ID: 903898999

View in Genome Browser
Species Human (GRCh38)
Location 1:26629238-26629260
Sequence CAGGATCATGTTCTTTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903898995_903898999 -1 Left 903898995 1:26629216-26629238 CCATCCATGTTCCTGCAAAAGAC 0: 164
1: 1184
2: 4327
3: 6329
4: 6290
Right 903898999 1:26629238-26629260 CAGGATCATGTTCTTTTTTATGG No data
903898993_903898999 5 Left 903898993 1:26629210-26629232 CCACCTCCATCCATGTTCCTGCA 0: 14
1: 690
2: 3492
3: 12935
4: 21194
Right 903898999 1:26629238-26629260 CAGGATCATGTTCTTTTTTATGG No data
903898997_903898999 -5 Left 903898997 1:26629220-26629242 CCATGTTCCTGCAAAAGACAGGA 0: 9
1: 238
2: 2309
3: 13284
4: 30601
Right 903898999 1:26629238-26629260 CAGGATCATGTTCTTTTTTATGG No data
903898994_903898999 2 Left 903898994 1:26629213-26629235 CCTCCATCCATGTTCCTGCAAAA No data
Right 903898999 1:26629238-26629260 CAGGATCATGTTCTTTTTTATGG No data
903898992_903898999 8 Left 903898992 1:26629207-26629229 CCTCCACCTCCATCCATGTTCCT 0: 11
1: 631
2: 2519
3: 5141
4: 7070
Right 903898999 1:26629238-26629260 CAGGATCATGTTCTTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903898999 Original CRISPR CAGGATCATGTTCTTTTTTA TGG Intergenic
No off target data available for this crispr