ID: 903898122

View in Genome Browser
Species Human (GRCh38)
Location 1:26621886-26621908
Sequence GATGACTTACGTTAGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903898119_903898122 15 Left 903898119 1:26621848-26621870 CCATAGAAATAATGTACATCGCA No data
Right 903898122 1:26621886-26621908 GATGACTTACGTTAGAAGAAGGG No data
903898117_903898122 30 Left 903898117 1:26621833-26621855 CCCAGTTAGCAAAAGCCATAGAA No data
Right 903898122 1:26621886-26621908 GATGACTTACGTTAGAAGAAGGG No data
903898118_903898122 29 Left 903898118 1:26621834-26621856 CCAGTTAGCAAAAGCCATAGAAA No data
Right 903898122 1:26621886-26621908 GATGACTTACGTTAGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903898122 Original CRISPR GATGACTTACGTTAGAAGAA GGG Intergenic
No off target data available for this crispr