554568 CAAGGAAGGCAGGGGTCCTAAGG 0: 1
1: 0
2: 0
3: 26
4: 256
903888396_903888406 9 Left 903888396 1:26554500-26554522 CCTTCTGGCCTCTGGGCACGGGG 0: 1
1: 0
2: 2
3: 28
4: 274
Right 903888406 1:26554532-26554554 GCAAAGGGTGGCAGCAAGGAAGG 0: 1
1: 0
2: 0
3: 36
4: 500
903888396_903888408 14 Left 903888396 1:26554500-26554522 CCTTCTGGCCTCTGGGCACGGGG 0: 1
1: 0
2: 2
3: 28
4: 274
Right 903888408 1:26554537-26554559 GGGTGGCAGCAAGGAAGGCAGGG 0: 1
1: 0
2: 10
3: 89
4: 1799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903888396 Original CRISPR CCCCGTGCCCAGAGGCCAGA AGG (reversed) Intronic
900201851 1:1411541-1411563 CCCCATGCACCAAGGCCAGATGG - Intergenic
900408116 1:2501295-2501317 TCCAGGGCGCAGAGGCCAGAGGG - Intronic
900557966 1:3289557-3289579 CCCAGTGCCCACAGCCCAGCAGG + Intronic
900607665 1:3531076-3531098 GCCGGTGACCAGAGGCCAGGTGG - Intronic
900659333 1:3774887-3774909 CAGCCTCCCCAGAGGCCAGAAGG + Intronic
900744227 1:4350542-4350564 CCCCGTGCACAGGGATCAGAGGG + Intergenic
901492291 1:9602689-9602711 ACCCCTGTGCAGAGGCCAGAAGG - Intronic
901494941 1:9615490-9615512 CCCAGTGCCCAGCGGGCAGGAGG + Intergenic
901764403 1:11490727-11490749 CACCGTGCCCTGATGCCAAAAGG - Intronic
902230465 1:15024150-15024172 ACCAATGCCCAGAGGTCAGAAGG + Intronic
902545370 1:17186436-17186458 CCCCGTGCTCCCAGGGCAGAGGG + Intergenic
902894204 1:19467715-19467737 CCCAGTGCAGAGAGGCCAGAGGG + Intronic
903189859 1:21650534-21650556 CCTCCTGCCCAGAGGTAAGAAGG + Intronic
903888396 1:26554500-26554522 CCCCGTGCCCAGAGGCCAGAAGG - Intronic
904678380 1:32212373-32212395 CTGGGTGCCTAGAGGCCAGAGGG + Intronic
905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG + Exonic
905408817 1:37754300-37754322 CACCGTGCCCAGAGCACAGCCGG - Exonic
905442865 1:38005752-38005774 CCCCATCCCCAGCTGCCAGAGGG + Intergenic
905617065 1:39408768-39408790 CACCGCGCCCCGGGGCCAGAGGG - Intronic
905694230 1:39963035-39963057 CCCCGTGCGCAGAGGCTACTGGG + Intronic
905771106 1:40638596-40638618 CCCAGATCCCAGAGTCCAGAAGG + Intronic
906607761 1:47183488-47183510 CCCTGTGCCCACAGGGCAGCTGG - Intergenic
907040019 1:51250969-51250991 CCCCGTGCGCAGAGGCTACTGGG - Intronic
909433418 1:75615541-75615563 CCCACTGCCCAGAGGCTAGGAGG + Intergenic
911054506 1:93698567-93698589 CTCCGTGGCCAGAGGAGAGAAGG + Intronic
913529983 1:119726929-119726951 CCCCGGGCCCTGAGCCCAGGTGG - Intronic
913662845 1:121020041-121020063 CGCACTGCCGAGAGGCCAGAAGG + Intergenic
914014229 1:143803303-143803325 CGCACTGCCGAGAGGCCAGAAGG + Intergenic
914163593 1:145157893-145157915 CGCACTGCCGAGAGGCCAGAAGG - Intergenic
914652849 1:149711861-149711883 CGCACTGCCGAGAGGCCAGAAGG + Intergenic
916102734 1:161406694-161406716 CCCCGTGCGCAGAGGCTACTGGG + Intergenic
917682049 1:177377327-177377349 CTCTGTGCTCAGAAGCCAGAGGG - Intergenic
919548147 1:198949413-198949435 CCCCGTGCGCAGAGGCTACTGGG + Intergenic
919916768 1:202144092-202144114 CCCCTTGCGCGGGGGCCAGAGGG + Intronic
923136898 1:231127761-231127783 CCCGGTGCCCAGGGCCCAGGAGG + Intergenic
923328104 1:232898459-232898481 CTCAGTGCCCAAAGTCCAGAGGG - Intergenic
923503035 1:234582217-234582239 CACTGGGCTCAGAGGCCAGATGG - Intergenic
1063956471 10:11272068-11272090 CCCAGTGCCCAGTGCCCAGTGGG + Intronic
1065687755 10:28302918-28302940 CCCCGGGCCCGGAGGCAAGGAGG + Intronic
1065806071 10:29394724-29394746 TCCCCTGCCCAAAGTCCAGAGGG - Intergenic
1069064546 10:63928758-63928780 CCCCATGCCTAGAGTCCACATGG - Intergenic
1069098301 10:64287038-64287060 CCCCTTGCCCAGAGGCGGGTGGG + Intergenic
1069359901 10:67630225-67630247 CCCTGTGCCCAGAGGACAATGGG - Intronic
1070299395 10:75192190-75192212 CCCCAAGCCCAGAGGCCGGCTGG + Intergenic
1070387462 10:75938929-75938951 CTCCGTGCCCAGAGGCGAGGAGG + Intronic
1070429722 10:76325272-76325294 CCATTTGCCCAGAGCCCAGACGG - Intronic
1070534159 10:77362565-77362587 CACAGTGCCCAGAGGACAGCAGG + Intronic
1072948902 10:99835478-99835500 CCCCTTGCCCTCAGGCCACAGGG + Intronic
1073260786 10:102188731-102188753 CTCAGTGCCCAAAGTCCAGAGGG + Intergenic
1075962869 10:126584502-126584524 CCCAGTCCCCAGAGTGCAGATGG - Intronic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1076345363 10:129775414-129775436 GACCATGCCCAGAAGCCAGAGGG + Intergenic
1076738472 10:132468967-132468989 CCCCCTGCCCAGGGGTCAGCAGG + Intergenic
1076740068 10:132478525-132478547 CCCCGGGCCCAGAGGGCAGAGGG - Intergenic
1077058011 11:605344-605366 CCCCGTGCCCACAGCCCCCAGGG - Intronic
1078364312 11:10693768-10693790 CCCTGAGCCCTGAGGCCAGCTGG - Intronic
1079058650 11:17228758-17228780 CCCCGTGCGCAGAGGCTACTGGG + Intronic
1080682465 11:34489402-34489424 TCCCTGGCCCAGAGGCCAGGAGG - Intronic
1081869112 11:46375298-46375320 ACCCCTGGCCAGAGGGCAGAGGG - Intronic
1082004878 11:47413962-47413984 GCCAGAGGCCAGAGGCCAGAGGG - Intronic
1083961260 11:66016206-66016228 CCCCTTGCCCTGAGGCCAGAAGG + Intergenic
1084168212 11:67387014-67387036 CCCACAGCCCAGGGGCCAGAGGG + Intronic
1084417594 11:69042408-69042430 CCCTGTGTCCAGTGGCCTGAGGG + Intergenic
1084437930 11:69155023-69155045 CCCAGTGCACAGAGACCCGAAGG - Intergenic
1084675234 11:70630224-70630246 GCAGGTGCCCTGAGGCCAGACGG + Intronic
1085388631 11:76171112-76171134 CCCCTTGCTGAGAGGCCAGGGGG + Intergenic
1087943873 11:104134986-104135008 TCCAGTGCCCTGAGGCCAGTGGG + Intronic
1088135610 11:106552492-106552514 ACTAGTGCCCAGAGTCCAGAGGG - Intergenic
1090404295 11:126467781-126467803 CCTTGAGGCCAGAGGCCAGAGGG + Intronic
1090437505 11:126698827-126698849 CCTCGTGCACAGAGCCCAGTAGG + Intronic
1090458030 11:126866544-126866566 GCCCGTGGGCACAGGCCAGAGGG - Intronic
1091422768 12:357539-357561 CACCGTGCCCAGCCTCCAGAAGG - Intronic
1092280139 12:7092146-7092168 CTCCCTGCCAAGAGCCCAGAGGG + Intronic
1092743805 12:11654549-11654571 CCCCGTGCCCTCAGACCAGCTGG - Intronic
1093512038 12:19941204-19941226 CGCCGTGCCCCGCGGCCAGCCGG + Intergenic
1097249855 12:57626539-57626561 TCCAGTGCCCAGAGGCCTGGTGG - Exonic
1100608010 12:96167615-96167637 CCCCCTGCTCAGAGGCCTGCTGG - Intergenic
1101639990 12:106581003-106581025 CCCCATGCCCAGTGCCCAGAAGG - Intronic
1101820904 12:108183721-108183743 CCCCGAGGTCAGAGGTCAGAGGG + Intronic
1102559124 12:113749574-113749596 GCCAGAGCCCAGAGGACAGAAGG - Intergenic
1103107926 12:118246572-118246594 CCCCGTGCGCAGAGGCTACTGGG + Intronic
1103221827 12:119252735-119252757 ACCCATGCCCAGAAGCCTGAAGG - Intergenic
1103822949 12:123712785-123712807 CCCCGTCCCCATTGTCCAGACGG + Intronic
1104391801 12:128397230-128397252 ACCTGTGCCCAGGGGCCATAGGG + Intronic
1104970095 12:132527221-132527243 CTCCGTGCCCACCCGCCAGAGGG - Intronic
1104990160 12:132620144-132620166 TCCCCTGACCAGAGGCCAAACGG + Intronic
1107828627 13:44353702-44353724 CCCCGTGCCCACTAGCCAGAAGG - Intergenic
1110744681 13:79038733-79038755 CCCCGTGCCCATAGACAACATGG + Intergenic
1112146489 13:96705817-96705839 GCCTGTGCCCAGAGGCCAGTGGG - Intronic
1112438566 13:99408752-99408774 CCCCTTGCCGAAAGGCCAGCTGG + Intergenic
1113952483 13:114079764-114079786 CCCCGTGTCCAGAGGCGAACAGG - Intronic
1119435149 14:74593797-74593819 CCACTCCCCCAGAGGCCAGATGG + Intronic
1119601473 14:75979806-75979828 CCCCGTGCCCACCGGCCTGGAGG + Intronic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121219443 14:92274793-92274815 CCCCGTGCCCAGGGGCAAAGTGG - Intergenic
1121291215 14:92777140-92777162 CCTTCTGCCCAGAGGCAAGAAGG - Intergenic
1121508272 14:94492936-94492958 CCTCCTGCACAGAGGCCAGGTGG + Intronic
1121744826 14:96279864-96279886 TCCAGTGGCCAGAGGCCAGCGGG + Intergenic
1122722451 14:103729906-103729928 CCCCGTGGACAGAAGCCAGGTGG - Intronic
1122775356 14:104114548-104114570 CCCCTTGGGGAGAGGCCAGAGGG + Exonic
1122856122 14:104561053-104561075 CCCAGCCCCCAGAGGCCAGCAGG + Intronic
1123995512 15:25715571-25715593 GGCAGAGCCCAGAGGCCAGATGG + Intronic
1124008068 15:25810498-25810520 CCCCGTGCCCAGAGTCCCAGTGG - Intronic
1124688004 15:31798767-31798789 CCACGGCCCCAGAGGCCAGAAGG + Intronic
1125241514 15:37582251-37582273 CTCAGTGCCCAGAGTCCGGAGGG - Intergenic
1128145589 15:65330837-65330859 GCCCTTGGCCAGAGGCCAGAGGG - Intronic
1129251628 15:74312366-74312388 CCCCGTGCCTAGAGGTGTGAAGG + Intronic
1129761624 15:78131918-78131940 GGCCGCGCCCAAAGGCCAGATGG - Intronic
1132837718 16:1962774-1962796 CCCCGTGCGCAGAGGCTACTGGG - Exonic
1134063439 16:11212381-11212403 CGCACTGCCCAGAGGGCAGAAGG + Intergenic
1134884812 16:17781182-17781204 CCCTGTGACCAGATGCCAGGAGG + Intergenic
1135899211 16:26441308-26441330 CCCAGTGCCCAGAGCACAGCAGG + Intergenic
1136228590 16:28874273-28874295 CTCAGTGCCCACAGGCCAGAGGG + Intergenic
1139348695 16:66321835-66321857 CCCTGGGACCAGAGGCCATATGG - Intergenic
1141698963 16:85633719-85633741 CCCCGTCCCCAGAGTCCAGCTGG - Intronic
1142031314 16:87839880-87839902 CCCTGTGCCCAGGAGCCAGGTGG + Intronic
1142239348 16:88938143-88938165 ACCCGTGCCCTGACCCCAGATGG + Intronic
1142869235 17:2809588-2809610 CCCCAGGCCCAGAGGCCTGCTGG + Intronic
1143170711 17:4928445-4928467 CACCGTGCCCAGCCTCCAGATGG + Intergenic
1143383019 17:6508121-6508143 CCAGGTGCCAAGAGGCCAGGAGG + Intronic
1143550340 17:7626859-7626881 CCCTGTCCCCAGAGCCCAGCCGG - Intronic
1143715590 17:8766182-8766204 CCCTGTGCCCACAGGCCTGGAGG - Intergenic
1144201624 17:12947356-12947378 CCCTGTGGTCAGAGGCCAGAGGG - Intronic
1144201638 17:12947410-12947432 CCCCTAGGTCAGAGGCCAGAGGG - Intronic
1144438343 17:15260955-15260977 CCCAGTGCCCAGCGCCCAGCCGG + Intronic
1144692347 17:17276078-17276100 CCCCGAGCACAGTGTCCAGATGG + Exonic
1144732665 17:17537493-17537515 CCCCGTGCCCAGCAGCCTGCAGG + Intronic
1144753745 17:17667481-17667503 CCAGGTTCCCAGAAGCCAGAGGG + Intergenic
1145022933 17:19446341-19446363 CCCCGTGCGCAGAGGCTACTGGG - Intergenic
1148114756 17:45169162-45169184 CCCCGGACCCAGAGCCCAGGGGG + Exonic
1148377235 17:47159561-47159583 CCCCGTGCGCAGAGGCTACTGGG - Intronic
1148685914 17:49501210-49501232 CCCTGTTCCCAGTGGCCACATGG + Intronic
1148830392 17:50426891-50426913 CCCCTTGCACTGAGGACAGAAGG - Intronic
1149392065 17:56202084-56202106 ACCCTTTTCCAGAGGCCAGAAGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150573964 17:66413472-66413494 TCCCTTCCCCAGAGGTCAGAGGG + Intronic
1151265558 17:72952496-72952518 CCCCATGCCCAGTGAGCAGATGG - Intronic
1152123544 17:78433156-78433178 CCCCTCGCCCAGAAGGCAGAGGG - Intronic
1152597868 17:81246626-81246648 AGCGGTGCCCAGAGGCCAGGAGG - Exonic
1152795564 17:82304509-82304531 CTTGGTGCTCAGAGGCCAGAGGG - Intergenic
1154491536 18:14925795-14925817 CCCCGGACCCAGAGGCCCGAGGG + Intergenic
1157453048 18:47802119-47802141 CTTCCTGCCCAGAGGCTAGAAGG - Intergenic
1157520528 18:48342279-48342301 CCCCCTGCCCAGAGCCCAAGTGG + Intronic
1159601270 18:70430728-70430750 CCCCGTGCGCAGAGGCTACTGGG + Intergenic
1160426882 18:78783752-78783774 CCCCCTTCCCACAGGCCAGCAGG + Intergenic
1160537850 18:79604459-79604481 CTGCGTGCCCAGGGGGCAGAGGG - Intergenic
1160754770 19:751489-751511 CCCCATGGTCAGAGGCCAGAGGG + Intronic
1160813807 19:1026416-1026438 CCCCGTCACCAGAGGCCTGGAGG - Intergenic
1160833672 19:1114597-1114619 CCCCGTGCCCTGTGGCCAGGAGG + Intronic
1161155784 19:2731433-2731455 GCCCAAGCCCACAGGCCAGATGG + Intronic
1162015182 19:7841711-7841733 CCCCAGACCCAGAGGCCAGTGGG + Intronic
1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG + Intergenic
1163054215 19:14706185-14706207 CCCTGGACACAGAGGCCAGAGGG + Intronic
1163102658 19:15107582-15107604 CCCAGGGCCCCGAGGACAGACGG + Intronic
1164575064 19:29401081-29401103 TCCCATGCCCAGAGGCCGGGCGG - Intergenic
1165823607 19:38692976-38692998 CCAGGTACCCGGAGGCCAGACGG - Intronic
1166079329 19:40433989-40434011 CTCCCTCCCCAGAGGCCGGACGG - Intergenic
1166300027 19:41908039-41908061 CCCCCTCCACAGAGGACAGAGGG - Intronic
1166996706 19:46722942-46722964 CCCCGTGCTCTGAGGGCACAGGG + Exonic
1167685454 19:50953033-50953055 CCCGGTGCCCAGAGCCCAGGAGG - Exonic
1168009379 19:53518302-53518324 GCCTGTGGCCAGAGGCCACAGGG - Intergenic
1168354553 19:55693052-55693074 TCCCCTGCCCAGTGGCGAGAGGG + Intronic
1168676046 19:58278821-58278843 CCCATTGGCCAGAGGCCAGCGGG + Intronic
1168715005 19:58521825-58521847 CCCCTATCCCAGAGGACAGAGGG + Intronic
925367871 2:3323515-3323537 ACCTGTGCCCCGAGGCCACAAGG - Intronic
927104694 2:19813034-19813056 CCTTGTGGCCAGAGGCCTGATGG - Intergenic
928723677 2:34147885-34147907 CTCAGTGCCCAAAGTCCAGAGGG + Intergenic
929165396 2:38876230-38876252 CCCCGTGCCCCTCGGCTAGACGG - Intronic
929561624 2:42959949-42959971 CTCCTGGGCCAGAGGCCAGATGG - Intergenic
931614676 2:64144116-64144138 CCCCGAGACCCGAGGCGAGAGGG + Exonic
931881444 2:66575194-66575216 TCCCGTACCCTGAGGCCACAAGG + Intergenic
932601123 2:73126682-73126704 CCCCGTCCCCACCGGCCAGGAGG + Intronic
933659565 2:84916272-84916294 CCCCGTGCGCAGAGGCTACTGGG + Intergenic
935212703 2:100952224-100952246 CCTCGTGCACAGAGGGCAAAGGG + Intronic
936577488 2:113668449-113668471 CCAGGGGCCCAGAAGCCAGAAGG + Intergenic
937227071 2:120376093-120376115 CACAGAGCCCAGAGGCCAGGTGG + Intergenic
937264550 2:120607731-120607753 CCCCGTGGGCAGAGCTCAGAGGG + Intergenic
937325551 2:120987940-120987962 CACCGTGCCCAGTGAGCAGATGG - Intronic
938537564 2:132257998-132258020 GCCCGTGCGCAGCCGCCAGAGGG + Intergenic
940183646 2:150960272-150960294 CCCTAGACCCAGAGGCCAGAAGG + Intergenic
944644325 2:201763183-201763205 CCCCGTGCACAGAGGCTACTGGG + Intronic
945851335 2:215011519-215011541 CCCTCTTCCCAGAGGCCAAAAGG - Exonic
947118723 2:226796857-226796879 CCCAGTGCCCAGTGGCCGAAAGG - Exonic
948087628 2:235264740-235264762 CCCAGTGCCCAGCGGCCCTACGG - Intergenic
948377300 2:237529899-237529921 CCCAGAGCCCACAGGCCCGAAGG - Intronic
948575455 2:238946894-238946916 CTCAGTGCCCAAAGTCCAGAGGG + Intergenic
949050164 2:241893495-241893517 CACACTGCCCAGAGGCCAGACGG - Intergenic
1169801480 20:9516136-9516158 CTCCGAGCCCAGCGGGCAGAGGG + Intronic
1171086460 20:22242573-22242595 CCCCACTGCCAGAGGCCAGAAGG - Intergenic
1172336760 20:34122900-34122922 CCCCGTGCGCAGAGGCTACGGGG + Intergenic
1172885629 20:38229025-38229047 CCCTGTACCCACTGGCCAGATGG - Intronic
1175367919 20:58467987-58468009 CCAGGTGCCCAGAGTCCAGCGGG - Intronic
1175908574 20:62393862-62393884 CCACCAGCACAGAGGCCAGAGGG + Intronic
1176289473 21:5036487-5036509 CCCCGTGCCCTCAGGCATGAGGG - Intronic
1177925022 21:27203366-27203388 TCCAGTGGCCAGATGCCAGATGG + Intergenic
1178473623 21:32917486-32917508 CCCCCTGCTCAGAGCCCAGGAGG + Intergenic
1179163042 21:38913306-38913328 GCCCGTGCTCTGAGGCCAGCTGG - Intergenic
1179720623 21:43314209-43314231 CCCCGTGCCCTGAGGCCACCAGG - Intergenic
1179829274 21:43985995-43986017 CCCCATCCCCCGAGGCCCGAGGG - Exonic
1179867757 21:44227100-44227122 CCCCGTGCCCTCAGGCATGAGGG + Intronic
1180948209 22:19708359-19708381 CTCCGTGGCCAGTGGCCAGCCGG - Intergenic
1181066245 22:20307425-20307447 CCGGGTGCCCAGAGGACACAGGG + Intergenic
1181327404 22:22060698-22060720 GCCTGTGACCAGAGGCCAGGTGG - Intergenic
1181495503 22:23285283-23285305 CCTGGGGCCCAGAGGCCTGACGG - Intronic
1181538949 22:23562908-23562930 CACCATGCCCAGAGACCAGATGG + Intergenic
1181688168 22:24543428-24543450 CCCTGTGCCCGGAGGGCAGTAGG + Intronic
1182294153 22:29303365-29303387 CCCTCTGGCCAAAGGCCAGAAGG + Intergenic
1182357260 22:29727832-29727854 CCCAGGGCCCAGATGCCAGGTGG - Intronic
1182424881 22:30266669-30266691 CCCAGTTCCCGGAGGGCAGAGGG + Intronic
1182656960 22:31898290-31898312 CCCAGAGCCCAGAACCCAGAGGG + Intronic
1184224389 22:43120823-43120845 GCCTGGGCCCAGAGGCCAGATGG + Intronic
1184827854 22:46965282-46965304 CCCCGCCCCCACAGGTCAGATGG - Intronic
1185032811 22:48453625-48453647 CCCCATGTCCATAGGCCAGAGGG + Intergenic
1185084732 22:48734522-48734544 CACACTGCCCAGAGCCCAGACGG - Intronic
1185340160 22:50287536-50287558 CTCGGTGCCCAGAGCCCAGGCGG + Intronic
1185422744 22:50744215-50744237 CCAGGGGCCCAGAAGCCAGAAGG - Intronic
951052695 3:18112174-18112196 TCCCGAGCCCTGAAGCCAGATGG + Intronic
951543662 3:23806184-23806206 CCCCGTGCCCTGCGGCCCGGCGG - Intronic
952655439 3:35779969-35779991 CCCCTTGCCCAGAGGCAAAGGGG + Intronic
952945332 3:38475084-38475106 CACCCTGCCCAGAGGCCACAGGG - Intronic
953025380 3:39142094-39142116 GCCCATGCCCTGAGGCCAGTTGG - Exonic
953616210 3:44493030-44493052 CCCAGTTTCCACAGGCCAGATGG + Intergenic
953687742 3:45091410-45091432 CAGCGTGCCCAGAGACCAGGTGG - Exonic
955676344 3:61452870-61452892 GCACGTGCTCTGAGGCCAGAAGG - Intergenic
957200147 3:77124089-77124111 CCCAGTGCCCAGTGTCTAGATGG + Intronic
961362421 3:126376223-126376245 CCCCCTGCTCAGAGGCCGGCTGG + Intergenic
961532601 3:127548229-127548251 CCCCGTCCCCGCAGGCCAGCAGG + Intergenic
961602532 3:128072596-128072618 CCCTGAGCCCTGAGGCCAGCAGG - Intronic
962257878 3:133884761-133884783 CCCAGTGCCCAAAGGACAGGGGG + Intronic
962317260 3:134366721-134366743 CCCTGTGCCCAGTGTCCAGAAGG + Intronic
968092270 3:195906832-195906854 TCCCGGGCTCAGGGGCCAGAGGG + Intronic
968547926 4:1208048-1208070 CTCAGGGCCCAGTGGCCAGATGG + Intronic
968578782 4:1380177-1380199 TGCCGTGCCCCGAGGCCAGACGG + Exonic
969262494 4:6042954-6042976 CCCCCAGCCCAGACCCCAGAGGG - Intronic
969436793 4:7193279-7193301 ACCAGTGACCAGAGGCCAGTAGG - Intronic
969479062 4:7437480-7437502 ACCCCTTCCCAGAGGCCAGGGGG + Intronic
976431692 4:84969078-84969100 CCCTTTGTGCAGAGGCCAGATGG + Intergenic
976712576 4:88087918-88087940 CCACAAGCCCTGAGGCCAGAAGG + Intergenic
979649016 4:123107766-123107788 ACCAGTGCCCAAAGTCCAGAGGG + Intronic
980595753 4:134952559-134952581 CCCCGTGCACAGAGGCTACTGGG - Intergenic
980745471 4:137007364-137007386 CACCCTCCCCAGAGGCCAGGAGG - Intergenic
981316946 4:143349646-143349668 CCCCGTGCACAGAGGCTACTGGG - Intronic
981614725 4:146634640-146634662 CCCTTTGCCCAGAAGCCTGAGGG + Intergenic
982800631 4:159702325-159702347 CCCTGTGCTCAGAGGTCAAATGG + Intergenic
986706306 5:10457302-10457324 CCCTGTCCCCAGCGGCCTGATGG - Intronic
992116066 5:73539534-73539556 CACTGTGCCCAGCTGCCAGAAGG + Intergenic
997239081 5:132294055-132294077 CCCCGGGCCCAGACCCCAGCAGG - Intronic
998147993 5:139741103-139741125 CCCAGAGCCCAGAGCCCCGAGGG - Intergenic
1001495363 5:172184431-172184453 CCCGGTGCCCAGAGAAGAGAAGG - Intronic
1002210626 5:177596820-177596842 CAAAGGGCCCAGAGGCCAGAGGG - Intergenic
1002334733 5:178469859-178469881 TCCCCTGTGCAGAGGCCAGAAGG + Intronic
1002373156 5:178770345-178770367 CCCAGAGCCCAGAGCCCAGCTGG + Intergenic
1002480766 5:179499330-179499352 CCCAGTGCCTTGAGGCCACAGGG + Intergenic
1002643118 5:180640040-180640062 CCCCGTGGCCCGAGGACGGAGGG - Intronic
1006945308 6:37780491-37780513 CCCCCAGGCCAGAGGCCAAATGG + Intergenic
1007390492 6:41547260-41547282 CCCCATTCCCAGAGGCCCGGCGG - Intronic
1007669397 6:43539193-43539215 CCCCGTGCACAGAGGCTACTAGG - Intronic
1008108341 6:47465191-47465213 CCCAGTGCCCAGAGCCCTGCTGG + Intergenic
1008545151 6:52577189-52577211 GCGCGTGCCCAGCGGCTAGAGGG - Intergenic
1008585651 6:52946334-52946356 CCCCGTGCCACCAGCCCAGATGG - Intergenic
1011075333 6:83431704-83431726 CCCGGGGCCCTGAGGCCGGAGGG + Intergenic
1013368180 6:109450062-109450084 TCCAGTGCCCAGGGGCCAGAAGG + Exonic
1018058317 6:160071026-160071048 CCCTGTGCCCAGGGCCCAGAAGG + Intronic
1018058337 6:160071082-160071104 CCCCATGTCCAGAGCCCAGGAGG + Intronic
1018058397 6:160071247-160071269 CCCTGTGCCCAGGGCCCAGGAGG + Intronic
1018808178 6:167277348-167277370 CCCCATGGTCAGAGGCCAGCTGG - Intronic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1019273331 7:162903-162925 CCCCATGGCCAGATGCCAGCAGG + Intergenic
1019658238 7:2209419-2209441 CCCAGAGCCCACAGGCCTGAGGG + Intronic
1020098906 7:5383476-5383498 AGCCGCCCCCAGAGGCCAGAGGG + Intronic
1020153198 7:5699826-5699848 TCCAGTTCCCAGAGGCCACATGG - Intronic
1024013177 7:45287960-45287982 CCTCCTTCCCAGAGGCCAGTGGG + Intergenic
1024246051 7:47471361-47471383 CCCAGTTCCCAGAGACGAGACGG - Intronic
1026944539 7:74307243-74307265 CGCTGTCCCCAGAGGCCAGGGGG + Intronic
1029120381 7:98263812-98263834 CCCCGTTTCCAGAGGTCAAAGGG + Intronic
1031665813 7:124481005-124481027 CCCCGTGCGCAGAGGCTACTGGG + Intergenic
1034488438 7:151380658-151380680 CCCTGTGCCCAGGGGCTCGAGGG - Intronic
1035470770 7:159107337-159107359 CCCCATGCTCAGGGGCCAGGAGG - Intronic
1035652780 8:1281461-1281483 GCCTGTGCCCAGGGGACAGAAGG - Intergenic
1036446966 8:8829885-8829907 AGAGGTGCCCAGAGGCCAGATGG + Intronic
1037924873 8:22836330-22836352 CCCCCTGCTCAGAGGGTAGAGGG + Intronic
1042004878 8:64169253-64169275 ACCAGTGCCCAGAGTCCAGAAGG - Intergenic
1044971479 8:97624573-97624595 CCCCGTGCGCAGAGGCTACTGGG - Intergenic
1048935253 8:139349870-139349892 CCCTGGGGCCAGAAGCCAGAGGG - Intergenic
1049078876 8:140425173-140425195 CCCCAAGAGCAGAGGCCAGAAGG + Intronic
1049219192 8:141421162-141421184 CCCAGGGCCCAGAGGCGACAGGG - Intronic
1049446810 8:142635031-142635053 CCCCTTAGGCAGAGGCCAGATGG - Intergenic
1049585638 8:143431206-143431228 ACCCGTGTCCAGAGGCCCGGAGG - Intergenic
1049749730 8:144277456-144277478 ACCCGTCCGCAGAGGCCAGGCGG - Intronic
1049798547 8:144507317-144507339 CCCCACAACCAGAGGCCAGAGGG - Intergenic
1050287525 9:4118367-4118389 CCCGGTGCCCGGCAGCCAGAAGG - Exonic
1052861874 9:33442437-33442459 CCCCGTCCCCCGAGGCCTGGAGG - Exonic
1053285538 9:36847604-36847626 CCCCCTCCCCAGTGGCCAGAAGG - Intronic
1053412533 9:37925055-37925077 ATGTGTGCCCAGAGGCCAGAGGG - Intronic
1055470180 9:76603058-76603080 CCCAGTGCTCAGAGGAGAGATGG - Intergenic
1058023608 9:100117123-100117145 CCCCGTGCACAGAGGCTACTGGG - Intronic
1059331755 9:113539947-113539969 CCACGGGCCCAGTGCCCAGATGG - Intronic
1060583555 9:124771895-124771917 CCCCCTGCCCATAGAACAGATGG + Intergenic
1060731089 9:126037451-126037473 CCTGGTGCCGAGAGGCCAGCTGG + Intergenic
1061667083 9:132166867-132166889 CATAGTCCCCAGAGGCCAGAGGG - Exonic
1061720070 9:132546037-132546059 CCTTGTCCCCAGAGGCCAGCAGG + Intronic
1061748472 9:132757325-132757347 CTCCTTCCCCAGAGGCCAGCGGG - Intronic
1061931557 9:133835628-133835650 GCCCGGGCCCAGATGCCAGCTGG + Intronic
1195664910 X:107420359-107420381 CCCCTTAGGCAGAGGCCAGAAGG - Intergenic
1199984151 X:152938313-152938335 CCCTGGCCCCAGAAGCCAGAGGG - Intronic