ID: 903891685

View in Genome Browser
Species Human (GRCh38)
Location 1:26574146-26574168
Sequence AGTCATCCATCCTGGCCCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 173}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903891673_903891685 22 Left 903891673 1:26574101-26574123 CCGCACTCAACAGCTCCAAGCCC 0: 1
1: 0
2: 1
3: 30
4: 264
Right 903891685 1:26574146-26574168 AGTCATCCATCCTGGCCCAGCGG 0: 1
1: 0
2: 2
3: 17
4: 173
903891679_903891685 -4 Left 903891679 1:26574127-26574149 CCCCAGCTGAAGCCCATCGAGTC 0: 1
1: 0
2: 0
3: 7
4: 88
Right 903891685 1:26574146-26574168 AGTCATCCATCCTGGCCCAGCGG 0: 1
1: 0
2: 2
3: 17
4: 173
903891675_903891685 2 Left 903891675 1:26574121-26574143 CCCACCCCCCAGCTGAAGCCCAT 0: 1
1: 0
2: 1
3: 29
4: 271
Right 903891685 1:26574146-26574168 AGTCATCCATCCTGGCCCAGCGG 0: 1
1: 0
2: 2
3: 17
4: 173
903891677_903891685 -2 Left 903891677 1:26574125-26574147 CCCCCCAGCTGAAGCCCATCGAG 0: 1
1: 0
2: 1
3: 11
4: 149
Right 903891685 1:26574146-26574168 AGTCATCCATCCTGGCCCAGCGG 0: 1
1: 0
2: 2
3: 17
4: 173
903891680_903891685 -5 Left 903891680 1:26574128-26574150 CCCAGCTGAAGCCCATCGAGTCA 0: 1
1: 0
2: 0
3: 4
4: 89
Right 903891685 1:26574146-26574168 AGTCATCCATCCTGGCCCAGCGG 0: 1
1: 0
2: 2
3: 17
4: 173
903891681_903891685 -6 Left 903891681 1:26574129-26574151 CCAGCTGAAGCCCATCGAGTCAT 0: 1
1: 0
2: 0
3: 5
4: 59
Right 903891685 1:26574146-26574168 AGTCATCCATCCTGGCCCAGCGG 0: 1
1: 0
2: 2
3: 17
4: 173
903891674_903891685 7 Left 903891674 1:26574116-26574138 CCAAGCCCACCCCCCAGCTGAAG 0: 1
1: 1
2: 3
3: 59
4: 592
Right 903891685 1:26574146-26574168 AGTCATCCATCCTGGCCCAGCGG 0: 1
1: 0
2: 2
3: 17
4: 173
903891676_903891685 1 Left 903891676 1:26574122-26574144 CCACCCCCCAGCTGAAGCCCATC 0: 1
1: 0
2: 2
3: 21
4: 351
Right 903891685 1:26574146-26574168 AGTCATCCATCCTGGCCCAGCGG 0: 1
1: 0
2: 2
3: 17
4: 173
903891678_903891685 -3 Left 903891678 1:26574126-26574148 CCCCCAGCTGAAGCCCATCGAGT 0: 1
1: 1
2: 0
3: 16
4: 90
Right 903891685 1:26574146-26574168 AGTCATCCATCCTGGCCCAGCGG 0: 1
1: 0
2: 2
3: 17
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903891685 Original CRISPR AGTCATCCATCCTGGCCCAG CGG Exonic