ID: 903907462

View in Genome Browser
Species Human (GRCh38)
Location 1:26696684-26696706
Sequence CTTCAGGTCCGGCTCCGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903907462_903907467 -4 Left 903907462 1:26696684-26696706 CCGGCGCGGAGCCGGACCTGAAG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 903907467 1:26696703-26696725 GAAGAACTCGAACGGGAACGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
903907462_903907469 4 Left 903907462 1:26696684-26696706 CCGGCGCGGAGCCGGACCTGAAG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 903907469 1:26696711-26696733 CGAACGGGAACGCGGGCCCTAGG 0: 1
1: 0
2: 0
3: 3
4: 34
903907462_903907474 29 Left 903907462 1:26696684-26696706 CCGGCGCGGAGCCGGACCTGAAG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 903907474 1:26696736-26696758 CGCCCTGAACAATAACCTCACGG 0: 1
1: 0
2: 0
3: 6
4: 43
903907462_903907468 -3 Left 903907462 1:26696684-26696706 CCGGCGCGGAGCCGGACCTGAAG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 903907468 1:26696704-26696726 AAGAACTCGAACGGGAACGCGGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903907462 Original CRISPR CTTCAGGTCCGGCTCCGCGC CGG (reversed) Exonic
900948640 1:5845175-5845197 CTTGAGATCCGGCTGCCCGCTGG - Intergenic
901551373 1:9997895-9997917 CTTCAGGTCCGGGCACCCGCGGG + Intronic
903907462 1:26696684-26696706 CTTCAGGTCCGGCTCCGCGCCGG - Exonic
903950458 1:26993523-26993545 CTTCAGGTCCTGCCCTTCGCCGG - Intergenic
905074001 1:35253455-35253477 CTGCAGGTTCCGCTCCTCGCGGG - Intergenic
920256591 1:204659411-204659433 CTTCAGGCCGGGCTCCATGCAGG - Intronic
921213813 1:212920904-212920926 CTTTGGGTCTGGCTCCGGGCTGG + Intergenic
1070768380 10:79069139-79069161 CTCCGGCTCCTGCTCCGCGCCGG - Exonic
1075667969 10:124244378-124244400 ATTCAGGTCCGGCTCTGCCCGGG + Intergenic
1081538641 11:44014272-44014294 CTTGAGGTCCAGCTGCGGGCAGG + Intergenic
1084065400 11:66701072-66701094 CTCCAGGTCCCGCTCCGTGCCGG + Exonic
1084179368 11:67438800-67438822 CTTCAGGTCCCGCTGCTTGCTGG + Exonic
1089432740 11:118436811-118436833 CTTCAGGGCCGGCCCTGCTCCGG + Exonic
1096640856 12:52993313-52993335 CTTCAGCTCCGGCTCCCTGAAGG - Intergenic
1097043747 12:56172130-56172152 CTTCAGGACCAGCTCCAGGCTGG - Intronic
1103464724 12:121132932-121132954 GCTCTGGTCCAGCTCCGCGCAGG + Exonic
1103704944 12:122866399-122866421 CTTCAGGGCCGGCTCCAGGCAGG + Exonic
1113200949 13:107867202-107867224 CTCCCGCTCCTGCTCCGCGCTGG + Intergenic
1113726490 13:112606534-112606556 CCTCAGGGCCGGACCCGCGCGGG - Intergenic
1119303962 14:73592126-73592148 CTCCAGGTCCAGCTCGCCGCGGG - Exonic
1119306585 14:73612738-73612760 CTCCAGGTCCAGCTCGTCGCGGG - Intronic
1121936348 14:98022804-98022826 CTGCAGGTCAGGCACCGCACCGG - Intergenic
1125604024 15:40930005-40930027 CTTCGGGACCGTCTCCACGCCGG + Exonic
1127984928 15:64061812-64061834 CTTCAGGTCCCGTTCCACACTGG + Intronic
1128315114 15:66655132-66655154 CTCCCGGCCCGGCTCCGCGCTGG + Intronic
1132512954 16:353062-353084 CTTCCGGCCCCGCCCCGCGCCGG - Intergenic
1133924694 16:10183001-10183023 CTGCTGGGCCAGCTCCGCGCCGG + Intergenic
1135557951 16:23452913-23452935 CTTCAGGGCCGGCTCCAAGGAGG - Exonic
1136399529 16:30010093-30010115 CTTCAGGTCCTGGTCCCCGGGGG + Exonic
1138289251 16:55832891-55832913 CAACAGGTCCGGCTCTGCGGCGG - Intronic
1139447501 16:67006852-67006874 CTTCAGGTCCAGCACTGGGCAGG - Intronic
1151370834 17:73645206-73645228 CCGCAGCTCCGGCTCGGCGCAGG - Intergenic
1152817785 17:82418495-82418517 CGTCCGGCCCGGCTCCGCGGCGG - Exonic
1152885334 17:82846039-82846061 CTTCAGGAACGGCTCCGGGCCGG + Intronic
1160583264 18:79899683-79899705 CTGCAGGGCCGGCTCGGGGCTGG - Exonic
1160855335 19:1214763-1214785 CTTCAGGTCCAGCACCGCTCTGG - Intronic
1165533261 19:36421693-36421715 CTCCAGGTCCAGCTCGCCGCGGG - Intergenic
1165718691 19:38063581-38063603 TTGCAGGTCAGGCTCCGTGCTGG + Intronic
1166301154 19:41912916-41912938 CTGCAGGGCCGGCTCCGCCATGG - Intronic
1166694791 19:44846410-44846432 CTCCGGCTCCGGCTCCGGGCCGG - Intronic
1168311891 19:55464726-55464748 CTTCAGGTCGGGCTCCTGGGAGG - Intergenic
926035211 2:9630816-9630838 CCTCAGGGACGGCTCCGGGCGGG - Intronic
932201272 2:69830170-69830192 GTGCGGGTCCGGGTCCGCGCGGG - Intronic
939178486 2:138779555-138779577 TTTCATGCCCAGCTCCGCGCAGG - Intronic
945675217 2:212847527-212847549 CTGCATGTCAGGCTCTGCGCAGG - Intergenic
1169143497 20:3238671-3238693 CTTCCCGTCCGGCGCCGCGGTGG - Intronic
1175926544 20:62474234-62474256 CTCCAGGCCCGGCCCGGCGCCGG + Intronic
1178334442 21:31731510-31731532 CCACAGGCCCCGCTCCGCGCAGG + Intronic
1180086578 21:45510396-45510418 CTTCAGGGCAGGCTCCGGGTGGG + Intronic
1182494243 22:30695032-30695054 TTCCACGTCCGGCTCCGGGCCGG + Exonic
1182528969 22:30940783-30940805 CTTCACCTCCTGCTCCGCACGGG + Exonic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
953609225 3:44433642-44433664 CTGCAGGTCCGGCTCCTCTAAGG - Intergenic
968452153 4:680828-680850 CTTCAGCTCCTGCTAGGCGCCGG + Intronic
968629146 4:1641311-1641333 CTCCAGGTCCAGCTCCCAGCGGG + Exonic
968705665 4:2076258-2076280 CTTAAGGGCCGGCGCCACGCTGG + Intronic
969711603 4:8847527-8847549 CTTCAGGTCCGCCTGCTCTCGGG - Intronic
977231064 4:94451974-94451996 CCTCGGGTCCGGCGCGGCGCGGG - Exonic
990749847 5:59002635-59002657 CCTCAGGTCTGGCTCTGGGCTGG - Intronic
992529184 5:77638888-77638910 CTTTAGCTCCTGCTCCGGGCTGG - Exonic
999175526 5:149629119-149629141 CTTCAGGTCCCACTCCTGGCTGG - Intronic
1001676263 5:173519181-173519203 CTTCAGCTCCAGCTCCATGCTGG + Intergenic
1002351989 5:178589919-178589941 CTCCAGGTGCGGCTCGGCCCAGG + Exonic
1002662860 5:180803101-180803123 CTTCAGGCGCGGCTCCAGGCTGG - Intronic
1006993962 6:38240380-38240402 CTTTAGGTCAGGCTCTGTGCTGG - Intronic
1022196306 7:28070560-28070582 CCCCATGTCCGGCTCCGGGCAGG + Intronic
1034264096 7:149773022-149773044 GGTCACGGCCGGCTCCGCGCAGG - Intronic