ID: 903907459

View in Genome Browser
Species Human (GRCh38)
Location 1:26696670-26696692
Sequence CAGCGGCGGCGGGCCCGGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 927
Summary {0: 1, 1: 1, 2: 15, 3: 96, 4: 814}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903907448_903907459 14 Left 903907448 1:26696633-26696655 CCGAGAGCAATGGGGGTGGCGGC 0: 1
1: 0
2: 1
3: 14
4: 173
Right 903907459 1:26696670-26696692 CAGCGGCGGCGGGCCCGGCGCGG 0: 1
1: 1
2: 15
3: 96
4: 814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903907459 Original CRISPR CAGCGGCGGCGGGCCCGGCG CGG Exonic
900113834 1:1020417-1020439 CTGGGGCGGGGGTCCCGGCGGGG - Intronic
900119106 1:1041039-1041061 GAGCGGGGGCGGGGCCTGCGGGG + Intronic
900349584 1:2228265-2228287 CGGCGGCGGCGCGCCGCGCGAGG + Intergenic
900349671 1:2228502-2228524 GGGCGGCGGCGGGCGCGGCGCGG + Intergenic
900417281 1:2540926-2540948 CGGCGGCGGGGGGCGCGGGGGGG - Intergenic
900564922 1:3327490-3327512 CAACGGCGGCGGCCCCGGGCAGG + Intronic
900663090 1:3795837-3795859 CAGCGGGGGCTGCCCGGGCGGGG - Intronic
900677907 1:3900128-3900150 CAGCTGCGCCGGGCAGGGCGGGG - Intronic
901019721 1:6249580-6249602 CGGGGGCGGCGGGCGCAGCGGGG + Exonic
901030643 1:6305224-6305246 ACGGGGCGGCGGGCCGGGCGGGG + Intronic
901030696 1:6305351-6305373 AAGGGGCGGCTGGCCGGGCGGGG + Intronic
901433885 1:9234728-9234750 CGGCGGGGGCGCGCGCGGCGGGG - Intergenic
901433992 1:9235076-9235098 GGGCGGCGGCGGGGCCGGCGGGG - Intronic
901641334 1:10694583-10694605 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
901673039 1:10867101-10867123 GAGCGGCTGCGGGGGCGGCGGGG - Intergenic
901703967 1:11059910-11059932 CGGAGGCGGCGGGGCCGTCGGGG + Exonic
902169582 1:14599120-14599142 CGGCGGCGGCGGCCCCGGCCCGG + Exonic
902480115 1:16707350-16707372 CAGCGGCCGCGTACCCGTCGCGG + Intergenic
903233865 1:21937340-21937362 CTGCGGGGGCGGGGCGGGCGGGG - Intergenic
903291770 1:22318627-22318649 CAGAGGGGGCGGACCTGGCGGGG - Intergenic
903446418 1:23425018-23425040 CACAGGCGGCGGTCGCGGCGCGG + Intergenic
903458443 1:23504397-23504419 TAGGGGCGGCTGGCCGGGCGGGG - Intergenic
903525090 1:23987237-23987259 AAGGGGCGGCTGGCCGGGCGGGG + Intergenic
903822117 1:26111183-26111205 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
903828653 1:26161980-26162002 CGGAGGCAGCGGGCTCGGCGCGG + Exonic
903907459 1:26696670-26696692 CAGCGGCGGCGGGCCCGGCGCGG + Exonic
903924050 1:26819053-26819075 ACGGGGCGGCTGGCCCGGCGGGG - Intergenic
903925144 1:26826645-26826667 CGGTGGCGGCGGGCCGGGGGCGG + Intergenic
903950675 1:26994303-26994325 CGGCCGCGGCGGCCGCGGCGCGG - Exonic
904237390 1:29123983-29124005 CGGTGGGGCCGGGCCCGGCGCGG - Intergenic
904618933 1:31764079-31764101 GGGCGGCGCCGGGCCGGGCGCGG + Intronic
905137076 1:35808176-35808198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905137124 1:35808343-35808365 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905241555 1:36584596-36584618 CAGAGGCGGCGGGCACTGGGTGG + Intergenic
905414378 1:37794379-37794401 CGGCGGCGGCGGGGGCGGCGCGG - Exonic
905580590 1:39081045-39081067 TAGCGGCCGCGGGGCCGGGGCGG + Intergenic
905794382 1:40807423-40807445 CAGTGGCGGCGGCCCTGGTGTGG + Intronic
905947767 1:41918106-41918128 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
906637092 1:47416893-47416915 CAGCAGCGCGGGGCCGGGCGCGG - Exonic
906650363 1:47508461-47508483 CCGCGGCCGCAGGCCCGGCACGG + Intergenic
907010702 1:50960152-50960174 CAGCGGCGTTAAGCCCGGCGGGG + Exonic
907278105 1:53328015-53328037 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
907429960 1:54406034-54406056 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
908293214 1:62688294-62688316 CGGCTGCGGCGGGCCGGGTGCGG + Exonic
908355702 1:63323403-63323425 GAGCGGCGGCGGGCCTGGCGCGG + Exonic
910450147 1:87335544-87335566 CAGCCGCAGTGAGCCCGGCGCGG + Intronic
911351734 1:96762646-96762668 AAGGGGCGGCTGGCCGGGCGGGG + Intronic
911527348 1:99004018-99004040 CAGCGGCGGGCGGGCCGGCGAGG - Intronic
912360222 1:109089039-109089061 CAGCAGCAGCTGGCCGGGCGCGG - Intergenic
912514786 1:110210818-110210840 GAGCGGCGGCCGGGCGGGCGGGG - Intergenic
912789789 1:112640025-112640047 AAGGGGCGGCTGGCCGGGCGGGG - Intronic
913022789 1:114804531-114804553 AAGGGGCGGCTGGCCGGGCGGGG + Intergenic
914197336 1:145454429-145454451 CCGGGGCGGCGGGGCCGGCGGGG - Intergenic
914201423 1:145488440-145488462 CAGAGGCGGCGACCCTGGCGAGG + Intergenic
914255322 1:145957760-145957782 CAGCGGCGGCGGGGGCGGTGCGG + Exonic
914480545 1:148061567-148061589 CAGAGGCGGCGACCCTGGCGAGG + Intergenic
914702904 1:150150232-150150254 CAGCGGGCGCGGGCGCGGGGCGG - Exonic
914878616 1:151530591-151530613 CAGCGGGGGCTGGCCCGCCTGGG + Exonic
914888155 1:151600765-151600787 CCGGGGCGGCTGGCCGGGCGGGG - Intergenic
915519906 1:156436123-156436145 CTCCGGCCGCGGGCGCGGCGGGG + Intergenic
916107311 1:161441324-161441346 CGGCGGCGGCCGGCCCGACGCGG + Intergenic
916108898 1:161448742-161448764 CGGCGGCGGCCGGCCCGACGCGG + Intergenic
916110486 1:161456123-161456145 CGGCGGCGGCCGGCCCGACGCGG + Intergenic
916112071 1:161463533-161463555 CGGCGGCGGCCGGCCCGACGCGG + Intergenic
916113658 1:161470914-161470936 CGGCGGCGGCCGGCCCGACGCGG + Intergenic
916233343 1:162561653-162561675 CCGCGGCGGCGGGGCGGGCCGGG - Exonic
916651747 1:166839823-166839845 CAGCGGAAGCGCTCCCGGCGCGG + Intronic
916890254 1:169106609-169106631 CGGCGGCGGCGGGGCGGGGGCGG - Exonic
916890259 1:169106618-169106640 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
918365654 1:183805140-183805162 CGGCGGCGGCGGGGGCAGCGCGG + Intronic
919981103 1:202643384-202643406 CCGCAGCGGCAGGGCCGGCGGGG - Exonic
920117275 1:203629635-203629657 CAGCGGCGGAGAGGCTGGCGGGG - Intronic
920528482 1:206685273-206685295 CTGCGGCGGCGGGGCCGGGGCGG - Exonic
921089599 1:211830513-211830535 CAGCGGAGCCGGGCCAGGGGAGG - Intronic
922306981 1:224352739-224352761 CAGGGCCGGCGGGGCCCGCGGGG + Intergenic
922730727 1:227947735-227947757 CGGGGGCGGCGGGGCCGGGGCGG - Intronic
922730781 1:227947927-227947949 CGGCCGCGGCGCGCCCTGCGCGG - Intergenic
922950927 1:229558277-229558299 CAGCGGCTGCGGGACCGCCCGGG + Exonic
922958619 1:229626014-229626036 GAGCGGCGGCGGGGGCGGCGGGG - Exonic
924325494 1:242890681-242890703 CATCAGCGGCAGGCCAGGCGGGG - Intergenic
924415284 1:243850689-243850711 CAGAGGCGGCGGGCAGGGCCGGG - Intronic
924754779 1:246931477-246931499 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1063452946 10:6163663-6163685 GAGCAGCTGCGGGCCCGACGGGG + Intronic
1064209080 10:13348113-13348135 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1065023083 10:21516866-21516888 CGGCGGCGGCGGCCGCCGCGGGG - Exonic
1065055448 10:21837928-21837950 CCGGGGCGGCTGGCCGGGCGGGG - Intronic
1065055471 10:21837974-21837996 CCGGGGCGGCTGGCCGGGCGGGG - Intronic
1065100376 10:22325589-22325611 CCGCGGGGGCGGGGCCGGCGCGG - Intronic
1065589776 10:27252564-27252586 CGGCGGCGGCGGGGGCGGCGGGG - Intergenic
1066115239 10:32233551-32233573 AAGGGGCGGCTGGCCGGGCGGGG + Intergenic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1066464423 10:35640388-35640410 CAGCGGTGGCGCGCCGGGCGCGG - Exonic
1066963967 10:42243671-42243693 CAGCGGCGGCGGGGGGGGGGGGG - Intergenic
1067119933 10:43465068-43465090 CCGGGGCGGCTGGCCGGGCGGGG + Intronic
1067119981 10:43465166-43465188 AAGGGGCGGCTGGCCGGGCGGGG + Intronic
1070328333 10:75401880-75401902 CAGCGGCGGCGGCGGCGGCGCGG - Exonic
1070835669 10:79445577-79445599 CAGCGGCTGCGGGCAGCGCGCGG - Exonic
1071527488 10:86366727-86366749 CGGCGGCGGCCGGGCCGGCGTGG + Intergenic
1071616606 10:87081080-87081102 AAGAGGCGGCTGGCCGGGCGGGG - Intronic
1071616657 10:87081208-87081230 AAGAGGCGGCTGGCCGGGCGGGG - Intronic
1072180477 10:92975755-92975777 ATGGGGCGGCTGGCCCGGCGGGG - Intronic
1072578445 10:96720491-96720513 GAGCGGCGGCCGGTCCCGCGCGG - Exonic
1072915546 10:99535529-99535551 CGGCGGCGGCGGGACCTCCGCGG + Exonic
1073196401 10:101695054-101695076 CGGGAACGGCGGGCCCGGCGAGG - Exonic
1074095044 10:110304568-110304590 CAGCGCCGGCCGGGCCGCCGAGG + Intronic
1074121717 10:110498272-110498294 GTGCTGCGGCGGGCCCGGGGCGG + Exonic
1074377485 10:112951618-112951640 CAGCGGGCGGGGGCCGGGCGCGG - Intronic
1074865457 10:117542240-117542262 CAGCGGAGGCGGCGCCGGCCAGG + Intergenic
1075054357 10:119207024-119207046 CGGCGGCGGCCGGCCCGGCCTGG - Intergenic
1075128856 10:119722270-119722292 AAGGGGCGGCTGGCCGGGCGGGG - Intergenic
1075136999 10:119794823-119794845 AAGGGGCGGCTGGCCGGGCGGGG + Intronic
1076372491 10:129964376-129964398 CGGCGGCGAGGGGCGCGGCGAGG - Intergenic
1076372512 10:129964461-129964483 CGGCGGCGGCGGGGCTCGCGGGG - Intergenic
1076373894 10:129971323-129971345 CCGTGGCGGCGGGCCTGGCGCGG + Intergenic
1076683530 10:132186903-132186925 CAGCGGGGGCGGGACCGGAACGG + Exonic
1076722093 10:132397176-132397198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1076722098 10:132397185-132397207 CGGCGGCGGCGGGGCGGGGGCGG + Exonic
1076994368 11:290958-290980 CAGCTGCGCCAGGCCCTGCGTGG + Exonic
1077008400 11:369605-369627 CCTCGGCCGCGGGCCCGGGGTGG - Intergenic
1077491504 11:2862926-2862948 CGGCGGGCGCGGGCCCGGGGCGG + Intergenic
1077898826 11:6474014-6474036 CCGCGGCGGCGGGCGGGGCGTGG - Intronic
1078245913 11:9573439-9573461 GGGCGGCGGGGGGCCCGGCCCGG - Intergenic
1078514137 11:12008651-12008673 GCGGGGCGGCGGGCCCAGCGAGG - Intronic
1078659822 11:13277848-13277870 CGGCGGCGGTGAGTCCGGCGCGG - Exonic
1079076723 11:17389145-17389167 CGGCGGCGGCGGGCGGGGCCGGG - Intronic
1079689404 11:23403534-23403556 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1080515465 11:33015842-33015864 CAGCGGGGGCGGGGCCTGCAGGG + Exonic
1081831633 11:46120448-46120470 CAGAGGCGGCGTGCCGGGGGCGG - Intronic
1081993506 11:47349932-47349954 CAGGGGCGACAGGCCCGGCTTGG + Intronic
1083258151 11:61508966-61508988 CAGTGGCGGCGGCCCCGGCCGGG + Exonic
1083448507 11:62726991-62727013 CGGCGGGGCCGGGCCCGGCGGGG - Exonic
1083448563 11:62727220-62727242 CGGCGGCGGCGGCGCCTGCGCGG - Exonic
1083617976 11:64035822-64035844 CGGCGGCGGCGAGCAGGGCGCGG - Intronic
1083623651 11:64060936-64060958 CCGCGGCGGCGGCGGCGGCGGGG + Intronic
1083656990 11:64234580-64234602 CAGCGGCGGCGGGGACGGCGGGG - Exonic
1083669421 11:64291840-64291862 CAGGGGCGACTGGCCGGGCGGGG + Intronic
1083739752 11:64702191-64702213 ACGGGGCGGCTGGCCCGGCGGGG - Intronic
1083753865 11:64778564-64778586 CCGCGGGGGCGGGCCGGGGGCGG + Intronic
1083816377 11:65134570-65134592 CGGCGGCGCGGGGCGCGGCGTGG + Intergenic
1083940008 11:65890709-65890731 GAGTGGCGCCGGGCCCGACGTGG + Exonic
1083945043 11:65918999-65919021 CGGCGGCGGCGGCCGTGGCGGGG - Exonic
1084172959 11:67409480-67409502 CCGGGGCGGGGGTCCCGGCGCGG - Exonic
1084891665 11:72239868-72239890 TGGGGGCGGCGGGCCTGGCGCGG - Exonic
1084936621 11:72590322-72590344 AGCCGGCGGCGGGCCCGGCGCGG - Intronic
1085053652 11:73392213-73392235 TGGGGGCGGCGGGCCCGACGTGG + Exonic
1085208045 11:74748935-74748957 CTGAGTCGGCGGGGCCGGCGGGG + Exonic
1089242974 11:117097987-117098009 CAGCCGCGGCGGGGCGGGCGCGG - Intronic
1089729453 11:120511510-120511532 CGGGGGCGGCGGGAACGGCGGGG - Intergenic
1089845083 11:121452177-121452199 CAGCGGCGGCGGGCGCAGCGGGG + Intergenic
1090198890 11:124839829-124839851 CAGCGGCCGCGGGGCGGGAGGGG - Intergenic
1090238280 11:125165145-125165167 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091460901 12:642949-642971 CCGGGCCGGCGGGCGCGGCGTGG - Intronic
1094477706 12:30853943-30853965 CAGCGGAGGTGGACCCGGCCCGG - Intergenic
1095461186 12:42446076-42446098 CAGGGGCTGCGGGGCCTGCGGGG - Exonic
1096146691 12:49283590-49283612 ATGGGGCGGCTGGCCCGGCGGGG + Intergenic
1096167551 12:49436984-49437006 CTGGGGCGGCTGGCCGGGCGGGG + Intronic
1096495504 12:52037290-52037312 CGGCGGCGGCGGAACTGGCGGGG + Intronic
1096501930 12:52069595-52069617 CATCGGCGGCGAGCCTGGCCGGG - Intronic
1096983748 12:55743420-55743442 CGGCGGCGGCGGCAGCGGCGGGG + Exonic
1097155014 12:57006250-57006272 GAGGGGCGGCGGGGCCGGCCGGG + Intronic
1097929631 12:65169838-65169860 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1098105988 12:67069377-67069399 CAGCGGCGGCTGCCGCGGTGTGG + Intergenic
1100048250 12:90411290-90411312 CCGGGGCGGCTGGCCGGGCGGGG - Intergenic
1100844520 12:98645044-98645066 CAGCGGCGGCGCGCCCGACGTGG - Exonic
1101393345 12:104323380-104323402 CCGGGGCGGCTGGCCGGGCGGGG + Intronic
1101910475 12:108857363-108857385 CAGCTCCGGCGGCCTCGGCGCGG + Intronic
1102197156 12:111033973-111033995 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1102197408 12:111034851-111034873 CGGCGGCGGCGGCCCCCGGGTGG - Intronic
1102278187 12:111598788-111598810 CGGCGGCGGGAGGCCCGGCCTGG - Exonic
1102300378 12:111767010-111767032 AAGAGGCGGCGGCCCAGGCGGGG - Exonic
1102518485 12:113465342-113465364 CGGAGGCGGCGCGCACGGCGCGG - Intronic
1103048754 12:117761160-117761182 CATGGGCGGCGTGCCCGGCGGGG + Exonic
1103120085 12:118372862-118372884 CAGCGGCGGCGGCCGCGGGAGGG - Exonic
1103595486 12:122022362-122022384 CAGCGGCCGCGGCCCCAGCCTGG - Intronic
1103691078 12:122774712-122774734 CAGCGGTTCCGGGCGCGGCGGGG + Intronic
1103704735 12:122865402-122865424 CAGCGACGGCGAGCCCGGCCAGG + Exonic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1103856088 12:123972460-123972482 CAGCGCCGGCGGGGGCGGAGGGG - Intronic
1104049563 12:125186488-125186510 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
1104624312 12:130339075-130339097 CAGCGGCGGCGGACGCGGGAAGG - Intronic
1104697097 12:130872011-130872033 GAGCAGGGGCGGGGCCGGCGCGG - Exonic
1104929384 12:132329804-132329826 GAGCGGGGGCGGGGCAGGCGCGG + Intergenic
1104985415 12:132593782-132593804 CTGCGGCGATGGCCCCGGCGGGG + Intergenic
1105890707 13:24680669-24680691 CAGCGGCGGAGCGCACGGTGGGG - Exonic
1105943531 13:25171172-25171194 CAGAGCCGCAGGGCCCGGCGGGG - Exonic
1106057711 13:26254267-26254289 CTGCTGCGGCGGGAGCGGCGGGG - Exonic
1106517166 13:30465403-30465425 CCGGGGCGGCGGGGCCGGCGCGG - Intronic
1107467637 13:40665126-40665148 CGGCGGGGGAGGGCGCGGCGAGG - Intronic
1107493268 13:40900935-40900957 ATGGGGCGGCTGGCCCGGCGGGG - Intergenic
1107548893 13:41457484-41457506 GAGCGGAGGCGGGGCCGGGGCGG - Intergenic
1108643637 13:52406175-52406197 CGTCGGGGGCGGGCCCCGCGGGG - Intronic
1110569857 13:76991920-76991942 AAGCCGCCGCGGGCCGGGCGCGG + Exonic
1110596585 13:77326776-77326798 CGGCGGCGGCGGCGGCGGCGAGG - Intronic
1110705865 13:78601961-78601983 CAGCGGCGGCGGCGGCGGCCGGG - Exonic
1111396066 13:87671795-87671817 CGGCGGCGGCGGGCTCGGCGCGG + Intergenic
1111672465 13:91348067-91348089 CGGCGGCGGCGTGGCCGGGGCGG + Intergenic
1112271904 13:97976481-97976503 CGGCGCCGGCGGCCGCGGCGGGG + Intronic
1112271948 13:97976604-97976626 GGGCGGGGGCGGGCCCAGCGCGG - Intronic
1112290823 13:98143115-98143137 CAGAGGCGGCGGGTCCGGCGCGG + Intronic
1113841485 13:113363970-113363992 CGGCGGCTGCGGTCCCCGCGCGG - Intronic
1115566585 14:34630044-34630066 CAGCGGGCGCGGGGCGGGCGCGG - Intronic
1115688872 14:35824607-35824629 AAGGGGCGGCTGGCCGGGCGGGG + Intergenic
1115688895 14:35824656-35824678 AAGGGGCGGCTGGCCGGGCGGGG + Intergenic
1115754275 14:36517673-36517695 CGGCGGCGGCGGGGGCGGCGGGG - Exonic
1115851789 14:37595150-37595172 CGGCGGCGGCGCGGCGGGCGGGG + Intronic
1116005230 14:39285401-39285423 AAGGGGCGGCTGGCCGGGCGGGG + Intronic
1117546491 14:56798083-56798105 CAGCAGCCGCGGGCCCTGCTGGG + Intergenic
1117875753 14:60249133-60249155 TAGCGGCGGCGGAGCCAGCGGGG + Intronic
1117920930 14:60724351-60724373 CAGTGGCGGCCGGGCCGGCCCGG + Intergenic
1119322229 14:73738960-73738982 GAGAGGCGGCGGGAGCGGCGGGG + Exonic
1120976578 14:90254215-90254237 CAGAGGGGGCGGGGCCGGGGTGG - Intergenic
1120990181 14:90368597-90368619 CAGCGGGGGCGGGCGGGGTGGGG + Intergenic
1121050435 14:90816323-90816345 CGGCGGCGGTGGGGCCTGCGGGG - Exonic
1121050492 14:90816453-90816475 CGGCGGCGGCGGGCGCGGCGGGG + Intronic
1121293193 14:92794379-92794401 CCTCGGCGGCTGGCCCGGAGGGG - Exonic
1121468919 14:94136812-94136834 CAGCTGCCGCGGGCCCAGCTAGG - Intergenic
1121645760 14:95516438-95516460 CTGGGGAGGCGCGCCCGGCGCGG - Intronic
1121767803 14:96502539-96502561 CAGCGGCGGCGGTTGCGGGGGGG + Exonic
1122081205 14:99269093-99269115 CAGCAGCGGCGAGCCAGGAGTGG - Intronic
1122183495 14:99971987-99972009 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1122221170 14:100239799-100239821 CCTCAGCGGCGGGGCCGGCGCGG + Exonic
1122352416 14:101103746-101103768 CAGCTGCCGCGGGTCCTGCGGGG - Intergenic
1122444938 14:101761564-101761586 CAGCGGGGCGGGGCCGGGCGCGG + Intergenic
1122543297 14:102509491-102509513 CGGCGGCCGCGGGCGCGGCGCGG + Intronic
1122620960 14:103057467-103057489 CGGCGGCGGCGGGGAGGGCGCGG - Intergenic
1122923001 14:104887612-104887634 CGGCTGAGGCGGGCCCGGCTGGG + Exonic
1122959422 14:105087664-105087686 GAGCAGCGGCGGGGCGGGCGGGG + Intergenic
1122975290 14:105168436-105168458 CGGCGGCGGCGGGGCCGGGCGGG - Exonic
1122975336 14:105168549-105168571 CGGCGGCGGCGGCGCGGGCGGGG + Exonic
1124469271 15:29968790-29968812 CGGCGGCGGCGGAGGCGGCGGGG - Intronic
1124469319 15:29968961-29968983 CGGCGGCGGCGGGAGCGGCCGGG - Intergenic
1124496796 15:30192114-30192136 CCGCAGCGGCAGGGCCGGCGGGG - Intergenic
1124746780 15:32346533-32346555 CCGCAGCGGCAGGGCCGGCGGGG + Intergenic
1124929143 15:34101889-34101911 CAGCGGCGGCGGTGGCGGCCGGG - Exonic
1125301029 15:38253082-38253104 CAGCGGCGGCCGGGGGGGCGCGG - Exonic
1125672908 15:41486464-41486486 CTGAGGCTGCGGGCCCGGAGTGG - Intergenic
1125812635 15:42554823-42554845 CAGCGGCGGCGGGGAAGGTGGGG - Intronic
1126034959 15:44537199-44537221 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1126109483 15:45167146-45167168 CAGCCGGGGCGGGGGCGGCGGGG + Intergenic
1127144149 15:56007371-56007393 CGGCGGCGGCGGGGGAGGCGGGG + Intergenic
1127165765 15:56243783-56243805 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1128344127 15:66842819-66842841 GGGCGGCGGCGGCGCCGGCGCGG + Intergenic
1128454156 15:67823353-67823375 GCGCGGCGGCGGGGACGGCGCGG - Intronic
1128841472 15:70854235-70854257 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
1128970214 15:72100933-72100955 ACGCGGCGGCTGGCCGGGCGGGG - Intronic
1129082329 15:73052217-73052239 GAGCGGGGGCGGGCCGCGCGCGG + Intronic
1129144246 15:73633092-73633114 CGCCGGGGGCGGGCCGGGCGGGG - Intronic
1129710789 15:77819392-77819414 CCGCGGCGGCGAGCGCGGCAGGG + Intronic
1129790933 15:78340255-78340277 GAGCGGGGGCAGGGCCGGCGGGG + Intergenic
1129853730 15:78810453-78810475 CGTCGGAGGCCGGCCCGGCGGGG + Intronic
1130296195 15:82648142-82648164 CAGCGGCGGCAGTCCCCGCCGGG - Intronic
1130362959 15:83207681-83207703 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1130390061 15:83447430-83447452 CAGCCGCGGGGGGACCGGCCCGG + Exonic
1130531037 15:84748310-84748332 CGGCGGCGGCGGGTAGGGCGGGG - Intergenic
1131144431 15:90002021-90002043 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131367664 15:91853715-91853737 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1131367719 15:91853881-91853903 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1131827015 15:96330404-96330426 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131827156 15:96331129-96331151 CAGCGGCTCCGGGCCCGACCCGG + Exonic
1132314380 15:100879668-100879690 CAGGGGCGGCGGGCGGGGCGGGG + Exonic
1132519630 16:381399-381421 CAGGTCCGGCGCGCCCGGCGCGG - Intronic
1132604583 16:788422-788444 CGGCGGGGGCGGGCCGGGGGCGG - Intergenic
1132683479 16:1153083-1153105 GAGCGGCGGGGGGCGGGGCGGGG - Intergenic
1132683529 16:1153235-1153257 CGACGGCGGCGGCCTCGGCGCGG - Exonic
1132719775 16:1309877-1309899 CCGCGGCGCGGGGCCCGGCTCGG - Intronic
1132843655 16:1990325-1990347 CGGCGGGGGAGGGGCCGGCGAGG - Intronic
1132889556 16:2196954-2196976 CAGAGGCTGCGGGACCCGCGGGG + Intergenic
1133156391 16:3879946-3879968 CACGGGCGGCCGGGCCGGCGAGG + Exonic
1133464738 16:6018970-6018992 CGGCGGCGGCGGCGCTGGCGAGG + Intergenic
1133784357 16:8963367-8963389 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1133784372 16:8963420-8963442 CGGCGACGGCGGCCCCGGGGCGG + Exonic
1135296538 16:21283936-21283958 CAGCGGCGGAGGCGGCGGCGAGG + Intronic
1135821870 16:25692319-25692341 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1135821951 16:25692641-25692663 GGGTGGCGGCGGGCTCGGCGGGG - Exonic
1136110894 16:28063205-28063227 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136110983 16:28063545-28063567 CGGCGGCGGCGGACGCGGCGCGG + Intergenic
1136315983 16:29454971-29454993 CAGAGGAGGCGGACCCCGCGGGG + Intronic
1136426281 16:30170115-30170137 ACGGGGCGGCTGGCCCGGCGGGG - Intergenic
1136430560 16:30194313-30194335 CAGAGGAGGCGGACCCCGCGGGG + Intronic
1136566432 16:31073405-31073427 GCGCGGCTGCTGGCCCGGCGCGG - Intronic
1136590337 16:31214635-31214657 GCGGGGCGGCGGGCCCGGCCTGG + Intronic
1137244956 16:46694614-46694636 CCGGGGCGGCTGGCCGGGCGGGG + Intronic
1137617792 16:49857318-49857340 CGGCGGCGGCAGGCACGGCGCGG + Intronic
1138178807 16:54929123-54929145 CAGCGGCGGCGGGGACCGTGGGG - Intergenic
1138247625 16:55479279-55479301 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1139402938 16:66696643-66696665 CGGCGGCGGCGGGCGGGCCGCGG - Exonic
1139451188 16:67029194-67029216 CGGCGGCGGCGGCGGCGGCGTGG + Intronic
1139469448 16:67170484-67170506 CAGCTGCGGCGGGGGCGGGGCGG - Intronic
1140221591 16:73048062-73048084 CGGCGGCGGCGGGCAGGCCGGGG - Exonic
1140478453 16:75250483-75250505 AAGCTGCGGCGGGCCCCGGGAGG + Intronic
1140927579 16:79599191-79599213 CGGCGGCGGCGGAGGCGGCGGGG - Exonic
1141503256 16:84459225-84459247 CAGCGGCCGCCCGCCAGGCGTGG - Intronic
1141608576 16:85169240-85169262 CGGCGGCGGCGGGGCCCGGGCGG - Intergenic
1141608579 16:85169249-85169271 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1141682596 16:85553290-85553312 CAGCGGCGGCGGCGGCGGCCTGG - Intergenic
1141830684 16:86508616-86508638 CAGCGACTGCTGGCCGGGCGCGG - Intergenic
1141831164 16:86510608-86510630 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1141910997 16:87058178-87058200 CCGCGGCGAGGGGGCCGGCGAGG - Intergenic
1142412053 16:89921868-89921890 CAGCAGAGGCGGGCCCTGCCAGG - Intronic
1142417043 16:89948831-89948853 CGGCGGGGTCGGGGCCGGCGGGG + Intronic
1142417051 16:89948846-89948868 CGGCGGGGACGGGGCCGGCGGGG + Intronic
1142417059 16:89948861-89948883 CGGCGGGGACGGGGCCGGCGGGG + Intronic
1142417111 16:89948966-89948988 CGGCGGGGACGGGGCCGGCGGGG + Intronic
1142417119 16:89948981-89949003 CGGCGGGGACGGGGCCGGCGGGG + Intronic
1142417164 16:89949071-89949093 CGGCGGGGACGGGGCCGGCGGGG + Intronic
1142417170 16:89949086-89949108 CGGCGGGGACGGGGCCGGCGAGG + Intronic
1142417205 16:89949178-89949200 CAGCGGCGGCGTCCCCGGGGTGG - Intronic
1142627796 17:1203413-1203435 CTGCGGGGGCGGGGCCCGCGGGG + Intronic
1142627809 17:1203443-1203465 CTGCGGGGGCGGGGCCCGCGGGG + Intronic
1142627822 17:1203473-1203495 CTGCGGGGGCGGGGCCCGCGGGG + Intronic
1142743046 17:1941792-1941814 CAGAGGCGGCGGGGCCAGCTGGG - Intronic
1142764519 17:2057779-2057801 CAGCCTGGACGGGCCCGGCGCGG + Exonic
1142836798 17:2593599-2593621 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1142939806 17:3371799-3371821 CCGGGGCGGCTGGCCGGGCGGGG + Intergenic
1143483084 17:7238384-7238406 CAGGGCCGGGGGGCCCGGTGGGG - Intronic
1143503516 17:7351939-7351961 GAGCGGCGGCGGGGCGGTCGTGG + Intronic
1143590877 17:7885306-7885328 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1144021030 17:11240630-11240652 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1144021161 17:11241057-11241079 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1144092775 17:11872628-11872650 CAGCGAAGGTGGGCCGGGCGCGG + Intronic
1144724799 17:17496476-17496498 CGGGGGAGGCGGGCCCCGCGGGG - Intergenic
1145041303 17:19579962-19579984 CGGCGGCGGGGAGCTCGGCGGGG - Intergenic
1145291662 17:21551445-21551467 CTGGGGCGGCGGGACCGGTGCGG + Exonic
1145388402 17:22435583-22435605 CTGGGGCGGCGGGGCCGGTGGGG - Intergenic
1145694205 17:26774511-26774533 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1145862988 17:28224293-28224315 AAGGGGCGGCTGGCCGGGCGGGG - Intergenic
1145920139 17:28604156-28604178 AAGGGGCGGCTGGCCGGGCGGGG + Intronic
1146058669 17:29593458-29593480 CGGGGGCGGCGCGCCCGGCGCGG - Exonic
1146132634 17:30291961-30291983 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1146356923 17:32142450-32142472 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1146492356 17:33292138-33292160 CAGCGGCGGCGGCCCCGGCCGGG + Exonic
1146763486 17:35498065-35498087 GAGCGGCGGCGAGGGCGGCGGGG + Intronic
1147044463 17:37743069-37743091 CAGCTGCGGCCAGCCCGGCGCGG + Intronic
1147705525 17:42422571-42422593 CAGGGGACGCGGGCCGGGCGCGG + Intronic
1147939471 17:44036127-44036149 CAGCGGAGGCAGGCCGGGGGAGG - Exonic
1147994637 17:44354063-44354085 CGGCGGCGGCGCGGCAGGCGGGG + Exonic
1148218249 17:45845546-45845568 CAGCGGCGCCGTGCCCGAAGAGG + Exonic
1148632865 17:49125713-49125735 ACGGGGCGGCCGGCCCGGCGGGG - Intergenic
1149296277 17:55265037-55265059 CAGCGGCCGCCGGCGCGGGGAGG + Exonic
1149666848 17:58370930-58370952 CAGGGGCGGGGGGCCCGTCGAGG + Exonic
1150060586 17:62065372-62065394 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1150108611 17:62479137-62479159 CGGCGGCGGCTGCCCGGGCGGGG + Exonic
1150326682 17:64263317-64263339 CGGCGGCCGCGGGCGCGGGGCGG - Intergenic
1150373506 17:64661883-64661905 CCCCGGCGGCGGGGGCGGCGGGG + Exonic
1150388850 17:64779741-64779763 GGGCGGGGGCGGGCCCGGCTCGG - Intergenic
1150643455 17:66964584-66964606 CGGCGGCGGCGGGGGAGGCGCGG + Intergenic
1150692559 17:67378231-67378253 TAGCGGCGGGGGTCCCGGAGCGG - Intronic
1150747244 17:67825792-67825814 CGGCGGCGGCGGTGGCGGCGGGG - Exonic
1151662431 17:75525847-75525869 CCGAGGGGGCGGGCCCGGCTGGG - Intronic
1151783896 17:76265799-76265821 CGGGGGCCGCGGGCCGGGCGCGG + Intronic
1151812596 17:76453177-76453199 CAGCGGCGGCGAACGAGGCGCGG + Exonic
1152225405 17:79090467-79090489 CAGCGGCGGCGGAGCAGGCCCGG - Intronic
1152345535 17:79748481-79748503 CACCGCCGGCGGCCCAGGCGCGG - Intergenic
1152357715 17:79814835-79814857 CGGCGGCGGCGGGAGGGGCGCGG + Intergenic
1152433110 17:80260518-80260540 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433123 17:80260548-80260570 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433136 17:80260578-80260600 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433149 17:80260608-80260630 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433162 17:80260638-80260660 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433175 17:80260668-80260690 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433188 17:80260698-80260720 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433201 17:80260728-80260750 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433214 17:80260758-80260780 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433227 17:80260788-80260810 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433240 17:80260818-80260840 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152468089 17:80476812-80476834 CAGCAGCGCCGGCCCAGGCGGGG - Intronic
1152543988 17:80991805-80991827 CCGCGGCGCCTGGCCCGGCGCGG + Intronic
1152751812 17:82065750-82065772 GCCCGGCGGCGGCCCCGGCGCGG - Intronic
1152924151 17:83079874-83079896 CGGCGGGGGCGGGCCCGGGGCGG - Exonic
1153805645 18:8706467-8706489 CCGCGGCGAGGGGCGCGGCGAGG - Intronic
1154377923 18:13824101-13824123 GTGCGGAGGCGGGCCCGGCGCGG + Intergenic
1154494331 18:14944632-14944654 CAGCGGCAGGGGGCCGGGGGGGG + Intergenic
1155152797 18:23135887-23135909 GGGCGGCGGCTGGGCCGGCGCGG - Exonic
1155199321 18:23503498-23503520 CTGCGGCTCTGGGCCCGGCGCGG - Exonic
1155392720 18:25352303-25352325 CGGCGGCGGCGGGCGGGGCTCGG - Intergenic
1156008446 18:32470481-32470503 CAGCGGCGGCCGCCGAGGCGCGG - Intronic
1156350506 18:36297903-36297925 CAGCGGCGGCCGGCTGGGCTCGG - Exonic
1157383938 18:47247081-47247103 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1157384091 18:47247582-47247604 CTGCGGGGGCTGCCCCGGCGGGG + Intronic
1157492791 18:48136138-48136160 CAGCGGCCGCGGGGCTGGCCTGG - Intronic
1158259108 18:55588155-55588177 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1158435946 18:57435678-57435700 CGGGGGCGGCGGGGGCGGCGGGG - Exonic
1158436001 18:57435842-57435864 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1158436027 18:57435920-57435942 CAGCGGCGCCGCGGCCCGCGTGG - Exonic
1158648872 18:59269336-59269358 CAGCGGTGGCGGGCCGGCTGGGG - Exonic
1159040576 18:63320037-63320059 CAGCGGCGGCGGCGGCAGCGCGG + Exonic
1160418997 18:78731531-78731553 CAGCGGCAGCCGGCCCCGCAGGG - Intergenic
1160453344 18:78979749-78979771 CGGCGGCGGCGGGGGGGGCGCGG + Intergenic
1160453694 18:78980964-78980986 CAGCGGCGGCGGCCTGGGCCTGG + Intronic
1160699093 19:497632-497654 CAGAGGCGGCGGTCGGGGCGGGG + Intronic
1160719164 19:589998-590020 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1160719315 19:590382-590404 GCGAGGAGGCGGGCCCGGCGGGG + Exonic
1160784463 19:892986-893008 CAGCCGTGGCGGGGCCTGCGGGG - Intronic
1160789740 19:917932-917954 CAGCGCGGGCGGGCCCGGGCGGG + Intronic
1160790456 19:920575-920597 CGGGGGCGGCGGGGGCGGCGCGG - Exonic
1160792578 19:929443-929465 CGGCGGGGGCGGCCCCTGCGGGG - Exonic
1160797509 19:952836-952858 CAGCTGCGGGGGGCCCAGGGCGG - Intronic
1160811569 19:1015134-1015156 CAGCTGCGGCTGGCCCCGCCAGG - Intronic
1160823344 19:1068166-1068188 CAGCCGGGGCGGGGCCTGCGGGG - Intronic
1160832022 19:1108574-1108596 CAGCGCCAGCGGGCGCGGGGCGG + Exonic
1160832027 19:1108580-1108602 CAGCGGGCGCGGGGCGGGCGGGG + Exonic
1160835470 19:1122725-1122747 CATCGGCGATGGGGCCGGCGTGG - Exonic
1160907092 19:1456553-1456575 CAGAAGCTGCGGGCCTGGCGAGG + Intronic
1160912176 19:1479556-1479578 CAGCGGGGGCGGGGCGGTCGCGG + Intronic
1160916547 19:1499395-1499417 CGGGGGCGGCTGGCCGGGCGGGG + Intergenic
1160963147 19:1733590-1733612 CAGCGTCTGTGGGCCTGGCGGGG - Intergenic
1160967917 19:1754583-1754605 GAGCGGCGGCGGCCCCAGCGCGG + Exonic
1160975251 19:1789815-1789837 GAGGGGCGGCGGGCTCGGGGTGG - Intronic
1161006665 19:1940717-1940739 GGGCGGTGGCGGGCGCGGCGCGG - Intergenic
1161063742 19:2227747-2227769 CAGAGGCGGAGGGCACCGCGTGG - Intronic
1161203649 19:3029231-3029253 CGCGGGCGGCGGGCCCCGCGCGG + Intronic
1161266406 19:3366674-3366696 CGCCGGCGGGGGGCCGGGCGAGG - Intronic
1161354044 19:3809387-3809409 CAGCTGAGGCGGGCCCCACGTGG - Intronic
1161384826 19:3985326-3985348 GAGCGGCGGCGGGGCCTCCGCGG - Intronic
1161397981 19:4054692-4054714 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1161450628 19:4343598-4343620 CAGGTACGGCGGGCCCAGCGGGG + Exonic
1161450704 19:4343859-4343881 CGGCGGCGGCGGGGCCGGGGCGG + Exonic
1161790345 19:6355860-6355882 CCGAGGCGGCTGGCCGGGCGGGG - Intergenic
1161802631 19:6424545-6424567 CGGCGGCGGCGGCCCGGGCGGGG - Exonic
1161802691 19:6424654-6424676 GGGCGGCGGCGGCCCGGGCGGGG + Exonic
1161802707 19:6424706-6424728 CGGCGGGGCCGGGCCTGGCGCGG + Exonic
1161973313 19:7595909-7595931 TAGCAGCAGCGGGCCCGGCTGGG + Exonic
1161973400 19:7596176-7596198 CGGGGGCGGCGGGCCGGGCGCGG + Intronic
1162131032 19:8526408-8526430 CAGAGGGGGCGGGGCCAGCGAGG - Intronic
1162396452 19:10420441-10420463 CAGCCGCGGCGGGCGGGGGGCGG + Intronic
1162470916 19:10871639-10871661 CAGCGGCGGCGGCCTGGGCCCGG + Exonic
1162470940 19:10871707-10871729 CAGCGGCGGCGGCGGCGGTGGGG + Exonic
1162675771 19:12296865-12296887 CAGGGGCGGGGGGCGGGGCGGGG + Intergenic
1162740224 19:12769870-12769892 CAGCGGCGGCAGGTGCGGCGGGG - Exonic
1162778669 19:12995680-12995702 GAGCGGCGCCGGGCCGAGCGCGG + Exonic
1162948538 19:14057544-14057566 CCGAGGCAGCGAGCCCGGCGGGG + Intronic
1162954337 19:14090079-14090101 CGGCGCCGGCGGGGCCGGCGGGG + Exonic
1163282311 19:16325319-16325341 CGGCGGCGGCGGCTCCGGGGCGG - Exonic
1163666598 19:18606600-18606622 CAACGGCGGCGGCCGCCGCGCGG + Exonic
1164105288 19:22105246-22105268 AAGGGGCGGCTGGCCGGGCGGGG - Intergenic
1164298402 19:23937112-23937134 CCGGGGCGGCTGGCCGGGCGGGG + Intronic
1164298469 19:23937258-23937280 CCGGGGCGGCTGGCCGGGCGGGG + Intronic
1164835022 19:31350566-31350588 CAGCCCCGGCAGGCCGGGCGCGG - Intergenic
1165493918 19:36141047-36141069 CGGCGGCGGCGGGGGAGGCGGGG + Exonic
1165789548 19:38483342-38483364 CAGCCGCGGTGGGCACTGCGGGG - Exonic
1165842625 19:38797969-38797991 CCGGGGCGGCTGGCCGGGCGGGG + Intergenic
1165907808 19:39204228-39204250 CAGCAGCAGCGGGCGCAGCGGGG + Exonic
1165939886 19:39409769-39409791 GAGCGGGGGCGGGCGCGGGGCGG + Intergenic
1166303818 19:41926697-41926719 CCGCGGCGGCCGGCCGGGAGGGG + Intronic
1166364656 19:42272396-42272418 CAGCGGGTGCTGGCTCGGCGTGG + Intronic
1166367206 19:42283906-42283928 CAATGGGGGCGGGCGCGGCGGGG + Intronic
1166531960 19:43548121-43548143 GAGGGGCGGCTGGCCGGGCGGGG - Intronic
1166640284 19:44489165-44489187 ACGGGGCGGCTGGCCCGGCGGGG - Intronic
1167001103 19:46746242-46746264 CAGGGGCTCCGGGCCCGCCGTGG + Exonic
1167002856 19:46756172-46756194 CAGCGGGGGCTGGCGCGCCGCGG - Exonic
1167297784 19:48661995-48662017 CCGAGGCGGCGGGCCCGGCATGG - Exonic
1167464317 19:49642207-49642229 CTGCGGCTCCGGCCCCGGCGCGG - Exonic
1167495712 19:49817631-49817653 CAAGGGCAGCGGGCCCGGCGCGG + Intergenic
1167622736 19:50568299-50568321 CGGCGCCGGCGGGCCCGAGGAGG - Intergenic
1167643702 19:50695085-50695107 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1168339459 19:55615004-55615026 CAGCGGCAGCGGGCGGGGCGTGG - Exonic
1168536423 19:57174101-57174123 CACCTGAGGTGGGCCCGGCGTGG - Intergenic
1168694423 19:58396604-58396626 CAGAGGCGGCGGGGGCGGCGGGG - Exonic
925400459 2:3569108-3569130 AAGGGGCGGCTGGCCGGGCGGGG + Intergenic
925407539 2:3615875-3615897 ACGCGGCGGCTGGCCGGGCGGGG + Intronic
925984732 2:9206730-9206752 GGGCGGCGGCCGGCCGGGCGTGG - Intergenic
926077320 2:9951728-9951750 CGGCGGCTGCGGGTCCGGAGCGG - Exonic
926268292 2:11345021-11345043 CCGCGGCGGGGGGCGCGGCCGGG - Intronic
927990200 2:27442286-27442308 CAGGGGGAGCGGGCCCGGGGCGG + Intergenic
928303685 2:30147842-30147864 CGGCGGCGGCGGTGGCGGCGGGG - Intronic
928541966 2:32293695-32293717 AAGGGGCGGCTGGCCGGGCGGGG + Intronic
929218116 2:39437111-39437133 CGGCGGCGGCGGCCGCAGCGTGG - Exonic
929511456 2:42568695-42568717 CGGCGGCGGCGGGCGGGGCTCGG + Intronic
929604176 2:43224531-43224553 GAGGTGCGGCGGCCCCGGCGGGG + Exonic
929604276 2:43224934-43224956 CGGCGGCGGCGTGCGCGACGTGG + Exonic
929760514 2:44802597-44802619 CCGCGGTGGCGGGGCCCGCGCGG + Intergenic
929778329 2:44942197-44942219 TAGCGGCGGCGGGAACGGTGCGG + Exonic
929778344 2:44942245-44942267 CAGCGGCGGCGGGAACGGTGCGG + Exonic
931052301 2:58428473-58428495 CGCCGGCCGCGGGCCCGGGGCGG + Intergenic
931253509 2:60552425-60552447 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
931274883 2:60735775-60735797 CAGCGGGGACGGGGGCGGCGAGG + Intergenic
931762499 2:65430907-65430929 CAGCAGCGGCGGCCGCCGCGCGG + Intronic
932492958 2:72133148-72133170 CAGTGGCGGCTGCCCCTGCGAGG - Exonic
933666856 2:84971277-84971299 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
933908023 2:86914183-86914205 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933908034 2:86914211-86914233 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933908069 2:86914307-86914329 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933908143 2:86914518-86914540 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933911179 2:86942542-86942564 CGGCGGCGGCGGCCTCGACGTGG + Intronic
934011428 2:87824733-87824755 CGGCGGCGGCGGCCTCGGCCTGG - Intronic
934011459 2:87824816-87824838 CGGCGGCGGCGGCCTCGGCCTGG - Intronic
934248017 2:90324088-90324110 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248189 2:90324702-90324724 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248362 2:90325312-90325334 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248373 2:90325350-90325372 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248405 2:90325467-90325489 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934261189 2:91478099-91478121 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
934655965 2:96116905-96116927 CACCGGCGCCGGGCCCAGCCCGG - Intergenic
934754561 2:96816357-96816379 CAGCACTCGCGGGCCCGGCGCGG - Exonic
934966866 2:98731141-98731163 CGGCGGGGGCGGAGCCGGCGGGG - Intergenic
934970666 2:98761631-98761653 CAGCGGCGGCGGGGTGGGGGGGG - Intergenic
934998505 2:98988875-98988897 AAGGGGCGGCTGGCCGGGCGGGG + Intergenic
935137718 2:100322064-100322086 CGGCGGCGGCGGGACCGGCTCGG + Exonic
935237487 2:101151055-101151077 TGGGGGCCGCGGGCCCGGCGGGG + Intronic
935592444 2:104855295-104855317 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
935592463 2:104855346-104855368 CGAAGGCGGCGGGGCCGGCGGGG + Intergenic
935592610 2:104855816-104855838 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
935592737 2:104856230-104856252 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592783 2:104856392-104856414 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935692683 2:105745085-105745107 CAGCGGCGCGGGTCCCGGGGCGG - Exonic
936126703 2:109794590-109794612 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
936939640 2:117871067-117871089 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
937203839 2:120223420-120223442 CGGCCGGGGCGGGCCCTGCGGGG + Intergenic
938796009 2:134718828-134718850 CAGCGGGGCCGGGCCGGGGGCGG + Exonic
939477302 2:142702689-142702711 AAGGGGCGGCTGGCCGGGCGGGG - Intergenic
939612934 2:144332295-144332317 CAGCAGCGGCGGCTGCGGCGCGG - Intronic
939969661 2:148644965-148644987 CGGCGGCGGCGGGGCGGGCGGGG - Exonic
939990886 2:148875935-148875957 CGGGAGCGGCGGGCCGGGCGGGG + Intronic
940635616 2:156293705-156293727 CGGGGGCGGCTGGCCGGGCGGGG - Intergenic
940962225 2:159798221-159798243 CAGCGGCTGCGCGGCCGGAGAGG + Exonic
941119109 2:161507855-161507877 CCGCGGCGGCGGCGGCGGCGGGG - Intronic
941602877 2:167563332-167563354 AAGGGGCGGCTGGCCGGGCGGGG + Intergenic
942046550 2:172102427-172102449 GAGCGGCGGCGGCGCCGGCCCGG - Exonic
942240812 2:173963731-173963753 CGGCGGGGGCGGGCCGCGCGCGG + Intronic
942355726 2:175108474-175108496 AAGGGGCGGCTGGCCGGGCGGGG - Intronic
942446143 2:176080247-176080269 CGGCGGCGGCGGGGGCGCCGGGG - Exonic
942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG + Exonic
942454804 2:176130336-176130358 CAGCGGCGGCGGCCCCGGGCGGG - Exonic
942458150 2:176151825-176151847 CAGCGGCCCCGGGCCTGGCTCGG + Exonic
942890520 2:180981092-180981114 GAGCCGCGGCGGGGCCGGCTGGG + Intronic
943297147 2:186154083-186154105 AAGGGGCGGCTGGCCGGGCGGGG + Intergenic
944221683 2:197310292-197310314 CGGCGGCCGCGGGCCCGGCGGGG - Intronic
944533034 2:200683907-200683929 CCGGGGCGGCTGGCCGGGCGGGG + Intergenic
945189029 2:207166931-207166953 CGGCGGCGGCGGCGCCCGCGGGG - Intronic
945225835 2:207530367-207530389 CAGCGGCGGCGCTCATGGCGGGG + Intronic
946019858 2:216633610-216633632 CGGCGGCGGCGGGGCGCGCGCGG + Exonic
946692419 2:222319505-222319527 CGGCGGTGGCGGGGCCGGGGTGG + Intergenic
946692489 2:222319771-222319793 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
947117945 2:226791675-226791697 GAGCCGCGGCGGGCGCGGGGCGG - Intronic
947992299 2:234497154-234497176 CCCCGGCGGCGGGCGGGGCGGGG - Intergenic
948479103 2:238239462-238239484 GAGTGGCGGCGGGGCGGGCGGGG - Intronic
1168757601 20:327248-327270 CAGAGAAGGCGGGCCGGGCGAGG - Exonic
1168804452 20:664218-664240 CGGCGGCGGCGGGGCGGGGGCGG - Exonic
1168806661 20:675731-675753 CGGTGGCGGCGGCCCCGGCTCGG + Exonic
1168814678 20:728427-728449 CGGAGGCGGCGGGCGGGGCGAGG + Intergenic
1169065595 20:2692870-2692892 GGGCGGCGGCGGCCGCGGCGGGG + Exonic
1169065643 20:2693019-2693041 CGGCGTCTGCTGGCCCGGCGCGG + Exonic
1169168139 20:3441373-3441395 CCGGGGCGGCTGGCCGGGCGGGG + Intergenic
1170524777 20:17226868-17226890 GGGCGGGGGCGGGCCCGGGGCGG + Intronic
1170664564 20:18375684-18375706 ACGGGGCGGCTGGCCCGGCGGGG + Intergenic
1172006198 20:31820316-31820338 CAGGGGCGGGGGGCCCGCGGAGG + Exonic
1172028948 20:31968250-31968272 CAGTGCCGGCGGGCGCGGGGAGG + Exonic
1172037337 20:32019235-32019257 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1172073657 20:32277705-32277727 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1172118474 20:32584698-32584720 GGGCGGCGGCGGGACTGGCGCGG - Intronic
1172349557 20:34229942-34229964 AAGGGGCGGCTGGCCGGGCGGGG + Intronic
1172349880 20:34230696-34230718 AAGGGGCGGCTGGCCGGGCGGGG + Intronic
1172367906 20:34363722-34363744 GCCCGGCGGCGGGGCCGGCGCGG + Intronic
1172474488 20:35226764-35226786 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1172698077 20:36835848-36835870 CAGCGGCGGCGGCGGCGGGGAGG - Intronic
1172702683 20:36862886-36862908 CCGCGGCCGGGGGCCCGGCGGGG - Exonic
1173827605 20:46057659-46057681 CAGCGGCGGGGGGCGCGGCGAGG - Exonic
1174357823 20:50010104-50010126 CAGCGGCGGCGGCGGCGGCGAGG + Intergenic
1175349881 20:58310015-58310037 GAGTGGCGGCGGGTCCGGCCGGG + Intronic
1175749211 20:61483672-61483694 CAGCGGGGGCGGGGCGGGGGGGG - Intronic
1175831067 20:61965782-61965804 CAGGGGCGGGGGGCCCGGGGAGG - Intronic
1176084021 20:63287783-63287805 CAGCGACGGCGGGGAGGGCGGGG + Exonic
1176178570 20:63739604-63739626 CGGAGGGGGCGGGCCCGGGGCGG + Intronic
1176234831 20:64049372-64049394 CGGGCGCGGCGGGCGCGGCGAGG + Exonic
1176281622 20:64316738-64316760 CAGCGGGGCGGGGCGCGGCGGGG + Intergenic
1176548595 21:8212230-8212252 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176550183 21:8217407-8217429 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176556251 21:8255724-8255746 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176556489 21:8256438-8256460 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176567526 21:8395265-8395287 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176569111 21:8400445-8400467 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176575190 21:8438766-8438788 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176575428 21:8439480-8439502 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176576572 21:8443299-8443321 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1176577025 21:8444677-8444699 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1178075551 21:29011552-29011574 AAGGGGCGGCTGGCCGGGCGGGG - Intronic
1178334446 21:31731524-31731546 CCGGGGCGGCGGGGCCTGCGCGG - Intronic
1178680693 21:34670137-34670159 TAGAGGCGGGGGACCCGGCGGGG + Exonic
1178922443 21:36747657-36747679 CGGCGGCGGCGGGCGCTGCGGGG - Exonic
1178948221 21:36966048-36966070 CAGCTGTGGCGGGCCGGGAGCGG - Intronic
1179133538 21:38660453-38660475 CAGCGGCTGCGGGGACGGGGAGG - Intronic
1179561585 21:42219221-42219243 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1179674834 21:42974443-42974465 GCGCGGCGGCGGGCGCGGGGCGG - Intergenic
1179873260 21:44254414-44254436 CAGTGGTGGCTGGGCCGGCGGGG + Intronic
1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG + Intergenic
1180064341 21:45405141-45405163 CAGCGGCGGCGGCTGCAGCGCGG + Intronic
1180559063 22:16601416-16601438 CAGCGGCGGCGCGCGGGGGGCGG + Intergenic
1181026620 22:20131139-20131161 CAGCGCCGTCGGCCCCGGCCCGG + Intronic
1181669654 22:24420258-24420280 CGGCGGCGGCGGGGCCAGCTGGG - Intronic
1181670692 22:24424309-24424331 GTGCGGCGGCCGGCGCGGCGCGG + Intronic
1181937129 22:26447014-26447036 CAGTGGCTGCTGGCCAGGCGTGG - Intronic
1182143454 22:27982329-27982351 CAGCGGCAGTGAGCCCAGCGAGG + Exonic
1182603883 22:31489214-31489236 CAGGTGCGGCTGGCCTGGCGAGG - Intronic
1183358932 22:37373464-37373486 CAGCGGCGGGGGCAGCGGCGGGG - Exonic
1183384315 22:37506205-37506227 CAGCTGCAGCGGGCCCAGGGTGG - Exonic
1183427210 22:37746315-37746337 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1183546022 22:38455259-38455281 CAGCATCGTCGGGCCCGGCCGGG + Intergenic
1183578256 22:38706159-38706181 CGGCGGCGGCGGGCGCTGAGGGG + Intronic
1183607071 22:38872091-38872113 CAGCGGCGGCCCGCCCCGGGCGG + Intronic
1184412231 22:44331877-44331899 CGGCGGCGGCGGGCGCGGCGCGG - Intergenic
1184508088 22:44916426-44916448 CGAGGGCGGCGGGCTCGGCGAGG + Exonic
1184645086 22:45891165-45891187 CCGCGGAGGTGGGGCCGGCGGGG - Intergenic
1184680700 22:46071081-46071103 CGGCGGGGGCGGGCCGGGCCGGG + Intronic
1184680821 22:46071408-46071430 CACCCGCAGCGGGCACGGCGGGG + Intronic
1184712736 22:46262801-46262823 CTGGGGCCGCGGGCCTGGCGCGG + Exonic
1184759402 22:46536464-46536486 CCGGCGCGACGGGCCCGGCGGGG - Exonic
1185055258 22:48575854-48575876 CCGCCGCGGCGGGCCAGGCTCGG - Intronic
1185133959 22:49058104-49058126 CACCGGCCGTGGGCCAGGCGGGG - Intergenic
1185315598 22:50177942-50177964 CGGCGCCGTCGGGCTCGGCGGGG - Exonic
1185316168 22:50180133-50180155 CCGCGGCGGGGGGCCCGGGTGGG - Exonic
1185335800 22:50270392-50270414 CGGCGGCGGCGGGCGGGGCGGGG + Exonic
1185376741 22:50486135-50486157 CGGGGTCGGCGGGCCCAGCGAGG - Exonic
1185398642 22:50604916-50604938 CAGCGGCGGGGAGGCCAGCGAGG + Exonic
1185409435 22:50674426-50674448 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1185413486 22:50697735-50697757 GCGGGGGGGCGGGCCCGGCGCGG + Intergenic
1203253239 22_KI270733v1_random:127821-127843 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203254622 22_KI270733v1_random:132357-132379 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203255078 22_KI270733v1_random:133745-133767 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203261294 22_KI270733v1_random:172902-172924 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203261533 22_KI270733v1_random:173613-173635 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203262678 22_KI270733v1_random:177436-177458 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203263134 22_KI270733v1_random:178824-178846 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
949552402 3:5122254-5122276 CGGCGGCGCCGGGACGGGCGTGG + Exonic
950153823 3:10707980-10708002 CAGCGGGGCCGGGCCGGGCCGGG - Intronic
950158065 3:10738843-10738865 CAGCGGCGGCGAGCTGCGCGTGG - Intergenic
950433879 3:12967370-12967392 CAGCGGGTGAGGGCGCGGCGCGG - Exonic
950710623 3:14810740-14810762 CAGGGGGTGCGGGCCCCGCGGGG + Intergenic
952287296 3:31981211-31981233 CCGCGGTGGCGGCCCCGGCACGG + Exonic
952416728 3:33096819-33096841 CGTCGGGGGCGGGCCGGGCGGGG - Intronic
952744459 3:36764248-36764270 GAGTGGCGGCGGGCATGGCGCGG + Intergenic
953385293 3:42502699-42502721 CCGCGGCGGGCGGCCCCGCGCGG - Exonic
954004218 3:47578866-47578888 CAGCGGCGGCGCGGGAGGCGGGG - Exonic
954004223 3:47578875-47578897 CAGCGGCGGCAGCGGCGGCGCGG - Exonic
954246935 3:49339691-49339713 CCTAGGGGGCGGGCCCGGCGGGG - Intronic
954256489 3:49411492-49411514 CAGCGGCGCCGGGCAGGGCGGGG - Intronic
954277954 3:49554656-49554678 CGGCGGCGCCGGCCCCGGCCCGG + Exonic
954355982 3:50084379-50084401 AAGGGGCGGCTGGCCAGGCGGGG + Intronic
954437423 3:50503467-50503489 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
954909024 3:54087773-54087795 CCGCGGCGGCGGGGACTGCGTGG - Intergenic
955067732 3:55547213-55547235 CAGTGGTGGTGGGCCCGGCTGGG - Intronic
955246271 3:57227810-57227832 CTGCGGCGGGCGGGCCGGCGCGG + Exonic
955911570 3:63863949-63863971 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
955996881 3:64687496-64687518 AGGCGGCGTCGGGGCCGGCGGGG + Intronic
956678028 3:71753682-71753704 CGGCGGCGGCGGGCCCGGCGGGG + Intronic
960955428 3:123027618-123027640 CAGCGGGCGCGGGCCCGGGTGGG - Intronic
961163727 3:124750186-124750208 ATGGGGCGGCTGGCCCGGCGGGG + Intergenic
961202487 3:125055852-125055874 GAGCGGCGGCGGCCACCGCGAGG + Exonic
961483284 3:127197379-127197401 AGGCGGCGGCGGGCCCTGCAGGG - Exonic
961551521 3:127672786-127672808 CAGACGCGCTGGGCCCGGCGTGG - Exonic
961827168 3:129605283-129605305 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
961962432 3:130868134-130868156 CCGGGGCGGCTGGCCGGGCGGGG - Intronic
961967264 3:130918699-130918721 CAGCAGCAGTGGGCCGGGCGCGG + Intronic
962156820 3:132956817-132956839 CAGGGGCGGGGGGGGCGGCGCGG - Intergenic
962277955 3:134030037-134030059 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
963253044 3:143119853-143119875 CGGCGGCGGCGGCTGCGGCGGGG + Exonic
963904451 3:150762651-150762673 CGGCGGCGGCGGGGCCGGCCCGG - Exonic
965109441 3:164402153-164402175 CAGGGCCGGCAGGTCCGGCGGGG + Intergenic
965881762 3:173396063-173396085 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
966015191 3:175132062-175132084 TAGGGGCGGCTGGCCAGGCGGGG + Intronic
966096808 3:176213682-176213704 CCGGGGCGGCGGGGCCGGCAGGG + Intergenic
966253410 3:177891683-177891705 ACGGGGCGGCTGGCCCGGCGGGG + Intergenic
966712031 3:182980724-182980746 CGGGGGCGGGGGGCGCGGCGGGG + Intronic
966886511 3:184380335-184380357 GAGCAGCAGCGGGGCCGGCGGGG - Exonic
967724153 3:192845786-192845808 CAGTGGCTGGGGGCCAGGCGCGG + Intronic
968178187 3:196569035-196569057 TAGCGGCGGCGGCGCGGGCGCGG + Exonic
968319060 3:197749820-197749842 CCGCGGCTGCGGGCGGGGCGGGG - Exonic
968433822 4:575200-575222 CGGGGCCGGCGGGGCCGGCGGGG - Intergenic
968514231 4:1009718-1009740 CGGTGGCGGCGGCGCCGGCGCGG - Intergenic
968514418 4:1010280-1010302 CAGCGGCGGCTGCGCCAGCGGGG + Intronic
968674734 4:1871421-1871443 CGGCGGCGGCGGGCGCAGCGCGG - Intronic
968701318 4:2059452-2059474 GGGCGGCGGCGGGCACGGCCGGG - Intergenic
968725776 4:2247222-2247244 CTGTGACGGCGGGCCCGGTGTGG + Intergenic
968775439 4:2536969-2536991 CGGCGGCGGCGGCTCGGGCGGGG + Intronic
969240276 4:5892753-5892775 CAGCGCTGGCCGGCCCGACGCGG - Exonic
969344729 4:6563626-6563648 CGGGCGCGGCGGGCGCGGCGGGG + Intergenic
969344784 4:6563793-6563815 CGGCTGCGGGGGGCCGGGCGCGG + Intergenic
969559809 4:7939760-7939782 CGGCGGCGGCGGCCCCGCCCCGG - Exonic
969671544 4:8592832-8592854 CAGCGGCAGCGGGGGCGGCATGG - Exonic
969714348 4:8861153-8861175 CAGCGGCGCCCGGACCCGCGGGG - Intronic
971351916 4:25862921-25862943 GCGCGGCGGCCGGCCCGGCCGGG - Exonic
972265338 4:37454004-37454026 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
972725870 4:41746091-41746113 CGGCGGCGGCGGGCCCAGCCCGG - Exonic
973279222 4:48341721-48341743 CGGCGGCGGCGGGGCCGGGATGG + Exonic
973613592 4:52659007-52659029 CTGGGGCGGCGGGGGCGGCGGGG - Intronic
975485909 4:74933817-74933839 CAGCGGCTGCGCGCCTGGCGGGG + Intronic
975778985 4:77819675-77819697 CGGCGGCGGCGGTGGCGGCGGGG + Intergenic
975801068 4:78059115-78059137 CGGCGGCGGCGGGCGCAGGGCGG + Intronic
977536554 4:98261365-98261387 GAGCGGCGGGGGGCGGGGCGGGG - Intronic
982026043 4:151254925-151254947 GAGGGGCGGCTGGCCAGGCGGGG + Intronic
982075328 4:151731925-151731947 ACGGGGCGGCTGGCCCGGCGGGG - Intronic
982182846 4:152765321-152765343 AAGGGGCGGCTGGCCGGGCGGGG + Intronic
982702376 4:158671544-158671566 CGGCGGCGGCGGGGCTCGCGAGG - Intronic
984952609 4:185018470-185018492 CAGCGGCCGCGGGCACCGGGGGG - Intergenic
984966338 4:185143408-185143430 CAGCGGCGACGCCCCCGGCCAGG - Exonic
984966367 4:185143514-185143536 CGGGCGCGGCGGGCCGGGCGGGG + Intronic
985542621 5:493882-493904 CAGCGGGGGTTGGCCCGGGGAGG + Intronic
985611630 5:892663-892685 CGCCGGCGGCGGGCCCGAGGCGG + Exonic
986297088 5:6448739-6448761 CGGCGGCGGCGGCTGCGGCGGGG + Exonic
986813662 5:11385167-11385189 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
987050430 5:14143635-14143657 CGGCGCCGCCAGGCCCGGCGCGG + Intergenic
987050487 5:14143806-14143828 CTGCGGGGGCGGTGCCGGCGAGG + Exonic
989812570 5:45695868-45695890 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
990041565 5:51383441-51383463 CGGCGGCGGCAGACTCGGCGCGG - Exonic
990210787 5:53480235-53480257 CAGCGCCGGCGCGCCCGGGGTGG - Intergenic
990955035 5:61332353-61332375 CAGCGGCGGCGGCGGCGGCGCGG + Exonic
990955116 5:61332692-61332714 CAGCGGTGGCGGCGGCGGCGCGG + Exonic
992088621 5:73299152-73299174 GAGCGCCGGCGGGCCGGGCGGGG - Intergenic
992249839 5:74866091-74866113 CGGGGGCGCGGGGCCCGGCGCGG + Intronic
992269935 5:75053555-75053577 CTGCGGAGGCCGCCCCGGCGGGG + Intergenic
992468531 5:77030786-77030808 CGGCGGCGGCGACCGCGGCGGGG - Exonic
992473191 5:77077522-77077544 GGGCGGCGGCGGGCAGGGCGCGG + Exonic
992530238 5:77645710-77645732 CCGCGCCGTCGGGCCGGGCGGGG + Intergenic
992671904 5:79069673-79069695 CTGAGGCCGCGGGGCCGGCGGGG + Intronic
992939511 5:81750031-81750053 CGGGAGGGGCGGGCCCGGCGGGG - Intronic
992978405 5:82140561-82140583 GAGGGGCGGCTGGCCGGGCGGGG - Intronic
993162839 5:84312535-84312557 CAGGGGTGGCTGGCCTGGCGGGG + Intronic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
994072736 5:95620479-95620501 CGGCGGCGGCGGGCCCTGGGCGG + Exonic
994072824 5:95620838-95620860 CGGCGGCGGCGGCAGCGGCGAGG - Exonic
995193543 5:109342014-109342036 ACGGGGCGGCTGGCCCGGCGGGG - Intronic
996298570 5:121954208-121954230 CAGCGGCGCCGGCGCGGGCGCGG + Intergenic
996785058 5:127229348-127229370 CGGCTGCGGCGGGCCCGGGCGGG - Intergenic
996900570 5:128538242-128538264 CGGCGGTGGAGGGCGCGGCGCGG + Intronic
997201287 5:132011560-132011582 CAGCGGGGCCCGGCCCGGCCCGG + Exonic
997321603 5:132983047-132983069 AAGGGGCGGCTGGCCTGGCGGGG + Intergenic
997980838 5:138466497-138466519 CAGCGGCGGCTGTGCGGGCGAGG - Intronic
998128017 5:139637428-139637450 GAGGGGCGGCGGGGCCGGCAGGG - Intergenic
998152630 5:139765813-139765835 CGGTGGCGGCGGACCCGGAGGGG - Intergenic
998200488 5:140114307-140114329 CAGTGGCGGCGGCGGCGGCGGGG + Exonic
998374569 5:141682235-141682257 GAGGGGAGGCGGGGCCGGCGCGG - Intergenic
999293260 5:150441455-150441477 CAGCAGGGGAGGGCCAGGCGTGG + Intergenic
1001077794 5:168643358-168643380 AAGGGGCGGCTGGCCGGGCGGGG + Intergenic
1001822512 5:174721117-174721139 CGGGGGCGGGGCGCCCGGCGCGG + Intergenic
1002031604 5:176434079-176434101 AAGGGGCGGCTGGCCTGGCGGGG - Intergenic
1002591068 5:180291969-180291991 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1002927308 6:1611786-1611808 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1003921573 6:10838200-10838222 CCGCGGGGGCCGGCCTGGCGTGG - Intronic
1004216779 6:13711242-13711264 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1004448739 6:15726300-15726322 TAGGGGCGGCCGGCCGGGCGGGG + Intergenic
1004448777 6:15726390-15726412 TAGGGGCGGCCGGCCGGGCGGGG + Intergenic
1004504728 6:16238654-16238676 CTGCGGCGGCGGCGACGGCGGGG - Exonic
1005063332 6:21796912-21796934 ACGCGGCGGCTGGCCGGGCGGGG + Intergenic
1005069524 6:21851375-21851397 TAGGGGCGGCCGGCCGGGCGGGG + Intergenic
1006624037 6:35384975-35384997 ACGGGGCGGCTGGCCCGGCGGGG - Intronic
1007451265 6:41941584-41941606 CAGCAGCCGCGGGTCCGGCCCGG + Exonic
1007523051 6:42466673-42466695 AAGGGGCGGCTGGCCTGGCGGGG - Intergenic
1007614402 6:43171749-43171771 CGGCGGCGGCGGGACACGCGGGG + Exonic
1007927741 6:45663551-45663573 CCGCAGCGGCGGGCCGGGCTCGG - Intronic
1008184287 6:48371232-48371254 CAGGGGCGGCTGGCCGGGCGGGG + Intergenic
1010030266 6:71266063-71266085 ACGCGGCGGCTGGCCGGGCGGGG + Intergenic
1010300593 6:74255082-74255104 CAGGGGCGGCTGGCCGGGCGGGG + Intergenic
1012410217 6:98947963-98947985 GAGGAGCGGCGGGCCCGGGGAGG + Intronic
1013048410 6:106510250-106510272 CAGGGGCGGCGAGCCCAGCCTGG - Intergenic
1013681275 6:112528314-112528336 CCGGGGCGGCTGGCCGGGCGGGG + Intergenic
1013836605 6:114342429-114342451 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1015149271 6:130019994-130020016 CGGCGGCGGCGGCCGCGCCGGGG + Intronic
1015559150 6:134496212-134496234 CAGCAGTGGAGGGCCGGGCGCGG + Intergenic
1015910228 6:138162011-138162033 CAGCGGCGGCTTCCCCGGCCCGG + Exonic
1017146686 6:151240909-151240931 GAGCAGCGGCGAGCGCGGCGGGG + Intronic
1017164162 6:151391559-151391581 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1017671968 6:156777703-156777725 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1017671970 6:156777709-156777731 CGGCGGCGGCGGCGCGGGCGCGG + Intergenic
1017954814 6:159169279-159169301 CAGGGGCGACGGGGGCGGCGGGG - Intergenic
1018613394 6:165663259-165663281 CGGCGGCGGCGGCGGCGGCGTGG - Intronic
1018686480 6:166307961-166307983 AAGAGGCCGCCGGCCCGGCGCGG - Exonic
1019298498 7:291162-291184 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1019472643 7:1229678-1229700 CAGAGGCCGCGGCCCGGGCGGGG + Intergenic
1019577678 7:1745420-1745442 CGGCGGAGGCGGGGGCGGCGGGG - Exonic
1019689650 7:2403567-2403589 CGCCGGGGGCGGGGCCGGCGAGG + Exonic
1019714973 7:2534397-2534419 ACGGGGCGGCTGGCCCGGCGGGG + Intergenic
1019989551 7:4682247-4682269 CAGCGGCGGCGCGGGGGGCGGGG - Intergenic
1020130499 7:5556335-5556357 CAGGGGCCGCGGGCCGGGGGCGG - Intronic
1020278313 7:6637526-6637548 CGGCGGCGGCGGGGCCGGGCTGG + Intronic
1020552284 7:9621699-9621721 CCGGGCCGGCGGGGCCGGCGGGG + Intergenic
1021735591 7:23637317-23637339 AAGGGGCGGCTGGCCAGGCGGGG - Intronic
1021735691 7:23637542-23637564 AAGGGGCGGCTGGCCAGGCGGGG - Intronic
1021827887 7:24573160-24573182 CAGCCGCGGCGGGAGGGGCGGGG + Intergenic
1021998340 7:26201640-26201662 CAGCGGGCGCGCGCCCGGCGGGG - Intronic
1022207955 7:28180795-28180817 CGGCGGCGTCGGGAGCGGCGGGG + Intergenic
1022427592 7:30284299-30284321 CAGCGTCGGCGGGCCACGTGCGG + Exonic
1023418260 7:39951233-39951255 CTGCTGCGGCGGTCCCGGCGGGG - Exonic
1023972425 7:45000639-45000661 CAGAGGAAGTGGGCCCGGCGAGG + Intronic
1026765164 7:73155455-73155477 AAGCGGCGGCGGGGGCGGGGCGG - Intergenic
1026822278 7:73557578-73557600 TGGCGGCGGCGGGAGCGGCGGGG + Exonic
1027041637 7:74965210-74965232 AAGCGGCGGCGGGGGCGGGGCGG - Intronic
1027082005 7:75237159-75237181 AAGCGGCGGCGGGGGCGGGGCGG + Intergenic
1027198577 7:76048172-76048194 CAGCGCTGGCAGGCCGGGCGAGG - Exonic
1027421189 7:78019597-78019619 CAGACGCGGCGGACGCGGCGCGG - Exonic
1027654985 7:80919238-80919260 CCGCGGGGGCGGACCGGGCGGGG + Exonic
1027774127 7:82443742-82443764 GAGCGCCGGCGGGCTCGCCGAGG - Exonic
1028585568 7:92447894-92447916 CGGCGGCGGCGGCTTCGGCGCGG + Exonic
1029238742 7:99143836-99143858 CGGCGGCGGCGGGGCCGGGCCGG - Exonic
1029281563 7:99438956-99438978 CGGCGGCGGCGGCGGCGGCGAGG + Intronic
1029390588 7:100271704-100271726 AAGCGGCGGCGGGGGCGGGGCGG + Intronic
1029456207 7:100673813-100673835 CGGCGGCGGCGGCGGCGGCGCGG - Exonic
1029640397 7:101816391-101816413 CGGCGGCGCGGGGCCCGGGGGGG - Intronic
1029640539 7:101816757-101816779 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1030033443 7:105388914-105388936 CGGCGGCGGCGGCGCAGGCGCGG - Intronic
1031966491 7:128031406-128031428 CAGCTGCCGCCGGCCCGGAGCGG - Intronic
1032074568 7:128830336-128830358 CGGGGGCCGCGGGCGCGGCGGGG + Intergenic
1033099979 7:138461132-138461154 CAGCGGCGGCGGCGGCGGCGCGG - Intronic
1033197591 7:139341043-139341065 CAGGAGAAGCGGGCCCGGCGGGG - Intronic
1033220495 7:139523950-139523972 CGGCGGCGGCCGGGCCCGCGAGG - Exonic
1033406373 7:141074033-141074055 CGGCGGCGGCGAACCCAGCGCGG - Intergenic
1033654025 7:143361791-143361813 CAGCGGGGGCCGGCGGGGCGGGG - Intronic
1034166523 7:149028805-149028827 CAAAGGCGGCGGGCCGGGCACGG + Intergenic
1034219439 7:149432647-149432669 CAGCAGCAGCGGAACCGGCGCGG - Exonic
1034306280 7:150047662-150047684 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1034361854 7:150506363-150506385 ACGGGGCGGCGGGCCGGGCGGGG + Intergenic
1034618255 7:152436591-152436613 CAGCGGCGGCGCGCGGGGGGCGG - Intergenic
1034800566 7:154052988-154053010 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1035021381 7:155803067-155803089 CAGCGGCGGCGGGGACCGCGGGG - Exonic
1035196806 7:157228667-157228689 CAGAGGTGGCGGGCACGGCAGGG + Intronic
1036664797 8:10731128-10731150 CAGGGGCGGCGGGGGCGTCGAGG - Intronic
1036708059 8:11059671-11059693 CAGGTGCGGCGGGCGCGGGGCGG + Intronic
1036910629 8:12754875-12754897 CAGAGGCGGCGGCCGCGGGGCGG + Exonic
1037529218 8:19757329-19757351 CAGCGGCGGCGGCGGCGGCTCGG + Intronic
1037827024 8:22165571-22165593 CCCCGGCGACGGGCCAGGCGGGG + Intronic
1038002575 8:23404008-23404030 CAGCGGCGGCGGAAGCGGAGGGG - Exonic
1038304112 8:26383517-26383539 CAGCGGAGCCGGGCGGGGCGGGG + Intronic
1038828463 8:31032890-31032912 CGGGGGAGCCGGGCCCGGCGTGG - Exonic
1038883665 8:31640289-31640311 CGGCGGCGGCGGGCGAGGCAGGG + Intronic
1038883710 8:31640431-31640453 CAGCGCCGGCGAGCCCGGGGAGG + Intronic
1039238092 8:35525095-35525117 CAGCGGAGGCAGGCCGGGGGAGG - Intronic
1039467837 8:37796845-37796867 GACCGGCGGCGGGAGCGGCGCGG + Intronic
1039476452 8:37841626-37841648 CTGCGGCGGCGGGCAGGGCCCGG - Exonic
1040038839 8:42896759-42896781 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1040471589 8:47738731-47738753 CAGCGGCGGCCTGGCAGGCGGGG + Exonic
1041689925 8:60678793-60678815 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1041725119 8:61011026-61011048 CAGCGGTGACGGGACAGGCGTGG - Intergenic
1042049042 8:64685937-64685959 AAGGGGCGGCTGGCCGGGCGGGG - Intronic
1042561042 8:70072140-70072162 CAGCGGCCGGGGGGCAGGCGAGG - Intergenic
1042785093 8:72537379-72537401 CAGCGGCGGCGGCGGCCGCGGGG - Exonic
1044229433 8:89757696-89757718 CAGCGGCGGACGGCAAGGCGGGG - Intergenic
1044698913 8:94949189-94949211 GAGCGGCCGCCGGCTCGGCGGGG + Exonic
1045269443 8:100649554-100649576 CTGCGGCGGCGGGCGGTGCGCGG + Exonic
1045298660 8:100892634-100892656 CCGGGGCGGCTGGCCGGGCGGGG + Intergenic
1045516292 8:102863625-102863647 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1046659968 8:116938488-116938510 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1047000977 8:120571996-120572018 CAGCGGGGGTGGGGCCGGGGAGG - Intronic
1047254954 8:123207550-123207572 CAGCGGCGGGCGGGCCGTCGTGG - Exonic
1049109858 8:140635803-140635825 CGGCGGCGCCGGGTCTGGCGGGG + Intergenic
1049145971 8:141001240-141001262 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1049177326 8:141202201-141202223 ACGGGGCGGCTGGCCCGGCGGGG + Intergenic
1049585303 8:143430163-143430185 CACCGGCGGCGGCGGCGGCGCGG - Exonic
1049585398 8:143430491-143430513 CGCGGGCGGCGGTCCCGGCGGGG + Intergenic
1049689786 8:143953447-143953469 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1049721080 8:144115870-144115892 CTGCGCCGGCGGGGCCTGCGTGG + Intronic
1049746845 8:144266624-144266646 CGGCGGCGCCGGGCGCAGCGTGG - Exonic
1049759725 8:144326558-144326580 CGGCGGCGGCGGGCCTGCGGCGG - Exonic
1049762277 8:144336908-144336930 CGGCGGCGGCGGGCGGGGGGCGG + Intergenic
1049791036 8:144472843-144472865 CAGGGGCGGCCGGCCCGCCGCGG + Exonic
1049799114 8:144509612-144509634 CAGCGGCGGGCAGCCCGGCCTGG - Exonic
1052016083 9:23469512-23469534 TAGCGGGGGAGGGCCGGGCGTGG + Intergenic
1052192789 9:25678177-25678199 CAGCGGCGGCGGCGGCGGCGTGG - Exonic
1052991831 9:34523070-34523092 CGGCGGCGGCGGGAGCTGCGCGG + Intergenic
1053050675 9:34958404-34958426 AAGCGGGGGCGGGGGCGGCGGGG + Intronic
1053138279 9:35665244-35665266 CCGCGGAGGCGGGGCCGGGGAGG + Exonic
1053338708 9:37303132-37303154 CAGCAGTGGCTGGCCGGGCGTGG + Intronic
1053482288 9:38424490-38424512 CAGCGGCCGCGGGGCGGGAGCGG - Intergenic
1053697505 9:40651092-40651114 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054308797 9:63450501-63450523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1055091119 9:72365284-72365306 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1056475175 9:86946299-86946321 CGGCGCGGGCGGCCCCGGCGCGG - Exonic
1056475272 9:86946737-86946759 CGGCGGCGGCGAGGCCCGCGGGG - Exonic
1056992397 9:91423920-91423942 CATTGGCGGCGGGCCGGGGGCGG - Intergenic
1057259665 9:93576672-93576694 CGGGGGCGGCGGGGGCGGCGGGG - Exonic
1057328064 9:94084627-94084649 CGGCTGCAGCAGGCCCGGCGGGG + Exonic
1058053328 9:100427368-100427390 CAGCGGCGGCGCGGCAGCCGCGG - Intronic
1059211379 9:112515097-112515119 AAGGGGCGGCTGGCCGGGCGGGG - Intronic
1059483716 9:114611539-114611561 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1059633936 9:116154342-116154364 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
1060811241 9:126612622-126612644 CAGCGGCGCGGAGCCGGGCGGGG - Intergenic
1061196659 9:129110566-129110588 CAGCCGCGGCGGCGGCGGCGCGG - Exonic
1061873868 9:133534509-133534531 CGGCGGCGGCGGCCCAGGAGCGG - Intronic
1061975877 9:134067874-134067896 GGGCGGCGGCGGGCCGGGCTGGG - Intronic
1061982937 9:134116141-134116163 AAGGGGCGGCTGGCCGGGCGGGG + Intergenic
1061983261 9:134116895-134116917 AAGGGGCGGCTGGCCGGGCGGGG + Intergenic
1061983562 9:134117600-134117622 AAGGGGCGGCTGGCCGGGCGGGG + Intergenic
1061983886 9:134118354-134118376 AAGGGGCGGCTGGCCGGGCGGGG + Intergenic
1062341294 9:136094964-136094986 CCGCGGAGGGGGGCCGGGCGGGG - Intronic
1062414119 9:136439366-136439388 CGGCGGCTGCGGGGCCGGCTCGG + Exonic
1062499094 9:136844728-136844750 CACCGGCGGCGAGGCGGGCGCGG - Exonic
1062537753 9:137028315-137028337 AAGCGGGGGCGGGCGGGGCGCGG - Intronic
1062659130 9:137619172-137619194 CAGCGGCGGCGGCGGCGGCGGGG - Intronic
1062696238 9:137877698-137877720 CAGGGTGGGCGGGGCCGGCGCGG + Intergenic
1062696346 9:137877996-137878018 CCGGGGCGGCGGGGCCGGCGGGG + Exonic
1202779853 9_KI270717v1_random:24389-24411 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203773851 EBV:62189-62211 CAGTGGGGGCGGGGCCGGCGGGG - Intergenic
1203469641 Un_GL000220v1:110968-110990 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203469879 Un_GL000220v1:111682-111704 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203471023 Un_GL000220v1:115501-115523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203471476 Un_GL000220v1:116882-116904 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203477462 Un_GL000220v1:154940-154962 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203477700 Un_GL000220v1:155654-155676 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203478844 Un_GL000220v1:159473-159495 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203479297 Un_GL000220v1:160854-160876 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1185508242 X:644368-644390 CTGCGGGAGCGGACCCGGCGGGG - Intronic
1185751034 X:2609565-2609587 CAGGGGCGGGGCGCCCCGCGGGG + Intergenic
1185892824 X:3835715-3835737 CCGCGGCGGCTGTCCCGGCCGGG - Intronic
1185897932 X:3874135-3874157 CCGCGGCGGCTGTCCCGGCCGGG - Intergenic
1185903051 X:3912566-3912588 CCGCGGCGGCTGTCCCGGCCGGG - Intergenic
1186426121 X:9465281-9465303 CGGCGGCGGCGGGGCGGGGGCGG + Exonic
1187464466 X:19515184-19515206 CGGCGGCGGCGGGCACTGAGGGG + Exonic
1187518142 X:19990921-19990943 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1187547324 X:20266779-20266801 CAGCGGCGGCGGCCCCAGAGAGG + Exonic
1189310040 X:40012490-40012512 CGGCTGCGGCCGGCGCGGCGCGG + Intergenic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1190337195 X:49269821-49269843 CACCGGCGGCGGGACCGGCGGGG - Intronic
1190337286 X:49270091-49270113 CGGCGGCGGCGGGGCCGACGAGG + Exonic
1190712929 X:53082575-53082597 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1190839130 X:54129137-54129159 CCGGGGCGGCTGGCCTGGCGGGG + Intronic
1192034375 X:67546547-67546569 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1193362318 X:80591487-80591509 AAGGGGCGGCTGGCCGGGCGGGG - Intergenic
1194714592 X:97275295-97275317 GAGGGGCGGCTGGCCCGGCGGGG + Intronic
1194977680 X:100410212-100410234 CGGCGGCGGCTGGCGCAGCGCGG - Exonic
1195716957 X:107826721-107826743 CAGCCTGGCCGGGCCCGGCGCGG + Intronic
1196684087 X:118495947-118495969 CAGCGGCGGCGGGCGGGTCTCGG - Exonic
1196909228 X:120468961-120468983 CGGCGGCGGTTGGCCCGGGGAGG - Intronic
1197736195 X:129851212-129851234 AAGGGGCGGCTGGCCGGGCGGGG - Intergenic
1198533581 X:137566823-137566845 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
1199500383 X:148500722-148500744 CAGCGGCGGCGGGGGCGGCCGGG - Exonic
1199772833 X:150984712-150984734 CCGCAGCGGCGGCCCGGGCGGGG - Intronic
1200098178 X:153673842-153673864 CGGAGGGGGCGGGGCCGGCGGGG - Intronic
1201223005 Y:11789674-11789696 CATCAGCGGCAGGCCAGGCGGGG - Intergenic