ID: 903904312

View in Genome Browser
Species Human (GRCh38)
Location 1:26672985-26673007
Sequence CTTTGAAGGGAGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903904312_903904321 16 Left 903904312 1:26672985-26673007 CCTCCCACCTTCTCCCTTCAAAG No data
Right 903904321 1:26673024-26673046 ATGAGCCACCACACCCCACCGGG No data
903904312_903904320 15 Left 903904312 1:26672985-26673007 CCTCCCACCTTCTCCCTTCAAAG No data
Right 903904320 1:26673023-26673045 TATGAGCCACCACACCCCACCGG No data
903904312_903904319 -8 Left 903904312 1:26672985-26673007 CCTCCCACCTTCTCCCTTCAAAG No data
Right 903904319 1:26673000-26673022 CTTCAAAGTGCTAGGATTACAGG 0: 6
1: 307
2: 5155
3: 54033
4: 345575
903904312_903904324 24 Left 903904312 1:26672985-26673007 CCTCCCACCTTCTCCCTTCAAAG No data
Right 903904324 1:26673032-26673054 CCACACCCCACCGGGTACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903904312 Original CRISPR CTTTGAAGGGAGAAGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr