ID: 903888861

View in Genome Browser
Species Human (GRCh38)
Location 1:26556729-26556751
Sequence GGCCAGAGCCCTGGTGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 9, 3: 62, 4: 515}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903888861_903888876 17 Left 903888861 1:26556729-26556751 CCACCCACACCAGGGCTCTGGCC 0: 1
1: 0
2: 9
3: 62
4: 515
Right 903888876 1:26556769-26556791 GCCACAGGAAGGGTGGTGGGAGG 0: 1
1: 0
2: 9
3: 60
4: 568
903888861_903888871 7 Left 903888861 1:26556729-26556751 CCACCCACACCAGGGCTCTGGCC 0: 1
1: 0
2: 9
3: 62
4: 515
Right 903888871 1:26556759-26556781 AGCCATCTTGGCCACAGGAAGGG 0: 1
1: 0
2: 3
3: 22
4: 291
903888861_903888875 14 Left 903888861 1:26556729-26556751 CCACCCACACCAGGGCTCTGGCC 0: 1
1: 0
2: 9
3: 62
4: 515
Right 903888875 1:26556766-26556788 TTGGCCACAGGAAGGGTGGTGGG 0: 1
1: 1
2: 2
3: 21
4: 268
903888861_903888869 2 Left 903888861 1:26556729-26556751 CCACCCACACCAGGGCTCTGGCC 0: 1
1: 0
2: 9
3: 62
4: 515
Right 903888869 1:26556754-26556776 GGCTCAGCCATCTTGGCCACAGG 0: 1
1: 0
2: 0
3: 25
4: 175
903888861_903888867 -5 Left 903888861 1:26556729-26556751 CCACCCACACCAGGGCTCTGGCC 0: 1
1: 0
2: 9
3: 62
4: 515
Right 903888867 1:26556747-26556769 TGGCCAGGGCTCAGCCATCTTGG 0: 1
1: 1
2: 1
3: 20
4: 252
903888861_903888879 19 Left 903888861 1:26556729-26556751 CCACCCACACCAGGGCTCTGGCC 0: 1
1: 0
2: 9
3: 62
4: 515
Right 903888879 1:26556771-26556793 CACAGGAAGGGTGGTGGGAGGGG 0: 1
1: 0
2: 12
3: 71
4: 809
903888861_903888870 6 Left 903888861 1:26556729-26556751 CCACCCACACCAGGGCTCTGGCC 0: 1
1: 0
2: 9
3: 62
4: 515
Right 903888870 1:26556758-26556780 CAGCCATCTTGGCCACAGGAAGG 0: 1
1: 0
2: 1
3: 28
4: 296
903888861_903888878 18 Left 903888861 1:26556729-26556751 CCACCCACACCAGGGCTCTGGCC 0: 1
1: 0
2: 9
3: 62
4: 515
Right 903888878 1:26556770-26556792 CCACAGGAAGGGTGGTGGGAGGG 0: 1
1: 0
2: 7
3: 55
4: 567
903888861_903888874 13 Left 903888861 1:26556729-26556751 CCACCCACACCAGGGCTCTGGCC 0: 1
1: 0
2: 9
3: 62
4: 515
Right 903888874 1:26556765-26556787 CTTGGCCACAGGAAGGGTGGTGG 0: 1
1: 0
2: 5
3: 36
4: 368
903888861_903888873 10 Left 903888861 1:26556729-26556751 CCACCCACACCAGGGCTCTGGCC 0: 1
1: 0
2: 9
3: 62
4: 515
Right 903888873 1:26556762-26556784 CATCTTGGCCACAGGAAGGGTGG 0: 1
1: 0
2: 2
3: 24
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903888861 Original CRISPR GGCCAGAGCCCTGGTGTGGG TGG (reversed) Intronic
900122803 1:1056130-1056152 GGCCAGCGCGCTGGTGAGGATGG - Intergenic
900165579 1:1243157-1243179 GGAGAGAGCCCTGGGGAGGGTGG + Intronic
900179156 1:1303760-1303782 GGGCTGAGCCTTGGTGTGGCTGG - Intronic
900186375 1:1335023-1335045 GGACAGAGCCCAGGTGGGGTGGG + Exonic
900191979 1:1355827-1355849 GGGCAGGGCCCTGGTGGGGGAGG + Intronic
900294558 1:1942504-1942526 GGGCAGAGCCCTGGAGGGAGGGG - Intronic
900491522 1:2951615-2951637 AGCCAGGGCTCTGGAGTGGGTGG - Intergenic
900626850 1:3612214-3612236 GGACAGTGGCCTGGAGTGGGTGG + Intergenic
900642869 1:3695649-3695671 GGACAGGGCCCTGGGGCGGGGGG + Intronic
901185752 1:7372044-7372066 GGTCAGAGCCCGGGTGGGGCAGG - Intronic
901633012 1:10656988-10657010 GGCCCGAGCCCTGGGATGGAAGG + Intronic
901876622 1:12170310-12170332 GGACAGAGCCCAGGTCTGTGAGG - Intronic
902286916 1:15412980-15413002 TGCCAGGGCCCGGGTGAGGGTGG + Intronic
902294704 1:15459072-15459094 GGCCAGAGCCCAGGAGTTGGAGG - Intronic
902782061 1:18711368-18711390 GGCCAGGGCACAGGTGAGGGGGG - Intronic
902954165 1:19913439-19913461 AGCCAGAGCCCTTGTGTGGATGG - Intergenic
903160799 1:21487819-21487841 AGCCACAGGCCAGGTGTGGGTGG - Intergenic
903888861 1:26556729-26556751 GGCCAGAGCCCTGGTGTGGGTGG - Intronic
904260696 1:29285965-29285987 AGCCAGAGCCCAGGTGGGGAAGG - Intronic
904411095 1:30325354-30325376 ATCCAGAGCCCTGATGTGAGTGG - Intergenic
904466393 1:30710571-30710593 GGAAAGAGCCCTGATTTGGGAGG + Intergenic
904492136 1:30867802-30867824 GGACAGAGCCCTGGTGCCCGGGG - Intergenic
904684020 1:32247915-32247937 GGACAGAGCACTGGTGTTGGGGG + Intronic
905482590 1:38271633-38271655 GGCCAGAGCACTGGAGCAGGGGG - Intergenic
905522117 1:38608332-38608354 GAGCACAGCCCTGGTGTGGAGGG - Intergenic
905631853 1:39523138-39523160 GCCCAGCCCCCTGGGGTGGGAGG + Intronic
905665907 1:39763049-39763071 GCCCAGCCCCCTGGGGTGGGGGG - Intronic
906041888 1:42793913-42793935 TGGCAGAGCCCTGGGCTGGGAGG + Intronic
906144704 1:43553009-43553031 GGCCGGAGCCCCGGGGTGGATGG + Intronic
906658568 1:47566271-47566293 TTCCAGAGCCCTGTTGTGGGAGG - Intergenic
906673392 1:47676446-47676468 GGAAAGAGCCCTTTTGTGGGGGG - Intergenic
906748041 1:48235239-48235261 GGCTAAAGCCCTGGCTTGGGAGG - Intronic
909240402 1:73205526-73205548 GGCCACAGTCCTGGGGTGCGAGG - Intergenic
909837194 1:80270985-80271007 GGCCAGACACTAGGTGTGGGAGG + Intergenic
909979463 1:82081475-82081497 AGCCTGAGACCTGGGGTGGGAGG + Intergenic
910767325 1:90794745-90794767 AAACACAGCCCTGGTGTGGGGGG - Intergenic
912863117 1:113232559-113232581 GGCTAGAGCCTGGGTGGGGGCGG + Intergenic
913212312 1:116591768-116591790 TGCCAGAGCCCTGCCCTGGGCGG + Intronic
913572203 1:120131838-120131860 AGCCAGAGCCCTGGTGGGATGGG + Intergenic
913681251 1:121188111-121188133 GGGCGGAGACCGGGTGTGGGTGG - Intronic
913703973 1:121399606-121399628 GGCCCGGGCCTTGGTGGGGGTGG - Intergenic
913942620 1:125122102-125122124 GGCCCGGGCCTTGGTGGGGGTGG - Intergenic
913980323 1:143501314-143501336 GGCCCGGGCCTTGGTGAGGGTGG - Intergenic
914074671 1:144326802-144326824 GGCCCGGGCCTTGGTGAGGGTGG - Intergenic
914104505 1:144639644-144639666 GGCCCGGGCCTTGGTGAGGGTGG + Intergenic
914293123 1:146293482-146293504 AGCCAGAGCCCTGGTGGGATGGG + Intergenic
914554167 1:148744265-148744287 AGCCAGAGCCCTGGTGGGATGGG + Intergenic
914908154 1:151763431-151763453 GGGCAGAGCTCTGCTGCGGGCGG - Exonic
915751398 1:158213806-158213828 AGCCACAGCCCTGGCATGGGGGG - Intergenic
916069164 1:161159899-161159921 GGCTAAAGCCCTGCTGTGGTGGG + Intronic
916426802 1:164688608-164688630 GGTCATGGCCCTGGTGTGAGTGG - Intronic
917676055 1:177320709-177320731 GCCCAAAGCCCTGTTGGGGGTGG + Intergenic
918106438 1:181419338-181419360 AGGCAGAGGCCTGATGTGGGAGG - Intronic
919941094 1:202286873-202286895 TCCCATTGCCCTGGTGTGGGGGG + Intronic
922450930 1:225736651-225736673 GGCTACAGCCCTGGTGGGGAGGG + Intergenic
922607212 1:226897091-226897113 GGTCAGAGACCTGGGATGGGGGG + Intergenic
922774881 1:228210100-228210122 CCCCAGAGCCCTGCTGTGGGTGG + Intronic
923220724 1:231890561-231890583 GGCTCCAGCCCTGGTGAGGGAGG + Intronic
923582176 1:235228377-235228399 GGCCTGAGCCCTGGAGGTGGAGG - Intronic
924639045 1:245816068-245816090 GGTCAAAGCCCTGGGGTGTGGGG + Intronic
1062807651 10:436475-436497 GGAGAGAGCTCTGGTGTGGGCGG - Intronic
1062807664 10:436535-436557 GCTCAGAGCTCAGGTGTGGGTGG - Intronic
1062807740 10:436945-436967 GGAGAGAGCTCAGGTGTGGGTGG - Intronic
1062807754 10:437005-437027 GGAGAGAGCTCAGGTGTGGGTGG - Intronic
1062807787 10:437178-437200 GGAGAGAGCTCAGGTGTGGGTGG - Intronic
1062807810 10:437296-437318 GCTCAGAGCTCAGGTGTGGGTGG - Intronic
1062807823 10:437352-437374 GCTCAGAGCTCAGGTGTGGGTGG - Intronic
1062834553 10:627176-627198 AGGCAGAGTCCTGGTGTGTGGGG - Intronic
1063171393 10:3513090-3513112 TGCCTCAGCCATGGTGTGGGAGG - Intergenic
1063196986 10:3752818-3752840 GGGCACAGCCCTGGGGTGGTGGG + Intergenic
1063598965 10:7462948-7462970 GGCAAGGGCCCTGCTCTGGGAGG + Intergenic
1064137112 10:12760697-12760719 GGACAGAACCCAGGTGTGGCTGG + Intronic
1064353257 10:14596084-14596106 GGCCAGAGGGCCTGTGTGGGAGG - Intronic
1066362586 10:34745559-34745581 GCCCAAAGCCCTGGAGTGGGAGG - Intronic
1067578759 10:47425936-47425958 CTCCATAGCCCTGGTGGGGGTGG - Intergenic
1069495555 10:68900784-68900806 GGCCACAGGCCTGGCGTCGGTGG - Intergenic
1069827478 10:71262978-71263000 AGCCAGGGCCCTGGTTTAGGTGG + Intronic
1069919801 10:71809735-71809757 GGCATGAGCCCTGGGGTAGGTGG - Intronic
1070129875 10:73648519-73648541 GGCCAGGGCTCTGGGCTGGGAGG - Exonic
1072800681 10:98390507-98390529 GGCCTGATCCCTGCTGTGGGTGG + Intronic
1073102113 10:101011875-101011897 GTCCTGAGCCCTGCTGGGGGTGG - Intronic
1073176966 10:101562532-101562554 GGGCAGGGCCCTGGTGAGGGAGG + Intergenic
1073447737 10:103591328-103591350 GGCCAGGGCCCTGGGTGGGGAGG + Exonic
1074564096 10:114561171-114561193 GGCCAGAGCCCGGGTATGCTAGG - Intronic
1075975754 10:126692545-126692567 GGCCAGATTACTGGTCTGGGTGG + Intergenic
1076162644 10:128257134-128257156 GGCAGGAGTCCTGGTGTGGTTGG - Intergenic
1076170192 10:128312705-128312727 GGTCAGAGCCCTGGGGAAGGAGG - Intergenic
1076295157 10:129378329-129378351 GGCCAGAGCACGCCTGTGGGAGG - Intergenic
1076497278 10:130905420-130905442 GGCCAGAGCAGGGGTGTGGGAGG - Intergenic
1076829905 10:132988982-132989004 GGCCTGAGGCCCGGTGGGGGGGG + Intergenic
1076829955 10:132989104-132989126 GGCCTGAGGCCTGGTGGGGGGGG + Intergenic
1076829972 10:132989146-132989168 GGCCCGAGGCCCGGTGGGGGGGG + Intergenic
1077049469 11:560402-560424 GCGCAGAGTCCTGGTGCGGGAGG - Intronic
1077059006 11:609641-609663 GTCCAGAGCCCTGGTGAAGCGGG + Exonic
1077377047 11:2209981-2210003 GGCCAGAGGGCTGGTGAGAGTGG - Intergenic
1077488567 11:2850192-2850214 GGCCAGGGTCCCGGGGTGGGCGG - Intergenic
1077571893 11:3346418-3346440 GGCCAGGGCACAGGTGGGGGTGG + Intronic
1077943751 11:6872566-6872588 GGCCTGAGCCCAGGTGTTTGAGG - Intergenic
1078096610 11:8301192-8301214 ACCAAGAACCCTGGTGTGGGTGG + Intergenic
1079338991 11:19596594-19596616 GGCCACTGCCCTGGTGTCCGGGG - Intronic
1080380208 11:31761780-31761802 GCCCAAATCCCTGGTCTGGGTGG - Intronic
1080720597 11:34844632-34844654 GGCCAGAGCCTAGGTTGGGGCGG + Intergenic
1081865477 11:46357425-46357447 GGCAACAGCCTTGGTTTGGGTGG - Intronic
1083184278 11:61008321-61008343 GACCAGAGACCTGGTGGGCGGGG - Intronic
1083619270 11:64040908-64040930 GGCCAGGCCCCAGGTGTGGCAGG + Intronic
1083726479 11:64631087-64631109 TGCTAATGCCCTGGTGTGGGTGG - Intronic
1083957486 11:65993156-65993178 GGCCAGGGCCGGGGGGTGGGAGG - Intergenic
1083995310 11:66268826-66268848 GGGCAGAACCCGGATGTGGGGGG - Intronic
1083998457 11:66283675-66283697 GGCCTCAGCCCTGGGGAGGGAGG + Exonic
1084043805 11:66557609-66557631 GGCCACAGCCTGGGTGTGGGTGG + Intronic
1084264271 11:67996898-67996920 GGGCGGGGCCCTGGTTTGGGAGG - Intronic
1084265490 11:68003449-68003471 AGCCAGAGCCTCGGTGTGGGTGG - Intronic
1084530988 11:69727620-69727642 GGTCAGAGCCATGATGGGGGTGG + Intergenic
1084701074 11:70786394-70786416 GGCCAGAGCCTTGGTGGTGCTGG + Intronic
1085523447 11:77151260-77151282 GGCTGGAGCCCTGATCTGGGAGG + Intronic
1088522038 11:110711531-110711553 ATCCAGGACCCTGGTGTGGGGGG + Intronic
1088651003 11:111958213-111958235 GTCCACAGCCATGGTTTGGGTGG - Intronic
1089177381 11:116558457-116558479 GGGCAGAGCCCTGGAGGGAGGGG + Intergenic
1089190316 11:116648827-116648849 GGCCAGGTCCCTAGTGTGGATGG + Intergenic
1089644566 11:119870153-119870175 GGTCAGAGCCCTGGGGAGTGTGG - Intergenic
1089773966 11:120823347-120823369 GGGAAGAGCCCTGGGCTGGGAGG - Intronic
1090452545 11:126819449-126819471 GGGCAGGGCCATTGTGTGGGAGG + Intronic
1091767807 12:3133247-3133269 GGACAGAGCCCTGAAGTGGGAGG - Intronic
1092013750 12:5139219-5139241 GCCCAGGGCCTTGGTGAGGGTGG + Intergenic
1092056559 12:5512498-5512520 AGCCAGCGCCCTGGTGTGTGGGG - Intronic
1092246325 12:6866372-6866394 GCCCAGCCCCCTGGTGTGGAGGG + Exonic
1092270513 12:7019420-7019442 GCCCAGAGCCACGGAGTGGGAGG + Intronic
1092331391 12:7590125-7590147 GGCCAGCCCCCTCGTCTGGGAGG - Intergenic
1093707436 12:22289687-22289709 GGCCAGAGCCATGGTCTTGTTGG - Intronic
1094000954 12:25693515-25693537 GGCCAGAGTTCTAGTGTGGCTGG + Intergenic
1094491594 12:30964092-30964114 GGCCCCAGCCCTGGAGTGGGAGG + Intronic
1096217114 12:49803865-49803887 AGCCAGAGCCCTGGGGAGGCAGG - Intronic
1097192224 12:57225032-57225054 GGCCAGCGCCCCCGTGTGGTTGG - Exonic
1097251118 12:57632750-57632772 GGTCAGTGCCCGGGGGTGGGTGG - Exonic
1098176292 12:67795091-67795113 GGCTAGATTCCTGCTGTGGGAGG + Intergenic
1101937361 12:109069291-109069313 GCCCAGATGCCTGGTGTGTGAGG + Intronic
1102151264 12:110690091-110690113 GGCCAGAATCAAGGTGTGGGTGG + Intronic
1103004228 12:117408686-117408708 GCCCAGAGCCCTGGAAGGGGAGG - Intronic
1103202308 12:119097762-119097784 TGCCAGAGCCCTGGGGTGTAAGG - Intronic
1103701642 12:122851123-122851145 CACCAGAGCCATGGTGTCGGCGG + Intronic
1103968452 12:124654812-124654834 AGCCGGAGGCCTGGTGTGGCGGG - Intergenic
1104965397 12:132506787-132506809 GCCCAGAGCCCTGCTGTGAGCGG - Intronic
1105034053 12:132905487-132905509 GGCTTGAGCCCTGGAGAGGGAGG + Intronic
1105215558 13:18282391-18282413 TGCCAGAGCCCTGCCCTGGGCGG + Intergenic
1105767897 13:23579276-23579298 GGCGAGAGCCGCGGTGAGGGCGG + Intronic
1105811877 13:24002536-24002558 GGCCTGAGGCCTGGTCAGGGGGG + Intronic
1106243442 13:27927783-27927805 GGCCGGAGCCTTGGAGAGGGCGG - Intergenic
1106593173 13:31115207-31115229 GGGAAGAGGCCTGGTGTGTGTGG + Intergenic
1112333799 13:98497678-98497700 GTCCAGAGCCAGGGTGTGGGTGG - Intronic
1113710648 13:112462160-112462182 GGCCGCAGCCTGGGTGTGGGCGG + Intergenic
1113764682 13:112874063-112874085 GGCCAGTGCCTCGTTGTGGGAGG - Intronic
1114523502 14:23352989-23353011 GGCCAGGGCCCAGGGGAGGGAGG + Intergenic
1114650170 14:24279728-24279750 GCCCAGAGCACTGGTGGAGGTGG + Intergenic
1115162375 14:30410527-30410549 ACCCAGAGCCCTGGTGGGGTAGG + Intergenic
1117554688 14:56872120-56872142 GGCTTGAGCCCTGGGGTTGGAGG - Intergenic
1117632463 14:57708182-57708204 AGCCAGATCACTGGTGTGGGTGG - Intronic
1118309299 14:64680902-64680924 GGGTATAGCCATGGTGTGGGCGG - Intergenic
1118778377 14:68988898-68988920 GGCCAAGGCCAAGGTGTGGGGGG - Intergenic
1119109416 14:71957600-71957622 GTTCAGAGCCCTGGTGAGAGAGG + Intronic
1119189441 14:72670389-72670411 GGTCAGGGCCCAGGTGTGGAGGG + Exonic
1119228630 14:72962891-72962913 TGCCAGAACTCTAGTGTGGGTGG + Intergenic
1119261658 14:73241330-73241352 GGCCAAAGCCCAGGTGGAGGGGG + Intronic
1120680756 14:87477848-87477870 GAGAAGGGCCCTGGTGTGGGAGG - Intergenic
1120993595 14:90398260-90398282 GGCCTCAGCCCTGGTGCGCGGGG + Intronic
1121491468 14:94364218-94364240 GGCCAGAGGGCTGGGGAGGGTGG - Intergenic
1121612312 14:95289897-95289919 GGCCAACCCCCTGGTGGGGGAGG - Intronic
1122071863 14:99210127-99210149 GGCCAGAGCCCAGGGGAAGGAGG + Intronic
1122232996 14:100316379-100316401 GGACAGAGCCAGGGTGTGGTGGG + Intergenic
1122853407 14:104548586-104548608 GGCCTGAGTCCTGGGGTGTGAGG + Intronic
1122905191 14:104798339-104798361 GCCCAGAGCCCCAGTGTGGCAGG + Intergenic
1123012972 14:105358100-105358122 GGGCAGAGCTATGGTGTGGCAGG - Intronic
1123044348 14:105504070-105504092 GGGCAGAGCCCTGGGCTGGTGGG + Intergenic
1202939505 14_KI270725v1_random:134066-134088 GGCCCGGGCCTTGGTGGGGGTGG + Intergenic
1123393636 15:19901849-19901871 GGCCCGGGCCTTGGTGGGGGTGG - Intergenic
1124963790 15:34418574-34418596 GGGCAGAGACCAGATGTGGGAGG + Intronic
1124980410 15:34564805-34564827 GGGCAGAGACCAGATGTGGGAGG + Intronic
1125347035 15:38728680-38728702 GGCCAGAGCCAGGGTGGGAGTGG + Intergenic
1125757237 15:42072004-42072026 GGCCTGAGCCCTGCTGTGCCTGG + Intronic
1126096514 15:45094527-45094549 GGCCAGAGTCCCAGGGTGGGAGG + Intronic
1126872150 15:53001474-53001496 GGACAGAACCCTGGACTGGGAGG + Intergenic
1127260275 15:57322388-57322410 GGCCAGGGCACTGGGGTAGGAGG - Intergenic
1128064482 15:64755837-64755859 TGTCAGGGCCCTGGAGTGGGTGG - Intronic
1128314181 15:66649929-66649951 GGGCAGAGCCCAGGTGTGGCTGG - Intronic
1128727625 15:69999547-69999569 GGCCAAGGCCCTGAGGTGGGTGG - Intergenic
1129542622 15:76363318-76363340 GCCCAGAGCTCTGGTGTGGTAGG - Intronic
1129599782 15:76992017-76992039 GGCCTGGGCCTGGGTGTGGGTGG + Intergenic
1129966960 15:79744575-79744597 TGCCAGAACTCTAGTGTGGGTGG + Intergenic
1130887647 15:88107555-88107577 AGACAGAGTCCTGGTGTGGATGG - Intronic
1131056479 15:89378172-89378194 GACCAGAGCCAGGGAGTGGGTGG + Intergenic
1131344489 15:91633372-91633394 GGGCACAGCCCTGGAGTGGGTGG + Intergenic
1132396350 15:101477931-101477953 GGCCAGAGCCCTGATAAGGAGGG + Intronic
1132503640 16:296306-296328 GGCCAGGGCCTGGGTGAGGGTGG + Intronic
1132568160 16:632523-632545 GGCCAGAGCCCCGGGGCGGGGGG + Intronic
1132688842 16:1173305-1173327 GGCCAGAGCCCTGGGGTAGTGGG + Intronic
1132793583 16:1706930-1706952 GGCCAGGGCCCAGGCCTGGGCGG - Intronic
1132844523 16:1993689-1993711 GGCCCCTGCCCAGGTGTGGGTGG + Exonic
1132903471 16:2270719-2270741 GGCCAGAGCCCTGCAGTGCTGGG + Intergenic
1132977134 16:2716471-2716493 ACCCAGGGCCCTGGGGTGGGAGG - Intronic
1132991509 16:2798168-2798190 GGCCAGGCCCCTGGTGCTGGAGG + Intergenic
1135326067 16:21526575-21526597 CACAAGAGCCCTGGGGTGGGAGG + Intergenic
1135397348 16:22141416-22141438 AGCCAGAGACCTGGCGGGGGAGG + Intronic
1135594808 16:23733780-23733802 GACTAGATCCCAGGTGTGGGTGG + Intergenic
1135742593 16:24989162-24989184 AGTCAGAGCCCAGGTGTGGAGGG - Intronic
1135754960 16:25089508-25089530 AGTCAGAGCCCAGGTGTGGAGGG - Intergenic
1136014149 16:27384061-27384083 GATGAGGGCCCTGGTGTGGGTGG - Intergenic
1136315965 16:29454918-29454940 GGCGAGGGCCCTGGTGAGAGGGG + Exonic
1136430542 16:30194260-30194282 GGCGAGGGCCCTGGTGAGAGGGG + Exonic
1136552121 16:30987361-30987383 GGCCTGAGCCCAGGAGTTGGAGG + Intronic
1136648021 16:31640018-31640040 TGGCAGAGCACTGGTGAGGGTGG + Intergenic
1136695921 16:32081969-32081991 GGCCCGGGCCTTGGTGGGGGTGG + Intergenic
1136699640 16:32119218-32119240 GGCCCGGGCCTTGGTGGGGGTGG - Intergenic
1136768018 16:32808703-32808725 GGCCCGGGCCTTGGTGGGGGTGG + Intergenic
1136796416 16:33025222-33025244 GGCCCGGGCCTTGGTGGGGGTGG + Intergenic
1136868285 16:33773542-33773564 GGCCCGGGCCTTGGTGGGGGTGG - Intergenic
1136958031 16:34806405-34806427 GGCCCGGGCCTTGGTGGGGGTGG - Intergenic
1137270118 16:46897770-46897792 GGGCAGGGCCCTGGGCTGGGCGG + Intronic
1137570843 16:49565453-49565475 GGGCAGAGCCCTAGTGAGAGGGG - Intronic
1138552231 16:57754193-57754215 AGCCTGTGCCCTGGTGTGTGGGG + Intronic
1138597310 16:58035896-58035918 GGCCAGGTCCCTGGTGTGGCTGG - Intronic
1141048580 16:80739699-80739721 GCTCAGAGCTCAGGTGTGGGAGG + Intronic
1141278368 16:82608089-82608111 GGCCAGAGGGCTAGTGTGGGAGG + Intergenic
1141375132 16:83523532-83523554 GCAGAGAGTCCTGGTGTGGGGGG - Intronic
1141624769 16:85255263-85255285 GGCCAGAGCCTGGGCTTGGGAGG + Intergenic
1141761917 16:86034158-86034180 GGCCTGAGACCTGGTGTGCTGGG - Intergenic
1142039105 16:87881300-87881322 CACAAGAGCCCTGGGGTGGGAGG + Intergenic
1142068224 16:88074721-88074743 CACCAGGGCCCTGGGGTGGGTGG - Intronic
1142196062 16:88739837-88739859 GGCCAGGGCCAGGCTGTGGGTGG - Intronic
1142433461 16:90042918-90042940 GGGCAGAGCTGTGGTCTGGGAGG - Intronic
1203070408 16_KI270728v1_random:1070723-1070745 GGCCCGGGCCTTGGTGGGGGTGG + Intergenic
1203073698 16_KI270728v1_random:1105792-1105814 GGCCCGGGCCTTGGTGGGGGTGG + Intergenic
1203103889 16_KI270728v1_random:1342734-1342756 GGCCCGGGCCTTGGTGGGGGTGG + Intergenic
1203129625 16_KI270728v1_random:1619634-1619656 GGCCCGGGCCTTGGTGGGGGTGG - Intergenic
1142632089 17:1231660-1231682 GGGCAGAGACCAGATGTGGGAGG - Intergenic
1142847540 17:2689602-2689624 TGTCAGAGCCCTGGTGGGGGAGG - Exonic
1142864862 17:2784691-2784713 GTGCAGAGCCCTGCTGAGGGTGG + Intronic
1143092174 17:4455449-4455471 GCCCAGAGGCGGGGTGTGGGGGG + Intronic
1143099389 17:4497123-4497145 GGACAGAGTCCAGCTGTGGGAGG - Intergenic
1143125772 17:4640161-4640183 GCTCAGAGCCCAGGTGTGGGGGG + Intronic
1143402704 17:6656661-6656683 GCTCAGAGCCCAGGTGTGGGGGG - Intergenic
1144803856 17:17950880-17950902 GGCCAGAGCCTTGGTGCAGAGGG + Intronic
1145007043 17:19343976-19343998 GGCCTGACTCCTGGTGGGGGTGG - Intronic
1145901805 17:28494667-28494689 GGTTAGAGCCCTCATGTGGGAGG + Intronic
1147041698 17:37724232-37724254 TGCCAGTTCCCTGGGGTGGGGGG - Intronic
1147263099 17:39220060-39220082 GGCCAAAGCCCTGGGGTGTCTGG + Intronic
1147557521 17:41488852-41488874 AGCCACACCCCAGGTGTGGGGGG + Intronic
1147655563 17:42088679-42088701 GGCCAGAGCCTGGGTGTTGGGGG + Intergenic
1147864884 17:43545659-43545681 GGGCCGAGACCTGGTGGGGGAGG + Exonic
1148078954 17:44956858-44956880 CCCCAGATCCCTGGTCTGGGTGG + Intergenic
1148689057 17:49516255-49516277 TCCCTGACCCCTGGTGTGGGTGG - Intergenic
1148735595 17:49862982-49863004 GGGCGGAGTCCTGGTGGGGGAGG + Intergenic
1148754041 17:49963209-49963231 GTCCCCAGGCCTGGTGTGGGGGG - Intergenic
1148851650 17:50558600-50558622 GTCCAGAGCCCAGGGGTGGCCGG + Intergenic
1149347525 17:55753093-55753115 GGCCAAAGCCTTGATGTGGCTGG - Intronic
1152109134 17:78347693-78347715 AGCCAGAGTCCTGGAGTGGAGGG - Intergenic
1152235186 17:79134950-79134972 GGGCAGAGACTTGGTGAGGGAGG + Intronic
1152442407 17:80317056-80317078 GGGGAGAGCCCTGGTGTTCGCGG + Intronic
1152580968 17:81165532-81165554 GTCCGGGGCCCTGGCGTGGGAGG - Intronic
1152651035 17:81493063-81493085 GGCCAGAGCCCTGGGATAGATGG + Intergenic
1152709629 17:81864598-81864620 GGTCAGAGCCCTCCTGTGGCTGG + Intergenic
1152762598 17:82116864-82116886 GGAGAGGGCCCTGCTGTGGGGGG - Intronic
1152817742 17:82418351-82418373 GGACAGGGCCATGGAGTGGGCGG - Exonic
1153967176 18:10192473-10192495 GTCCAGAGCCAAGGTGTGGCAGG - Intergenic
1153979532 18:10297338-10297360 AGCCAGTGCCGTGGTGTGTGGGG + Intergenic
1154029282 18:10737395-10737417 AGCCAGAGCGCTGTTGTTGGTGG - Intronic
1154330139 18:13422612-13422634 GGCTTGAGCCCAGGTGTTGGAGG + Intronic
1155211905 18:23609248-23609270 GGCCAGATTACTGGTCTGGGTGG - Intronic
1156622035 18:38864275-38864297 GGGCAGAAGCCTAGTGTGGGGGG + Intergenic
1156674144 18:39507417-39507439 GGCCAGATTACTGGTCTGGGTGG - Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1158770781 18:60514493-60514515 GGCCCGAGCCTTGGCGAGGGGGG - Intergenic
1159060567 18:63510198-63510220 GGAAAGAACCCTGGTGTGGGAGG + Intergenic
1159844289 18:73440152-73440174 TGGCAGTGACCTGGTGTGGGAGG + Intergenic
1159888483 18:73933146-73933168 GCCCAGAGTCCTGGGGTGGGAGG + Intergenic
1159957944 18:74533070-74533092 GGCCAGAGCCTTGGGTTGAGGGG - Intergenic
1160399823 18:78602042-78602064 GGGGTGAGCACTGGTGTGGGTGG - Intergenic
1160604397 18:80038384-80038406 TGCCAGAGCCCTGGCTTGGGTGG + Intronic
1160605026 18:80043706-80043728 GGCCATTGCCATGGTGTGGGTGG + Intronic
1160775536 19:853439-853461 GGCCAGAGGCCTGGGGAGGGTGG + Intronic
1160821898 19:1062817-1062839 GAGCAGGGCCATGGTGTGGGTGG - Intronic
1160821922 19:1062895-1062917 GGGCGGGGCCATGGTGTGGGTGG - Intronic
1160821934 19:1062934-1062956 GGGCGGGGCCATGGTGTGGGTGG - Intronic
1160821946 19:1062973-1062995 GGGCGGGGCCATGGTGTGGGTGG - Intronic
1160821969 19:1063051-1063073 GGGCAGGGCCATGGTGTGGGTGG - Intronic
1160821999 19:1063165-1063187 GGGCGGGGCCATGGTGTGGGTGG - Intronic
1160822020 19:1063240-1063262 GGGCGGGGCCATGGTGTGGGTGG - Intronic
1160822032 19:1063279-1063301 GGGCAGGGCCATAGTGTGGGTGG - Intronic
1160822045 19:1063318-1063340 GGGCGGGGCCATGGTGTGGGTGG - Intronic
1160822057 19:1063357-1063379 GGGCGGGGCCATGGTGTGGGTGG - Intronic
1161055863 19:2190380-2190402 GGAGGGAGCCCTGGTGGGGGTGG + Intronic
1161129426 19:2579377-2579399 GGCCAGGGCGCAGGTCTGGGTGG - Intronic
1161576740 19:5058560-5058582 GGCCAGGGCCTGGGTGTGGTGGG + Intronic
1161585309 19:5102475-5102497 GGCCAGAGCCTGGGGGAGGGTGG + Intronic
1161673185 19:5625706-5625728 TGACAGAGTCCTGGGGTGGGAGG + Intronic
1162107714 19:8380546-8380568 GCCCAAAGCCCTGTTGTAGGGGG + Intronic
1162366979 19:10255656-10255678 GGCCAGACCTCTGGGGTGGATGG - Intronic
1162403020 19:10457499-10457521 GCCAAGAGTGCTGGTGTGGGGGG - Intronic
1162476764 19:10905119-10905141 GCCCAGAGCCCTGGTGGGCAGGG + Intronic
1162860524 19:13503587-13503609 GGACAGAGACCTGGGGAGGGAGG - Intronic
1163567166 19:18058636-18058658 GGTCTGAGCCGAGGTGTGGGGGG - Intergenic
1164921739 19:32093520-32093542 GCACAGAGCTCTGGTGTGAGTGG + Intergenic
1165331528 19:35143220-35143242 GGGGGGAGCCCTGGCGTGGGGGG - Intergenic
1165353651 19:35291020-35291042 GGCCAGAGCAGTGGGGAGGGGGG - Intergenic
1165432526 19:35780847-35780869 GGCCAGGGGCCTGGTGGGGTAGG - Intronic
1165432595 19:35781098-35781120 GGCCGCAGCCCTGGTGTGACGGG - Intronic
1165450456 19:35879253-35879275 TTCCTGAGCCCGGGTGTGGGCGG + Intronic
1165999768 19:39871065-39871087 GGTCAGGGCCAGGGTGTGGGGGG + Intronic
1166002448 19:39885891-39885913 GATCAGAGCCCTGGGGAGGGAGG + Intronic
1166005232 19:39902143-39902165 GATCAGAGCCCTGGGGAGGGAGG + Intronic
1166042965 19:40214209-40214231 GGCCATGGCCCTGGTGAGTGAGG + Exonic
1166104620 19:40591121-40591143 GGCCACGGGGCTGGTGTGGGTGG - Exonic
1166185094 19:41134636-41134658 GGGCAGAGACCCGATGTGGGAGG - Intergenic
1166344152 19:42155009-42155031 GGCCAAGGCCCTGGTGTGTGTGG - Intronic
1166732669 19:45067744-45067766 GGACACAGCCCTGGCCTGGGGGG + Intronic
1166776455 19:45315745-45315767 AGACAGAGCCCAGGTATGGGTGG - Intronic
1166781379 19:45345283-45345305 GGGCAGAACCCTGGGTTGGGAGG + Intronic
1166813111 19:45526068-45526090 GGCAAGAGCCCTGTTTTGGAAGG + Intronic
1166863192 19:45821349-45821371 GGCCAGGCCACTGGAGTGGGGGG + Intronic
1167425774 19:49429004-49429026 GGCCTGAGCCCTGGGGTGGGAGG + Intergenic
1167441896 19:49513489-49513511 GGCCAGGGCCCTGCTGCAGGCGG + Intronic
1167590471 19:50401986-50402008 GGCCCGAAACCTGGTGTGGGAGG - Exonic
1167906450 19:52664737-52664759 GACAAGGGGCCTGGTGTGGGGGG + Intronic
1168110077 19:54187263-54187285 GGCCAGAGCCAGGGCGTGGCAGG + Exonic
1168592320 19:57647609-57647631 AGTCTGAGCCTTGGTGTGGGCGG - Intergenic
1202670203 1_KI270709v1_random:42917-42939 GGCCAGAGCCTTTGTGGCGGTGG - Intergenic
925048090 2:789744-789766 GTCCACAGCCGTGGTTTGGGTGG - Intergenic
925283160 2:2698968-2698990 GTCCAGAGGCCTGGGGTGGAAGG + Intergenic
925945393 2:8857805-8857827 GCGCAGAGCCCTGGCATGGGGGG + Exonic
926163627 2:10504883-10504905 GGCCAGAGTCCTGGGGTGGCTGG + Intergenic
927135475 2:20093493-20093515 GGGCACAGTCCTGGTGTGTGGGG - Intergenic
927542490 2:23926197-23926219 GGCCAGAGCCCCTGGGTGGAAGG - Intronic
927948971 2:27154726-27154748 GGGCAGAGGCCAGGTGTGGGAGG + Exonic
927954506 2:27199184-27199206 GGGCAGAGGCCAGGTGTGGGAGG + Intergenic
927972888 2:27316774-27316796 GGCCAGAGGCCTGATGGGGCAGG + Intronic
929235858 2:39605044-39605066 GGTCAGAGGACTGGTGCGGGTGG - Intergenic
929278247 2:40048798-40048820 GGCCAGGGACCTGGTGGTGGAGG + Intergenic
929438906 2:41949999-41950021 GTCCAGGGCCGTGGTGGGGGAGG + Intronic
929460303 2:42098443-42098465 GGCCAGGAGCCTGGTGGGGGTGG - Intergenic
929562477 2:42964474-42964496 GGCCAGAGGCCTGGGCTGGAAGG - Intergenic
930216934 2:48707299-48707321 GGCCAGAGCTCTCCTGTGTGAGG + Intronic
931345447 2:61441287-61441309 GGGCAGAGCCTGGGTGTGGTGGG - Intronic
932416776 2:71578348-71578370 GGCCAGGGTCCTGGAGAGGGAGG + Intronic
932702095 2:73999117-73999139 GGACACAGCCATGGTGAGGGAGG + Intronic
934028015 2:88017086-88017108 GGCCGCAGCCAGGGTGTGGGTGG + Intergenic
934298770 2:91764334-91764356 TGCCAGAGCCCTGCCCTGGGCGG - Intergenic
936018282 2:108975691-108975713 GGCCAGAGCCCTGTGGTGGTCGG + Intronic
937260792 2:120585867-120585889 GCCCAGAGCCCTAGGGTAGGGGG + Intergenic
938068584 2:128294748-128294770 TCCCAGAGCCTGGGTGTGGGAGG - Intronic
938116118 2:128603903-128603925 GTGCAGAGCCCTGGGCTGGGCGG - Intergenic
938517844 2:132035466-132035488 GGCCCGGGCCTTGGTGGGGGTGG + Intergenic
946176308 2:217923863-217923885 GGCATCAGCCCTGGTCTGGGAGG - Intronic
946234947 2:218318360-218318382 GGCCAAAGCCCTGGAGTGCATGG + Intronic
946339496 2:219058701-219058723 GGCCAGGGCCTTGGTCTGAGGGG + Intronic
946399386 2:219460687-219460709 AGCCTGGGCCCTGGTGTGGAGGG - Intronic
946453532 2:219801502-219801524 GGTCAGAGTCCTGGTCTGGCTGG + Intergenic
946966814 2:225044521-225044543 ACCCAGAGCACTGGTGTGAGAGG + Intergenic
947525761 2:230875817-230875839 GGCCAGGGCCTGGGGGTGGGGGG + Intronic
947572325 2:231245919-231245941 GGGCAGAGGCTTGGTGTGGGTGG - Intronic
948099454 2:235361913-235361935 GGACAGAATCCTGGTGTGGAAGG - Intergenic
948141972 2:235680322-235680344 GGCCTGAGCCCTTGTAGGGGTGG + Intronic
948232999 2:236365587-236365609 GGACAGAGCCTTGGGTTGGGAGG + Intronic
948931911 2:241137434-241137456 GGAAAGAGCCCTTCTGTGGGTGG + Intronic
1169542245 20:6612338-6612360 GCCCAGAGCCATTGTGTGAGAGG + Intergenic
1170549993 20:17468505-17468527 GGCCAGCGTCCTGCTGTAGGCGG + Intronic
1170599242 20:17828438-17828460 GGCCAGAGCCAGGGTGGAGGTGG - Intergenic
1170740496 20:19051676-19051698 GGAAAGAGCCCTGGTTTTGGAGG - Intergenic
1170795121 20:19540411-19540433 AGGCAGAGCCCTTGTGTGGAGGG - Intronic
1171336274 20:24388547-24388569 GGCCAGAGCCCTGGAGAGTCAGG + Intergenic
1171447380 20:25214358-25214380 GGCCAGGGCCCTGGTGAAGGTGG + Intronic
1172526571 20:35603301-35603323 GGCCAGGGCCCTGGCGCGGCTGG + Intergenic
1172640144 20:36435937-36435959 GAGCAGAGCCCTGGGCTGGGAGG - Intronic
1173005379 20:39136023-39136045 GCCCAGAGGCTTGGTCTGGGTGG - Intergenic
1175150257 20:56928242-56928264 GGCCTGTGCCCTGGTGGGGATGG + Intergenic
1175172307 20:57089487-57089509 GGCCAGAGCACAAGTCTGGGTGG + Intergenic
1175223536 20:57431858-57431880 GGGCTGAGCCCTGGGGTGGGTGG - Intergenic
1176129032 20:63488473-63488495 GGCCAGAGCCCTGGGGTTGGGGG - Intronic
1176140463 20:63542645-63542667 CGCCAGAGGCCTGGTGTGGGGGG - Intronic
1176257340 20:64159195-64159217 GGCCAGAGCCATGAGGTGGGCGG - Intronic
1176583687 21:8553023-8553045 GGCCCGGGCCTTGGTGGGGGTGG - Intergenic
1177134880 21:17298000-17298022 GCCCAGAGCCCTGTTGCAGGTGG + Intergenic
1178323726 21:31626278-31626300 GGCCAGAACCCTGGAGGCGGAGG - Intergenic
1179239781 21:39579938-39579960 GGCCAGATGACTGGTCTGGGTGG - Intronic
1179563731 21:42233713-42233735 GGTCAGAGTCCTGCTTTGGGAGG + Intronic
1180131640 21:45830499-45830521 CGCGGGAGCCCTGCTGTGGGGGG + Intronic
1180193934 21:46182523-46182545 GGCCAGCTCCCTGATGCGGGAGG - Intronic
1180266497 22:10529956-10529978 GGCCCGGGCCTTGGTGGGGGTGG - Intergenic
1180871948 22:19151119-19151141 GGCCAGAGGACTGGCCTGGGCGG - Intergenic
1181039513 22:20185147-20185169 CGCCAGAGCCTTGGAGAGGGAGG - Intergenic
1182257720 22:29050392-29050414 GGCCAGAGCCCTCGTAGAGGTGG - Exonic
1182283340 22:29230637-29230659 GCCAAGGGGCCTGGTGTGGGAGG - Intronic
1182475367 22:30574085-30574107 GGCCAGAGCCCTAGGGGAGGAGG - Intronic
1182485132 22:30634964-30634986 AGACAGAGCCCTGGGCTGGGAGG - Intergenic
1182522739 22:30893410-30893432 GGCCAGAGCCCTGCATGGGGGGG + Intronic
1182580301 22:31304938-31304960 GGCCACAGCCCTGGGGTTTGGGG - Intergenic
1182592854 22:31395475-31395497 GGCCTGAGCCCTGGAGGCGGAGG + Intergenic
1183173047 22:36201961-36201983 GCTCAGAGCCCTGAGGTGGGAGG - Intronic
1183329664 22:37212496-37212518 GGCCGGAGAGCAGGTGTGGGGGG + Intergenic
1183829193 22:40409040-40409062 GAGGAGAGCCCTGGAGTGGGGGG + Intronic
1184092284 22:42299082-42299104 GCCCAGACCCCTGCTGTGGAGGG + Intronic
1184339806 22:43880078-43880100 GGCCAGAGGCCTGGTGTCCCTGG + Exonic
1184383919 22:44163625-44163647 GCCCAGATCACTGGTGTGAGGGG + Intronic
1184413351 22:44338266-44338288 GGGCAGTGCCCTGGACTGGGTGG + Intergenic
1184508424 22:44917960-44917982 GGCCAGGGCCCTGATGTGGGAGG - Intronic
1184538040 22:45100703-45100725 GGCAAAGGCCCTGGGGTGGGGGG - Intergenic
1184647545 22:45904259-45904281 GGCCAGCTCCCTCCTGTGGGTGG + Intergenic
1184840661 22:47050743-47050765 GGGCAGAACCTTGGGGTGGGTGG + Intronic
1184849289 22:47110825-47110847 GCCCCGAGCCTCGGTGTGGGAGG + Intronic
1203288867 22_KI270735v1_random:15192-15214 GGCCCGAGCCTTGGTGGGTGTGG + Intergenic
950192695 3:10988731-10988753 GCCCAGAGCCCTGGCTTTGGAGG + Intergenic
950494611 3:13326151-13326173 GGCCACAGCCCTGTAGAGGGCGG - Intronic
950633166 3:14297743-14297765 GGCCGGAGCGCTGGCGTTGGGGG - Intergenic
951012798 3:17700030-17700052 TGCCAGAACTCTAGTGTGGGTGG - Intronic
952348595 3:32512094-32512116 GGCTTGAGCCCGGGTGTAGGAGG - Intergenic
952924609 3:38312108-38312130 AGCCAGAGTCCTGGTCGGGGAGG + Intronic
952958404 3:38575000-38575022 CACCAGAGCTCTGGTGTAGGAGG + Intronic
953661412 3:44894146-44894168 GGAGAGAGCCGTGGTGGGGGTGG - Intronic
953883524 3:46703323-46703345 TGCCCCAGCCCTGATGTGGGTGG - Intronic
953901295 3:46845643-46845665 GGCCAGGGCCCTGAGGCGGGAGG + Intergenic
954671686 3:52294417-52294439 GCCCAGAGCCCAGGTGGGGAAGG - Intergenic
954699008 3:52441995-52442017 GGCCAGAGAGCGGGGGTGGGCGG + Intronic
957584301 3:82114517-82114539 GGCCTGAGCCCCTGGGTGGGAGG - Intergenic
957865074 3:86012643-86012665 GGCCAGATGCCAGGAGTGGGTGG + Intronic
958256736 3:91333347-91333369 GGTCACAGTCCTGGGGTGGGAGG - Intergenic
959262257 3:104097808-104097830 AGCCCAAGCACTGGTGTGGGTGG + Intergenic
961042338 3:123686329-123686351 GTCCAGAGCCCAGGAGTGGGAGG - Intronic
961381243 3:126497791-126497813 GGGCAGAGGCTTGGTGTGGGTGG + Intronic
961552815 3:127678866-127678888 GGCCAGGGCCCTGTTTTGTGGGG + Intronic
964459883 3:156912597-156912619 GGCCAGAACCCAGGCGTGAGTGG - Intronic
965530605 3:169766795-169766817 GGGCAGAGCCCAGGAGTTGGAGG + Intergenic
966854340 3:184183921-184183943 GGCCACAGCTCTGGAGTGGGAGG + Exonic
969665918 4:8557640-8557662 GGCCCGAGCCCGGATGTGGCAGG - Intergenic
969716173 4:8869328-8869350 CTCCAGAGCCCTGCAGTGGGAGG - Intronic
969724689 4:8912121-8912143 GGCCACAGGCCTGGCGGGGGAGG + Intergenic
969867549 4:10085531-10085553 GGCCTGAGCCCTGCTGGTGGGGG - Intronic
970148001 4:13057042-13057064 GACCACAGCCCTGCTTTGGGAGG - Intergenic
975666673 4:76740556-76740578 AGCCAGAGACCGAGTGTGGGCGG + Exonic
975707186 4:77122796-77122818 GGCCAGATTACTGGTCTGGGTGG - Intergenic
976398499 4:84582896-84582918 GGCGCGAGACCTGGTGCGGGAGG + Intergenic
977883877 4:102236393-102236415 GCCCAAAGCCCTGATGTAGGGGG + Intergenic
978319797 4:107481276-107481298 AGCCAAAGCACTGGTGTGAGTGG + Intergenic
979115235 4:116815140-116815162 TCCCAGGGCCCTGGTGTGGTAGG - Intergenic
980243110 4:130202336-130202358 GGGCAGATCCCTGGTGAGGCAGG + Intergenic
982122389 4:152155797-152155819 GGTGAGAGCCATGCTGTGGGAGG - Intergenic
985278472 4:188262549-188262571 GTCCACAGCCCTGGCGTGGAGGG + Intergenic
985469839 5:33383-33405 CGCCATGGACCTGGTGTGGGGGG - Intergenic
985501506 5:250541-250563 GAGCAGAGCCCTGGTGATGGTGG - Intronic
985539537 5:481732-481754 GGCCAGGGGCGTGGTGAGGGGGG - Intronic
985682477 5:1263853-1263875 GGACAGGGCCATGGTGTGGGGGG - Intronic
985735373 5:1577090-1577112 GAGCAGAGCCCTGGTGATGGTGG + Intergenic
985985362 5:3511065-3511087 GCCCAGAGCTCTGTGGTGGGAGG - Intergenic
988487401 5:31678282-31678304 GCCCAGAGCTCTGGGGTGAGTGG - Intronic
990341859 5:54831383-54831405 GACCAGGTCCCTGGTGTGGCAGG + Intergenic
991588789 5:68226925-68226947 GGCCGGGGCTTTGGTGTGGGAGG - Exonic
993733382 5:91447887-91447909 GACCAGAGCACTGGAGTTGGGGG - Intergenic
997210866 5:132075949-132075971 GGCCACAGCCATGGTGGGAGTGG + Exonic
997434072 5:133861584-133861606 TGCCAAAGCCATGGTGGGGGTGG - Intergenic
997642171 5:135456409-135456431 GCTCACAGCCCTGGCGTGGGAGG + Intergenic
998011923 5:138702363-138702385 GGCCAGAGCATTGGTGTAAGAGG + Intronic
998039686 5:138944449-138944471 GACCCGGGCCCTAGTGTGGGAGG - Intergenic
998588581 5:143453932-143453954 GGGGAGAGGCCTGGTGGGGGCGG - Intergenic
999218224 5:149954078-149954100 GGCCGGAGCCTGGGAGTGGGAGG - Intergenic
1001275630 5:170348999-170349021 GGCCAGAGCTGTGGCGTGGGAGG - Intergenic
1003290437 6:4775573-4775595 ACCCAGAGGCCTGGCGTGGGGGG + Intronic
1006388803 6:33746880-33746902 CACCAGAGCCCTGGTGCGGGAGG + Exonic
1007227942 6:40328011-40328033 GGGTAGAGGGCTGGTGTGGGAGG + Intergenic
1007237785 6:40403418-40403440 GACCAGAGGCCTGGGGTTGGGGG + Intronic
1007594100 6:43040801-43040823 GGCTGGAGCCTTGGAGTGGGAGG - Intronic
1007701529 6:43769109-43769131 GGCCAGGGGGCTGGTGGGGGCGG - Intergenic
1007728783 6:43933162-43933184 GGCTACAGTCCTGCTGTGGGTGG - Intergenic
1007743168 6:44025098-44025120 GGCCTGAGGCCTGGTGGAGGGGG - Intergenic
1007777222 6:44230502-44230524 GCCCAGTGCCCTGGTGTGGTGGG + Intronic
1008587239 6:52960962-52960984 GCCCAAAGCCCTGTTGTAGGGGG - Intergenic
1008998602 6:57687815-57687837 GGTCACAGTCCTGGGGTGGGAGG + Intergenic
1009949657 6:70380942-70380964 GCCCAGATTACTGGTGTGGGTGG - Intergenic
1010637482 6:78279353-78279375 GGCCAGATTACTGGTCTGGGTGG - Intergenic
1011030319 6:82915550-82915572 TGGCAGAACCCTGGGGTGGGAGG + Intronic
1011277162 6:85642766-85642788 TGCCAGAACCTGGGTGTGGGAGG - Intronic
1011624340 6:89271147-89271169 GGCTGGGGCCCTGGGGTGGGGGG + Intronic
1016896606 6:149059937-149059959 GCCCAGTGCCCTGGTCTTGGTGG + Intronic
1016903734 6:149128819-149128841 GCCCAGAGCACTGGGGAGGGAGG + Intergenic
1017206323 6:151807773-151807795 GGCCAGAGCTCGCGTGTCGGCGG + Intronic
1017820226 6:158043889-158043911 GACCAGAGCCCTGCTTTGGACGG - Intronic
1018009328 6:159655369-159655391 GGCCAGAGGCATGGTGGAGGTGG + Intergenic
1019320883 7:414716-414738 GGCCAGAGCCCTGGTGTGAAAGG + Intergenic
1019421320 7:952595-952617 GGCCACAGCCCTGGGGAGCGGGG + Intronic
1019450501 7:1095282-1095304 AGACAGCGCCCAGGTGTGGGGGG - Intronic
1019476644 7:1247603-1247625 CGCCCGGGCCCCGGTGTGGGGGG + Intergenic
1019485266 7:1286293-1286315 TGCCAGGGCCCTGAGGTGGGAGG + Intergenic
1021065236 7:16164911-16164933 AGCCAGAGCCCTCCTGTAGGAGG + Intronic
1022499187 7:30871980-30872002 AGGCAGAGCCCTGGTGCGGCTGG + Intronic
1023839427 7:44088085-44088107 GGGCAGGGCCCTGGCCTGGGTGG + Intergenic
1025482248 7:60995206-60995228 GGCCTGGGCCTTGGTGGGGGTGG - Intergenic
1025877946 7:65506449-65506471 GGCCCGGGCCTTGGTGCGGGTGG + Intergenic
1025882282 7:65552242-65552264 GGCCCGGGCCTTGGTGCGGGTGG + Intergenic
1025891160 7:65650360-65650382 GGCCCGGGCCTTGGTGCGGGTGG - Intergenic
1026093051 7:67317185-67317207 GCCCAGAGGCCAGGTGTGGTGGG - Intergenic
1026194702 7:68162975-68162997 GGCTTGAACCCTGGTGGGGGTGG - Intergenic
1026829735 7:73603360-73603382 GCCCAGACCCCAGGTGGGGGTGG + Intronic
1026985920 7:74555238-74555260 GTCGGGAGCCATGGTGTGGGCGG + Intronic
1027035804 7:74924432-74924454 GCCCAGAGGCCAGGTGTGGTGGG + Intergenic
1029712397 7:102306938-102306960 GGAGGGAGCCCTGGTGTGGGGGG + Intronic
1029743286 7:102503235-102503257 GGCCAGATCCCTGGTGGGGGTGG + Exonic
1029761275 7:102602396-102602418 GGCCAGATCCCTGGTGGGGGTGG + Exonic
1030874136 7:114792429-114792451 TGCCAGACCCCTGGAGTGGTGGG - Intergenic
1031553467 7:123143253-123143275 AGCCAGAGGACTTGTGTGGGGGG - Intronic
1032319014 7:130867928-130867950 TGCCAGAGGCTTGGTGTGGCAGG - Intergenic
1032455488 7:132070314-132070336 GGGAAGAGCCCTGGAGGGGGAGG + Intergenic
1035125776 7:156607221-156607243 GGGCAGTGCCCAGGTGTTGGGGG - Intergenic
1035258233 7:157645758-157645780 CCCCAGAGTCCCGGTGTGGGTGG + Intronic
1035721671 8:1797493-1797515 AAGCAAAGCCCTGGTGTGGGTGG - Intergenic
1035755364 8:2027051-2027073 GGATAGAGCCCTTGTGTGGTAGG - Intergenic
1036642646 8:10593723-10593745 GGCCAGAGCTCAGGCGTCGGGGG - Intergenic
1037709551 8:21344873-21344895 GCACCGAGCCCTGGTGGGGGTGG + Intergenic
1037935070 8:22909917-22909939 GACCAGAGGGCTGGAGTGGGTGG + Intronic
1037963727 8:23117741-23117763 CGCCAGGGCTCTGCTGTGGGTGG - Intergenic
1038697614 8:29819856-29819878 GAGCACAGCCCGGGTGTGGGTGG - Intergenic
1038731542 8:30132403-30132425 GGTCAGAGCCCTGGAGAGGAGGG - Exonic
1038779580 8:30558440-30558462 GGCCAGGCCACTGGTGTGGATGG + Intronic
1038807863 8:30812066-30812088 GCCCAGATCCCGGGCGTGGGGGG - Intronic
1039892976 8:41696999-41697021 GGACAGAGCCTTGGAATGGGTGG + Intronic
1039896428 8:41719651-41719673 CTCCAGAGCCCTGGTGAGTGGGG - Exonic
1040645196 8:49389179-49389201 AGCCAGAGACATGGTGTGTGAGG + Intergenic
1042784887 8:72536676-72536698 GGTCAGGGTCCTGCTGTGGGCGG + Intergenic
1045057925 8:98385191-98385213 GGGCTCAGCCCAGGTGTGGGAGG - Intergenic
1045883240 8:107065301-107065323 ACCCAGGGCCCTGGTGTGGTAGG + Intergenic
1048878863 8:138857264-138857286 GGGCAGAGCTGTGGTGAGGGTGG - Intronic
1048891571 8:138953194-138953216 TATCAGAGCCCTGGTGAGGGAGG - Intergenic
1048963573 8:139599200-139599222 GGCCAGTTCCTTGGGGTGGGGGG + Intergenic
1049217408 8:141414605-141414627 GGGAAGAGCCCTGGACTGGGGGG + Intronic
1049292461 8:141811847-141811869 GGCCAGGGCACTGGTGTGGGAGG - Intergenic
1049355902 8:142187905-142187927 GGTAGGAGCCCAGGTGTGGGAGG - Intergenic
1049422476 8:142523097-142523119 TGCCACAGGCCTGCTGTGGGGGG - Intronic
1049446276 8:142632966-142632988 GGGCAGAGTCCTGGTGTTGGAGG - Intergenic
1049551423 8:143261692-143261714 GGCCAGAGCCCTGCCCTGAGCGG - Intronic
1049587153 8:143437444-143437466 GGCTAGAGCCATGGTGGGTGGGG - Intergenic
1049616200 8:143576776-143576798 GGCCAAAGCCCAGGTGTGGCTGG - Exonic
1049743807 8:144254546-144254568 GCCCAGGGCAGTGGTGTGGGAGG - Intronic
1050944703 9:11501653-11501675 GGCCAAAGGCCTGGTTTGAGGGG + Intergenic
1052745836 9:32440384-32440406 CCCCTGAGCCCTGGTGAGGGCGG - Intronic
1053122714 9:35558611-35558633 AGGCAGAGCCCGGGGGTGGGGGG - Intronic
1053612083 9:39724319-39724341 AGCCAGAGCCATGCTGTGGTGGG - Intergenic
1053870117 9:42482311-42482333 AGCCAGAGCCATGCTGTGGTGGG - Intergenic
1054086174 9:60746837-60746859 GGCCAGAGCCATGCTGTGGTGGG + Intergenic
1054241435 9:62618074-62618096 AGCCAGAGCCATGCTGTGGTGGG + Intergenic
1054555563 9:66652597-66652619 AGCCAGAGCCATGCTGTGGTGGG + Intergenic
1054731995 9:68710331-68710353 TGCCAGAGAACTGGGGTGGGAGG + Intronic
1056797633 9:89669678-89669700 GGAAAGAGACCTGGGGTGGGAGG + Intergenic
1058717128 9:107732756-107732778 GTCCAGAACTCTGATGTGGGAGG - Intergenic
1058851257 9:109013624-109013646 GGGCAGAGGCCGGGGGTGGGCGG - Intergenic
1059437178 9:114283916-114283938 GCCCAGAGCCGTGGTTGGGGTGG + Intronic
1060182672 9:121545254-121545276 TGACAGTGCCCTGGTGTGAGGGG + Intergenic
1060666986 9:125437839-125437861 GGCCAGAGGCGTGGTGTCAGGGG + Exonic
1061238926 9:129358035-129358057 AGCCAGAGCCCTGGGGTGGGGGG + Intergenic
1061304746 9:129725757-129725779 GGCCAGGGGCCTGGGTTGGGGGG - Intergenic
1061497989 9:130986566-130986588 GGTCTGGGCCCTGGTGTGGCAGG - Intergenic
1061587578 9:131578765-131578787 GCCCAGTGGCCTGGGGTGGGGGG + Exonic
1061637851 9:131926069-131926091 GGCCAGAGCACAGGAGTGAGGGG - Intronic
1061669198 9:132179151-132179173 GGACAGAGACCTGGTTGGGGAGG - Intronic
1061861824 9:133472312-133472334 TGGGGGAGCCCTGGTGTGGGGGG - Intronic
1062075268 9:134585210-134585232 GGCCAGAGCTCCGATGTGGGTGG + Intergenic
1062126747 9:134868089-134868111 GGGCAGAGACCTGGCGTTGGAGG - Intergenic
1062249839 9:135588541-135588563 GACCAGAGCCATGGTGGGGTGGG + Intergenic
1062267911 9:135695819-135695841 GACCAGAGCTCAGCTGTGGGTGG + Intronic
1062297339 9:135839662-135839684 GGCCTTAGCCCTGGAGTGAGTGG - Intronic
1062337751 9:136079870-136079892 GGCCACAGCCGTGCTGTGGAAGG + Intronic
1062361246 9:136189359-136189381 GCCCCGAGCCCTGGTGGGGAAGG + Intergenic
1062443926 9:136585520-136585542 GACCAGAACCCTGGGGTGGCTGG + Intergenic
1062636112 9:137492652-137492674 GGGCAGGGCCATGGTCTGGGTGG + Intronic
1203376696 Un_KI270442v1:382764-382786 GTCCAGAGCCCTGGCAGGGGAGG + Intergenic
1203613643 Un_KI270749v1:30791-30813 GGCCCGGGCCTTGGTGGGGGTGG - Intergenic
1186567369 X:10677810-10677832 GGACAGGGGCCTGGGGTGGGGGG - Intronic
1186643543 X:11482573-11482595 CCCCAGAGCCACGGTGTGGGTGG - Intronic
1187294346 X:17984500-17984522 GGGCAGAGCCCTGGAGTTGGAGG - Intergenic
1187455973 X:19441552-19441574 GGCTTGAGCCCTGGAGTCGGAGG - Intronic
1187709637 X:22040410-22040432 GGCTTGAGCCCTGGAGTTGGAGG + Intronic
1187729117 X:22234934-22234956 ACCCAGAGCCCTGGTGGGGTAGG + Intronic
1187820120 X:23278321-23278343 GGCCAGAGCTCTGGTGATAGCGG + Intergenic
1189335377 X:40168015-40168037 TGCCAGAGCTCTGGTGGGGGAGG - Intronic
1192239648 X:69319145-69319167 GCCCAGAGCCCTGGGGTTGTGGG - Intergenic
1194174435 X:90629169-90629191 GGCCACAGCCCTGGGGTGTCAGG - Intergenic
1196853276 X:119959480-119959502 TGCATGAGCCCTGGTGTTGGGGG - Intergenic
1196862764 X:120043169-120043191 GGTCAGGGCACTGGGGTGGGAGG - Intergenic
1196880338 X:120193175-120193197 GGTCAGGGCACTGGGGTGGGAGG + Intergenic
1196904824 X:120420743-120420765 GGCAAGAGCCTTGGTGGGGGTGG - Intergenic
1197208241 X:123808479-123808501 TGCCAGGGCCTTGGGGTGGGAGG - Intergenic
1197745712 X:129931582-129931604 GGTCAGAACCCTGTTGGGGGCGG - Intergenic
1199771157 X:150976179-150976201 GGCAAGAGCAGTGCTGTGGGAGG + Intergenic
1200520652 Y:4206862-4206884 GGCCACAGCCCTGGGGTGTCAGG - Intergenic