ID: 903892801

View in Genome Browser
Species Human (GRCh38)
Location 1:26581201-26581223
Sequence GCAACTACCTCCACTGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903892801_903892809 -7 Left 903892801 1:26581201-26581223 CCACCCCCAGTGGAGGTAGTTGC No data
Right 903892809 1:26581217-26581239 TAGTTGCAGGTGGCAGGCAAAGG No data
903892801_903892811 6 Left 903892801 1:26581201-26581223 CCACCCCCAGTGGAGGTAGTTGC No data
Right 903892811 1:26581230-26581252 CAGGCAAAGGAGTGGTACTAAGG No data
903892801_903892810 -2 Left 903892801 1:26581201-26581223 CCACCCCCAGTGGAGGTAGTTGC No data
Right 903892810 1:26581222-26581244 GCAGGTGGCAGGCAAAGGAGTGG No data
903892801_903892813 22 Left 903892801 1:26581201-26581223 CCACCCCCAGTGGAGGTAGTTGC No data
Right 903892813 1:26581246-26581268 ACTAAGGCTACTCCAAGGAGAGG No data
903892801_903892814 23 Left 903892801 1:26581201-26581223 CCACCCCCAGTGGAGGTAGTTGC No data
Right 903892814 1:26581247-26581269 CTAAGGCTACTCCAAGGAGAGGG No data
903892801_903892812 17 Left 903892801 1:26581201-26581223 CCACCCCCAGTGGAGGTAGTTGC No data
Right 903892812 1:26581241-26581263 GTGGTACTAAGGCTACTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903892801 Original CRISPR GCAACTACCTCCACTGGGGG TGG (reversed) Intergenic
No off target data available for this crispr