ID: 903909140

View in Genome Browser
Species Human (GRCh38)
Location 1:26709464-26709486
Sequence GGTGCTGTTGAGAACTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903909140_903909142 -4 Left 903909140 1:26709464-26709486 CCATGGAAGTTCTCAACAGCACC 0: 1
1: 0
2: 1
3: 10
4: 136
Right 903909142 1:26709483-26709505 CACCCCCGACCCAGGACCCCAGG 0: 1
1: 0
2: 2
3: 46
4: 388
903909140_903909155 25 Left 903909140 1:26709464-26709486 CCATGGAAGTTCTCAACAGCACC 0: 1
1: 0
2: 1
3: 10
4: 136
Right 903909155 1:26709512-26709534 CTGGCCCTGCTTCTCAATTCAGG 0: 1
1: 0
2: 0
3: 21
4: 187
903909140_903909149 6 Left 903909140 1:26709464-26709486 CCATGGAAGTTCTCAACAGCACC 0: 1
1: 0
2: 1
3: 10
4: 136
Right 903909149 1:26709493-26709515 CCAGGACCCCAGGTTCCCACTGG 0: 1
1: 0
2: 6
3: 29
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903909140 Original CRISPR GGTGCTGTTGAGAACTTCCA TGG (reversed) Intronic