ID: 903909149 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:26709493-26709515 |
Sequence | CCAGGACCCCAGGTTCCCAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 323 | |||
Summary | {0: 1, 1: 0, 2: 6, 3: 29, 4: 287} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
903909140_903909149 | 6 | Left | 903909140 | 1:26709464-26709486 | CCATGGAAGTTCTCAACAGCACC | 0: 1 1: 0 2: 1 3: 10 4: 136 |
||
Right | 903909149 | 1:26709493-26709515 | CCAGGACCCCAGGTTCCCACTGG | 0: 1 1: 0 2: 6 3: 29 4: 287 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
903909149 | Original CRISPR | CCAGGACCCCAGGTTCCCAC TGG | Intronic | ||