ID: 903911344

View in Genome Browser
Species Human (GRCh38)
Location 1:26728258-26728280
Sequence CTGTTCTTCTTAATATCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 343}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903911344 Original CRISPR CTGTTCTTCTTAATATCAAA GGG (reversed) Intronic
902980439 1:20118987-20119009 TTGGTCTGCTTAAGATCAAATGG + Intronic
903911344 1:26728258-26728280 CTGTTCTTCTTAATATCAAAGGG - Intronic
904544794 1:31260961-31260983 ATTTTCTTCTTGATCTCAAAGGG - Intronic
905085408 1:35371034-35371056 CTTTTCTTCTTAACCTTAAATGG + Intronic
905568179 1:38982732-38982754 CTGTTCTTTTTATTATCTAAAGG + Intergenic
908591690 1:65643645-65643667 CTTTTCTTATTAATATAAGAAGG - Intergenic
908720233 1:67117587-67117609 ATGTTCTTATTAATATCATTGGG + Intronic
908833284 1:68203210-68203232 CTGATCTTCTGAATATGCAATGG - Intronic
909133071 1:71763979-71764001 CTGTTCTTCTTTATACTACATGG - Intronic
910892993 1:92037376-92037398 CGGGTCTTCTTAAAATCTAAAGG + Intronic
911570811 1:99514894-99514916 TTTTTCTTCTTAATATAAGAAGG + Intergenic
914288876 1:146253822-146253844 CTCTTCTTCTTATTATTATAAGG + Intergenic
914549911 1:148704565-148704587 CTCTTCTTCTTATTATTATAAGG + Intergenic
914887042 1:151593962-151593984 GTGTACTTCTAAATTTCAAATGG + Intergenic
914972288 1:152318509-152318531 CTCTTCTACTCAATCTCAAAAGG + Intronic
915058060 1:153155056-153155078 CTCTTCTTCTAAATGCCAAATGG + Intergenic
915184019 1:154088632-154088654 CTGTTGTTCTTCATAATAAAAGG + Intronic
916346163 1:163793706-163793728 ATGTTCTTGTTAATGTGAAATGG + Intergenic
917031984 1:170702953-170702975 CTGTTCTTCTCTTGATCAAATGG - Intronic
917489718 1:175487798-175487820 CTCTTGTTTTTAATACCAAATGG + Intronic
918953727 1:191176440-191176462 ATATTCTTCTTAACTTCAAATGG + Intergenic
919143377 1:193601920-193601942 CTCTTTTTCTTAATATTTAAAGG + Intergenic
919164845 1:193879572-193879594 CTGTTCATTTTCATATCCAAGGG - Intergenic
919328866 1:196143405-196143427 ATGCTCTTCTTAATATAAATGGG + Intergenic
919427585 1:197451775-197451797 CTTTTCTTCTTAATGTCATATGG + Intronic
921414833 1:214873662-214873684 CTGTTCATCTTTGTATGAAAAGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922328398 1:224552018-224552040 ATGTTACTCTTAATATCACACGG - Intronic
922742861 1:228024893-228024915 CTGTTCTTTTTCCCATCAAATGG + Intronic
923075929 1:230608632-230608654 TTTTTCTTATTAATATCAGAAGG + Intergenic
923272286 1:232367630-232367652 CTGTTCTCCTAAACAGCAAAGGG - Intergenic
923940474 1:238818092-238818114 CTCTTTTTCTTATTTTCAAAAGG + Intergenic
924053086 1:240097001-240097023 CTGTTATACTTAATATGTAAAGG - Intronic
1063509168 10:6630036-6630058 TTTTTCTTATTAATATCAGAAGG - Intergenic
1063718965 10:8559143-8559165 CTGTTCTTCTTATTTAGAAAGGG - Intergenic
1063807564 10:9664012-9664034 ATTTTCTTCTCAATATCACATGG - Intergenic
1064396136 10:14983556-14983578 CTATTGTTCTTAATATTCAAAGG + Intronic
1067791418 10:49290917-49290939 CTGTTCTTTTTAATGAGAAATGG + Intergenic
1068037992 10:51784865-51784887 CTTTCCTTTTTAATATTAAAAGG + Intronic
1068398039 10:56489350-56489372 CTTTGCATCTTCATATCAAAAGG - Intergenic
1070975349 10:80602091-80602113 CTGTGCTTCTAAATCTCAAATGG - Intronic
1071409092 10:85369510-85369532 TTGTTCTTATTAGTTTCAAAGGG + Intergenic
1073079494 10:100849851-100849873 CTTTTCTGCTTAATATAGAATGG + Intergenic
1074263489 10:111877540-111877562 CAGGTCTTATTAATATCAAAAGG + Intergenic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1078832344 11:14990095-14990117 TTGTTATTCATAATATCCAAGGG + Intronic
1080222872 11:29926734-29926756 ATGTTCTTTTTAAGTTCAAATGG - Intergenic
1080961802 11:37169077-37169099 CTGTTCCTTTTAATATGAATAGG + Intergenic
1082936892 11:58664580-58664602 ATATTCTTCTTAATATCCAGGGG - Intronic
1083460632 11:62808983-62809005 CTTTTGTTTTAAATATCAAATGG + Intronic
1084261784 11:67983852-67983874 ATATTGTTCTTAATATCAAGGGG + Intergenic
1084810858 11:71610256-71610278 ATATTGTTCTTAATATCAAGGGG - Intergenic
1085553086 11:77393597-77393619 TTCTTCTTCTAAATATAAAATGG + Intronic
1087194011 11:95286352-95286374 TTTTTCTTCTGAATATCATATGG + Intergenic
1089978982 11:122756828-122756850 CTGTGCTTCTTAATTTCCACTGG - Intronic
1090718737 11:129453589-129453611 CTGTTGATCTCAATAACAAAGGG - Intergenic
1090933922 11:131324888-131324910 CTGTTCATCATAATATCCAGTGG - Intergenic
1091361335 11:134980800-134980822 CTCTTCTTCTTACTTCCAAAAGG - Intergenic
1091502396 12:1031457-1031479 CTATTCTAGTTAATATCACAGGG + Intronic
1091916308 12:4273601-4273623 CTGTTCTCCTTAATAACGAGAGG + Intergenic
1092100000 12:5875281-5875303 CTGTGCTTCTTAGTATCTCATGG - Intronic
1092435660 12:8445058-8445080 ATATTGTTCTTAATATCAAGGGG + Intergenic
1092770881 12:11895421-11895443 CTGTTTTTAATAATATGAAATGG + Intergenic
1092822589 12:12366460-12366482 CTGTTCCTTTTTTTATCAAAGGG + Intronic
1092947196 12:13467541-13467563 CTTTTCTTCTTAACAGCATAAGG - Intergenic
1094314748 12:29127290-29127312 ATGTTCTTCTTAAGGTCATATGG - Intergenic
1095358101 12:41301340-41301362 CTGTTCTGCAGAATAACAAAGGG - Intronic
1097046480 12:56190464-56190486 TTCTTCTTCTTATTATTAAAAGG + Intergenic
1097433707 12:59536158-59536180 ATGTTCTTCCTAATATCCTATGG + Intergenic
1097433785 12:59536734-59536756 ATGTTATTCCTAATATCACAGGG + Intergenic
1097546482 12:61008641-61008663 CTATGCTTATGAATATCAAAAGG + Intergenic
1097583865 12:61491948-61491970 CTGTTCTTCTAAATACAAACTGG - Intergenic
1099181047 12:79473007-79473029 ATATTGTTCCTAATATCAAAGGG + Intergenic
1100027784 12:90150990-90151012 CTTTTCTTTTAAATATCAATGGG + Intergenic
1102193039 12:111003484-111003506 CTGTTGTACTTAATATACAATGG - Intergenic
1102803065 12:115753881-115753903 CATTTCTACTTAAGATCAAATGG + Intergenic
1103882889 12:124180083-124180105 GTGTCCTTCTTAGTTTCAAAGGG + Intronic
1104229537 12:126871090-126871112 CTGTTTGTCTTATCATCAAATGG - Intergenic
1107544796 13:41425703-41425725 ATATTCTTCTTAATAGCACAGGG + Intergenic
1107544842 13:41425971-41425993 ATATTGTTCTTAATATCAAGGGG + Intergenic
1107548120 13:41452761-41452783 ATATTCTTCTTAATAGCACAGGG - Intergenic
1109538504 13:63743624-63743646 CTATTATTCATAATATCCAAGGG - Intergenic
1109545335 13:63836145-63836167 CTATTATTCATAATATCCAAGGG + Intergenic
1109668207 13:65566799-65566821 CTGAAGTTCTTAATATAAAATGG + Intergenic
1109925376 13:69130559-69130581 CTGATCTGCTCAATTTCAAAAGG + Intergenic
1111682772 13:91464271-91464293 CTGTTCATGGTAATATAAAATGG + Intronic
1113181074 13:107627335-107627357 CTGTTCTCTTTAATAACACAGGG - Intronic
1113249791 13:108439654-108439676 CTGCTCCTCTTGATATTAAAGGG - Intergenic
1114436500 14:22711514-22711536 ATATTCTTCCTAATATCACAAGG + Intergenic
1115195888 14:30798945-30798967 CTGATCTTCTTAGTTCCAAAGGG + Intergenic
1115196267 14:30803271-30803293 CTGATCTTCTTAGTTCCAAAGGG + Intergenic
1116518138 14:45823266-45823288 ATATTGTTCCTAATATCAAAAGG + Intergenic
1116518184 14:45823575-45823597 ATATTCTTCGTAATATCCAAAGG + Intergenic
1116518233 14:45823886-45823908 ATATTCTTCGTAATATCCAAAGG + Intergenic
1116518885 14:45827935-45827957 ATATTGTTCTTAATATCCAATGG + Intergenic
1117038102 14:51747254-51747276 ATATTGTTCTTAATATCAAGGGG - Intergenic
1117038147 14:51747522-51747544 ATATTCTTCTTAATAGCACAGGG - Intergenic
1117743626 14:58844985-58845007 CAGTGCTGCTTAATACCAAAAGG - Intergenic
1117964751 14:61195494-61195516 ATGTTCTTCATAAAATCAAATGG + Intronic
1118398158 14:65355156-65355178 CTTTACTTTTTAAAATCAAATGG + Intergenic
1118695701 14:68382942-68382964 CTGTTCTTCCTGATAACACATGG + Intronic
1120228877 14:81821308-81821330 CTATTTTTCCTAATAACAAAGGG + Intergenic
1120228919 14:81821732-81821754 CTATTTTTCCTAATAACAAAGGG + Intergenic
1120529427 14:85614364-85614386 CTTTTTTTTTTAATTTCAAAGGG - Intronic
1121568242 14:94926502-94926524 TTGTTATTCTTATAATCAAAGGG + Intergenic
1122501789 14:102205319-102205341 CTCTTCTTTTTCATACCAAAGGG - Intronic
1122604859 14:102941391-102941413 CTTTTCTTCTGAATACAAAAAGG + Intronic
1202845160 14_GL000009v2_random:164842-164864 GTGTTCTGTTTAATCTCAAAGGG + Intergenic
1202914561 14_GL000194v1_random:155114-155136 GTGTTCTGTTTAATCTCAAAGGG + Intergenic
1202875628 14_GL000225v1_random:206383-206405 GTGTTCTGTTTAATCTCAAAGGG - Intergenic
1202878108 14_KI270722v1_random:27601-27623 GTGTTCTGTTTAATCTCAAAGGG - Intergenic
1123957955 15:25359737-25359759 CTGTTCTACTTTATCACAAAAGG + Intronic
1125223024 15:37361762-37361784 CAGCTCTTCTGCATATCAAAAGG - Intergenic
1126296631 15:47144930-47144952 CTGTTCTTCTTAAGCACACATGG + Intergenic
1126435722 15:48635689-48635711 CTGATTTTCTTAAAAGCAAATGG + Intronic
1126730740 15:51680087-51680109 CTGTTATTATGAAGATCAAATGG - Intergenic
1126954919 15:53922586-53922608 ATTTTCTGCTTAATATAAAAAGG - Intergenic
1127233755 15:57024696-57024718 CTATTCTTCTTACTATGGAATGG - Intronic
1127352044 15:58162841-58162863 CTGCTCTACTTGGTATCAAATGG - Intronic
1130169659 15:81498216-81498238 GTGTTCTTATTAACATAAAAAGG - Intergenic
1130241810 15:82200554-82200576 CTGCTTCTCTTAACATCAAATGG + Intronic
1131625192 15:94110442-94110464 CTATTTTTATTATTATCAAAAGG + Intergenic
1131670941 15:94619007-94619029 CTGTTCTTCTGAAATCCAAATGG - Intergenic
1133210380 16:4260341-4260363 CTCTGCTTCTTAATATAAAGGGG - Intronic
1135666415 16:24339141-24339163 CTATTCTTTTTAATTTAAAAGGG + Intronic
1138467662 16:57203966-57203988 TTATTCTCCTTGATATCAAATGG + Intronic
1141055565 16:80810636-80810658 CTCTGCTTCTTTATAGCAAAAGG - Intergenic
1144853444 17:18255531-18255553 CTCTTCTTCTTAATTCCAGAAGG + Intronic
1146511067 17:33449144-33449166 CTGTTATTCTCAACCTCAAAGGG - Intronic
1149068494 17:52509625-52509647 CTGTTTTTCATTATGTCAAATGG + Intergenic
1149394595 17:56226685-56226707 CTGTTATTATTACTATCAGAAGG - Intronic
1149410359 17:56398816-56398838 TTGTTCTTCATAATATCACATGG - Intronic
1151131297 17:71899522-71899544 CATTTCTTCTTAAGATTAAATGG - Intergenic
1153528870 18:6023422-6023444 ATGTTCTTCGTTCTATCAAAAGG - Intronic
1153635738 18:7111469-7111491 CTGTGCTATTTATTATCAAATGG + Intronic
1154002331 18:10492905-10492927 GTTTTCTTCCTAATATCAAATGG + Intergenic
1154493965 18:14942124-14942146 CTCTTCTTCTTACTTCCAAAAGG + Intergenic
1155726771 18:29096038-29096060 TTATTCTTGTTAGTATCAAATGG + Intergenic
1156900427 18:42294729-42294751 TTGTGCTCCTTAATACCAAAAGG + Intergenic
1157992563 18:52514632-52514654 CTGTGCTGCTTATTATCAAATGG + Intronic
1159567186 18:70064971-70064993 TTGATCTTCTTAAGAACAAAAGG - Intronic
1159897049 18:74007382-74007404 CTTTTCTTCTTAATGACAATGGG - Intergenic
1163219034 19:15901062-15901084 ATCTTCTTCTTAATACCACATGG + Intergenic
1164994834 19:32713076-32713098 CAATTCTTTTTAAAATCAAATGG + Exonic
1168357193 19:55708664-55708686 TTGTGCTTCTAAATATCACAAGG + Exonic
1168668607 19:58224016-58224038 CTTTTCTTCTGAATATTAAAGGG - Intergenic
1202672570 1_KI270710v1_random:5328-5350 GTGTTCTGTTTAATCTCAAAGGG + Intergenic
926794189 2:16605526-16605548 CCGTTCTGCCTAATTTCAAATGG + Intronic
926849617 2:17180637-17180659 CTTTTCTCCTTGAAATCAAAGGG + Intergenic
927574080 2:24186435-24186457 GTATTCTTCTTAAACTCAAAGGG + Intronic
927730514 2:25467181-25467203 TTGTTATTCTAAATTTCAAAGGG + Intronic
929623828 2:43385863-43385885 TTTTTTTTTTTAATATCAAATGG - Intronic
930042445 2:47137785-47137807 CTGTCCTTTTTAATGTCAATAGG + Intronic
930613803 2:53572215-53572237 TTGTTTTTCATATTATCAAAGGG - Intronic
931081291 2:58774698-58774720 GTGTTAGTCTTAATATAAAAAGG + Intergenic
931842520 2:66169398-66169420 TTGATATTCATAATATCAAAGGG - Intergenic
932384273 2:71316619-71316641 TTCTTCTTCTTTATATCAACTGG + Intronic
932895198 2:75632693-75632715 CTTTTCTTCTTAACAGCAAAAGG + Intergenic
933136453 2:78741903-78741925 CTGTTCTGCCTAATTCCAAAAGG + Intergenic
933544128 2:83688397-83688419 ATGTTCTTCCTAATGACAAATGG - Intergenic
935348756 2:102135142-102135164 CTGTTTTTTTTAAAATCAAAAGG + Intronic
938774202 2:134526811-134526833 ATGTTCTTCTTAAAATATAATGG - Intronic
938837149 2:135117031-135117053 ATTTTTTTTTTAATATCAAAGGG - Intronic
939363213 2:141200578-141200600 GTGGTCTTCTTAATATCTACTGG - Intronic
940247730 2:151637500-151637522 CTCTTCTTTTTAACATCAGAGGG + Intronic
940874643 2:158886951-158886973 ATATTGTTCTTAATATCCAAGGG - Intergenic
941049788 2:160719767-160719789 GTGTTCTACTTGATATCAATGGG + Intergenic
941283764 2:163583708-163583730 CTGTTCATCTTAATATGATCTGG + Intergenic
941368203 2:164632806-164632828 CTGTTCCTCTTAGTATTTAAAGG + Intergenic
941533309 2:166694667-166694689 CTGTTGTTCCTAATATCCAGGGG - Intergenic
941612878 2:167683235-167683257 CTGTACTTCTTTATATTACAGGG + Intergenic
942086869 2:172451933-172451955 CTGTTCTTTTTGAAATCACATGG + Intronic
942597541 2:177606401-177606423 ATGCACTTCTTAATATAAAATGG - Intergenic
942812943 2:180019060-180019082 ATGTTACTCTTAATGTCAAAGGG - Intergenic
943356944 2:186867680-186867702 CTCTTCTTCTTAAGGTCAATCGG + Intergenic
944339026 2:198573319-198573341 CTGATCATCTTAAAATCAGATGG + Intergenic
944939699 2:204610284-204610306 CTGTTCTTCTTAATGTAATATGG + Intronic
945499844 2:210558169-210558191 CTGGTTTTCTTAATTTAAAATGG - Intronic
946113292 2:217438816-217438838 CTGTTCTTCTTGATAGGAATTGG - Intronic
948612303 2:239177653-239177675 ATGTTTGTCTTAATAACAAAAGG + Intronic
1169514289 20:6299322-6299344 CTTTTCTTCTTACTATTAAAAGG - Intergenic
1169665346 20:8028157-8028179 GTGTAGTTCTTTATATCAAAGGG + Intergenic
1174572602 20:51512901-51512923 CTGCTCTTCTGGATATGAAAGGG + Intronic
1174763269 20:53227995-53228017 CTGATCTTTATAATTTCAAATGG + Intronic
1176275807 20:64268096-64268118 TGGTGCTTTTTAATATCAAAAGG - Intronic
1176633914 21:9169759-9169781 GTGTTCTGTTTAATCTCAAAGGG + Intergenic
1176639402 21:9285066-9285088 TTGTTCTGTTTAATCTCAAAGGG - Intergenic
1176871664 21:14087530-14087552 CTGCTCTCCTAAATATTAAAGGG + Intergenic
1177569116 21:22863427-22863449 CCATTCTTCTTACTATGAAAAGG - Intergenic
1177657463 21:24037254-24037276 CTGTTGTTATTAATTTCACATGG - Intergenic
1177698952 21:24611895-24611917 CTCTTTTTCTGAAGATCAAAAGG - Intergenic
1177809554 21:25911232-25911254 TTCCTCTTCTTAATATAAAATGG - Intronic
1178770613 21:35500385-35500407 CATTCCTTCTTAATGTCAAATGG + Intronic
1178819834 21:35965086-35965108 CTGAACTTCTTTATATCAATGGG - Intronic
1180372707 22:12057896-12057918 TTGTTCTGTTTAATCTCAAAGGG - Intergenic
1180416169 22:12716710-12716732 GTGTTCTGTTTAATCTCAAAGGG - Intergenic
1180423448 22:12892555-12892577 TTGTTCTGTTTAATCTCAAAGGG - Intergenic
1183116924 22:35699508-35699530 ATATTGTTCTTAATATCCAAAGG + Intergenic
1183835114 22:40446053-40446075 ATGTACTTCTTAACATCAAGGGG + Intronic
949796054 3:7852274-7852296 CTTTTTGTCTTAATTTCAAATGG + Intergenic
950332977 3:12171446-12171468 CTGTTTTTCTCAGTATTAAAGGG - Intronic
951645443 3:24885445-24885467 CTGTGGTTCTGAATATTAAATGG + Intergenic
951846360 3:27088891-27088913 CTGGTCTTATGAATGTCAAATGG - Intergenic
952699017 3:36305570-36305592 GTGATTTTTTTAATATCAAAAGG + Intergenic
952826461 3:37529246-37529268 CAGATCTTATTAATATAAAAGGG + Intronic
953067898 3:39491545-39491567 TTGTAATTCTTAATTTCAAATGG + Intronic
954909875 3:54095513-54095535 TTGTTCTTCTAGATGTCAAAAGG - Intergenic
957045096 3:75367401-75367423 CTATTATTCTTAATCTCATAAGG + Intergenic
957076811 3:75609167-75609189 ATATTCTTCTTAATAGCACAGGG + Intergenic
957076854 3:75609434-75609456 ATATTGTTCTTAATATCAAGGGG + Intergenic
957408158 3:79798997-79799019 TGGTTCTTCTTAAAATTAAATGG - Intergenic
958505319 3:94969196-94969218 GTGCTTTTCTTAATATCCAAGGG + Intergenic
958620890 3:96558138-96558160 CTTATCTTTCTAATATCAAAAGG - Intergenic
960927829 3:122813661-122813683 CTTTTCCGCTTAATACCAAAGGG + Intronic
963485124 3:145926058-145926080 CTATTGTTCTTATTATCACATGG - Intergenic
963585958 3:147188639-147188661 CTGTGCTTCATAATCTCATATGG - Intergenic
964273084 3:154979425-154979447 ATGTTTTTCTAAATATCAAAGGG + Intergenic
964670441 3:159219518-159219540 CTCCTCTTCTGAACATCAAATGG - Intronic
967596599 3:191332055-191332077 CTATTCTTCTTAATCTCTATTGG - Intronic
967805406 3:193711127-193711149 CTTTTCTTCTTCTTGTCAAAGGG - Intergenic
967986073 3:195096154-195096176 CTTTTCTGCTTAAGGTCAAAGGG - Intronic
1202747492 3_GL000221v1_random:119961-119983 TTGTTCTGTTTAATCTCAAAGGG + Intergenic
969020302 4:4135728-4135750 ATATTGTTCTTAATATCAAGGGG + Intergenic
969733549 4:8971686-8971708 ATATTGTTCTTAATATCAAGGGG - Intergenic
969793136 4:9505744-9505766 ATATTGTTCTTAATATCAAGGGG - Intergenic
970771900 4:19623352-19623374 ATGTTCTTATTCATATAAAATGG - Intergenic
972909224 4:43793789-43793811 TTCTTCTCCTTAATATCAATAGG - Intergenic
973013087 4:45101974-45101996 CTGTTTCTTTTACTATCAAATGG - Intergenic
973856555 4:55016713-55016735 CTCTTCTTCTTATTATTAAAAGG - Intergenic
974097722 4:57383284-57383306 CTTTTCTTCTAAACTTCAAATGG - Intergenic
976810299 4:89093124-89093146 TTGTTCTACTTTATATCATAAGG - Intronic
977407456 4:96618036-96618058 CTTTTCTTTTTAATCACAAAGGG + Intergenic
978214263 4:106179505-106179527 ATGTGCTTCTGAATAGCAAATGG - Intronic
978382978 4:108149977-108149999 CTTTTCTTCTTTTTCTCAAAAGG - Intronic
979123885 4:116941862-116941884 ATGTATTTTTTAATATCAAAAGG - Intergenic
979793994 4:124821402-124821424 CACTTCTTCTATATATCAAAAGG - Intergenic
980067655 4:128207945-128207967 CTTTTCCTCTTGAAATCAAATGG - Intronic
982538379 4:156636555-156636577 GTTTTCTTCTTACTTTCAAATGG + Exonic
983623703 4:169784642-169784664 ATGTTGTTCATAATATCCAAGGG + Intergenic
984085725 4:175308881-175308903 CTTTTTTTCTCATTATCAAAAGG - Intergenic
984145388 4:176054091-176054113 CTTTTCCTCATATTATCAAATGG - Intergenic
984611816 4:181849035-181849057 CTGTACATTTTAATGTCAAATGG - Intergenic
986922674 5:12706797-12706819 CTGTCCTTCATATTATCAAAAGG + Intergenic
986923014 5:12710916-12710938 CAGTTCTACTAACTATCAAAGGG - Intergenic
987074325 5:14366631-14366653 CTGTTATTTTTAGTAGCAAATGG - Intronic
989076240 5:37565491-37565513 CTCATCTTGTTAAGATCAAAAGG - Intronic
989098705 5:37805037-37805059 CTGTTCTTCATAACATCAACTGG + Intergenic
989275844 5:39587102-39587124 CTGCTCTTCTTGCTATGAAATGG - Intergenic
989739351 5:44751907-44751929 CTATTGTTCTGAAAATCAAATGG + Intergenic
990778637 5:59332889-59332911 CTGTTCCTCTTGATGGCAAATGG - Intronic
990849617 5:60188039-60188061 CTTTTTCTCTTAGTATCAAATGG + Intronic
993603569 5:89958858-89958880 CTATTCTTCTCCATATCAAAAGG + Intergenic
993711265 5:91227900-91227922 CTATTCTTCCTCATATAAAAGGG + Intergenic
993970043 5:94408205-94408227 CCTTTCTTCTCACTATCAAAAGG - Intronic
995150486 5:108839049-108839071 TTGTACTTCTTTGTATCAAAGGG - Intronic
995257671 5:110065682-110065704 TTCTTCTTGTTAAAATCAAAAGG + Intergenic
995351939 5:111187680-111187702 ATTTTATTCTTAACATCAAATGG - Intergenic
997684868 5:135781522-135781544 ATATTGTTCCTAATATCAAAAGG + Intergenic
997685383 5:135784996-135785018 ATATTTTTCTTAATATCATAAGG + Intergenic
997688224 5:135804639-135804661 ATATTATTCTTAATATCATAGGG + Intergenic
998125230 5:139615072-139615094 CAATTCTTCTTAATCTGAAATGG + Intronic
998713706 5:144856067-144856089 CTGTTCTTAAAAATAGCAAAAGG - Intergenic
999544191 5:152608790-152608812 CTGTTCCTCACAATAGCAAATGG + Intergenic
1000957051 5:167555685-167555707 TTATTCTTCTTAGTAGCAAATGG - Intronic
1002484806 5:179527558-179527580 CTGTTCTGGTTATTATAAAACGG - Intergenic
1004384506 6:15160870-15160892 CAGTTCTTTTTAATATCAATGGG + Intergenic
1004419609 6:15456846-15456868 CTGTTTTTCTTAAATTAAAATGG - Intronic
1004791917 6:19035916-19035938 CTTTTTTGCTTAATACCAAATGG - Intergenic
1004963405 6:20819502-20819524 CTGTTTTTCTGATGATCAAATGG + Intronic
1005270564 6:24159102-24159124 CTGAACTTGTTAATATCCAATGG + Intergenic
1005402922 6:25453454-25453476 ATGTTCCTCTATATATCAAAGGG - Intronic
1008331265 6:50247415-50247437 CTATACTTCTTAATATTATAAGG - Intergenic
1008646833 6:53522748-53522770 CTGTCCTACTTAATATCCTATGG + Intronic
1009226995 6:61029263-61029285 TTATTGTTCTTAATATCAAAAGG - Intergenic
1009227010 6:61029339-61029361 CTATTGTTCTTAATATCCAGTGG - Intergenic
1009227412 6:61031863-61031885 ATATTATTCTTAATATCACAGGG - Intergenic
1009310054 6:62139011-62139033 CTGTTCTTTTTATCATGAAATGG + Intronic
1010093799 6:72015598-72015620 CTGGTCTTGTTAATGTCACAGGG + Intronic
1010527114 6:76914946-76914968 CTGTTCTTCTATTTGTCAAATGG + Intergenic
1012316432 6:97786594-97786616 CTGATCTTTTTACTATCAACAGG + Intergenic
1012775411 6:103489359-103489381 ATATTCTTCTTAATACCTAAGGG + Intergenic
1012944902 6:105454993-105455015 CTCTTCTTCTTGGTATCAGAAGG + Intergenic
1014925166 6:127261812-127261834 ATGTTCTGCTTTATATCTAATGG + Intergenic
1016603757 6:145893600-145893622 TTGTTCTTCGTAATATCTAGAGG + Intronic
1018350892 6:162957724-162957746 CTGGGCTTCTTAATTTTAAAAGG - Intronic
1018468775 6:164078571-164078593 CTGGTCTTCTAAATCTCACAGGG - Intergenic
1019899506 7:4008995-4009017 CGGTTGTTCTGAATATAAAATGG - Intronic
1020307721 7:6847758-6847780 ATATTGTTCTTAATATCAAGGGG + Intergenic
1020336662 7:7067498-7067520 TTATTGTTCTTAATATCCAAGGG + Intergenic
1020336926 7:7069267-7069289 CTATTGTTCATAATATCCAAGGG + Intergenic
1020337421 7:7072713-7072735 ATATTCTTCCTAATATCCAAGGG + Intergenic
1020337678 7:7074805-7074827 CTATTCTTCATAATATCCAAGGG + Intergenic
1021607506 7:22423331-22423353 GTCTTATTCATAATATCAAAAGG + Intronic
1024477134 7:49824771-49824793 TTGTTATTCTTAATATTGAATGG + Intronic
1024867290 7:53918723-53918745 CTCTTGCTCTTAATAACAAATGG - Intergenic
1024913536 7:54472198-54472220 CTGTTCTCCATAGTATCAACTGG + Intergenic
1026573908 7:71555813-71555835 CTGCTGTCCTTAATATCTAAAGG + Intronic
1028662690 7:93298620-93298642 CTGTTTTACTTATTGTCAAAAGG + Intronic
1029078842 7:97956700-97956722 ATATTGTTCTTAATATCAAGGGG + Intergenic
1030406908 7:109126632-109126654 CTGTTCTTTTAAATGTGAAAGGG + Intergenic
1030408739 7:109147531-109147553 CTTTGCTTATTAATAGCAAAGGG + Intergenic
1030565250 7:111146190-111146212 CTGTTCTTGTCAATATAACATGG + Intronic
1030739731 7:113094236-113094258 ATGTTTTTCTTAATTTCATAAGG + Intergenic
1031063084 7:117073989-117074011 ATTTTTTTCTTAATTTCAAAAGG - Intronic
1031081183 7:117258443-117258465 CTGTTCTCAGTAATTTCAAAAGG + Intergenic
1032667994 7:134056299-134056321 ATGTTCTTTTGATTATCAAAAGG - Intronic
1036907061 8:12715913-12715935 ATATTGTTCTTAATATCAAGGGG + Intergenic
1036985785 8:13529127-13529149 ATGTTTTTCTTAAAATAAAATGG + Intergenic
1038637908 8:29302193-29302215 ATATTGTTCTTAATATCCAAGGG - Intergenic
1038732363 8:30138899-30138921 CTTTTCTTCTGAAGAACAAAAGG - Intronic
1040921774 8:52628775-52628797 CTGTTGTTCAAAACATCAAAAGG + Intronic
1041042104 8:53857476-53857498 TTTTTGTTCTTAATATCACATGG - Intronic
1041152197 8:54946472-54946494 CATTTTTTGTTAATATCAAAAGG - Intergenic
1041271273 8:56111588-56111610 CTGTTCTTCAGAAAAGCAAAAGG - Intergenic
1042569876 8:70151617-70151639 AGGATCTTCTTAGTATCAAAAGG + Intronic
1042631630 8:70822966-70822988 GTATTATTATTAATATCAAATGG - Intergenic
1042832397 8:73045939-73045961 CTGTTTTACTTTTTATCAAAAGG + Exonic
1043220607 8:77657768-77657790 ATGGTCTTTTTAAAATCAAATGG - Intergenic
1043552479 8:81390253-81390275 CTGTTCTTCCTTAAAACAAATGG - Intergenic
1043669994 8:82872289-82872311 CAGTTGTCCTTGATATCAAATGG + Intergenic
1044052176 8:87519305-87519327 GTGTCCTGCATAATATCAAATGG + Intronic
1044566339 8:93664741-93664763 ATATTCTGCATAATATCAAAGGG - Intergenic
1045101095 8:98844831-98844853 CTGTTCTTCTAAATATGCACTGG + Intronic
1045925652 8:107576997-107577019 ATATTCTTCCTAATATCAAGAGG + Intergenic
1045926384 8:107582045-107582067 CTGTTGTTCTTAATATCCAGAGG - Intergenic
1046545816 8:115648635-115648657 TTTTTCTTCTTAAAAACAAAAGG + Intronic
1047650468 8:126914683-126914705 CTGTGCTTCTTACAAGCAAAAGG + Intergenic
1048091852 8:131249980-131250002 CTGTTCCTCTGAATATCATCTGG + Intergenic
1048447724 8:134504536-134504558 TTGTTCTGCTAAATATCAAGGGG + Intronic
1050769448 9:9178383-9178405 CTTTCCTTCTTTCTATCAAAGGG + Intronic
1051232111 9:14965039-14965061 CTATTGTTCCTAATATCCAAGGG - Intergenic
1052612409 9:30792240-30792262 CATTTCTTATTAATATAAAAGGG + Intergenic
1053210809 9:36226062-36226084 CTTTTCTTCTTGATTTCAATGGG + Intronic
1055361702 9:75497842-75497864 ATGATCTTTTTAATACCAAAGGG + Intergenic
1055688682 9:78806770-78806792 TTGTTACTCTTAATTTCAAAGGG + Intergenic
1056051712 9:82776204-82776226 ATTTTCTTTTTCATATCAAAAGG + Intergenic
1056865159 9:90222301-90222323 ATATTGTTCTTAATATCAAGGGG - Intergenic
1056865203 9:90222569-90222591 ATATTCTTCTTAATAGCACAGGG - Intergenic
1056917818 9:90760320-90760342 ATATTCTTCTTAATAGCACAGGG + Intergenic
1056917863 9:90760588-90760610 ATATTGTTCTTAATATCAAGGGG + Intergenic
1057988615 9:99744007-99744029 CTGTTCTTCTTCCTTTCTAAAGG - Intergenic
1058338643 9:103865267-103865289 GTTTTCTTGTTATTATCAAAGGG - Intergenic
1058518395 9:105797374-105797396 ATGTTCTTCTTAATATCCATGGG - Intergenic
1061535538 9:131246607-131246629 ATTTTCTTTTTAATATCCAAGGG - Intergenic
1062325659 9:136011264-136011286 CTGACCTTGTGAATATCAAAAGG + Exonic
1203756758 Un_GL000218v1:137402-137424 GTGTTCTGTTTAATCTCAAAGGG + Intergenic
1203716128 Un_KI270742v1:150052-150074 TTGTTCTGTTTAATCTCAAAGGG + Intergenic
1203535087 Un_KI270743v1:28184-28206 TTGTTCTGTTTAATCTCAAAGGG - Intergenic
1203650366 Un_KI270751v1:113622-113644 GTGTTCTGTTTAATCTCAAAGGG + Intergenic
1186058280 X:5674763-5674785 CTGTTTTTCTTAATGATAAATGG + Intergenic
1187799386 X:23043600-23043622 CTGCTCTCTTTTATATCAAATGG - Intergenic
1188484531 X:30668699-30668721 ATGTTATTCTTAGTATCATAGGG + Intronic
1188858832 X:35231622-35231644 CTTTTCTTCTTATGTTCAAAGGG - Intergenic
1189937417 X:46084096-46084118 CTGTTCATATTATTCTCAAAAGG - Intergenic
1192080799 X:68046091-68046113 ATGTTCTGCTAAATTTCAAATGG - Exonic
1192119687 X:68443491-68443513 CTGTTCTTCTTAAGCTAAACAGG - Intergenic
1192134547 X:68584801-68584823 CTGTTTTTCCTAATATAGAAAGG + Intergenic
1194039713 X:88925153-88925175 CTGCTCTTCTCCACATCAAAGGG - Intergenic
1196267922 X:113674600-113674622 TTCTTCTGCTTAATACCAAAAGG + Intergenic
1196271091 X:113711752-113711774 CTTTCCTTCTTATTATCCAAAGG - Intergenic
1198244135 X:134813036-134813058 CTTATTTTCTTAATACCAAAGGG + Intronic
1199116048 X:143993931-143993953 ATGTTCTTTTTAATATTTAAAGG - Intergenic
1199219716 X:145304036-145304058 CTGTTCTTCTTAATTTTTATTGG + Intergenic
1200375872 X:155779533-155779555 TCTTTCTTCTTAATATAAAAAGG + Exonic
1201399717 Y:13592258-13592280 CTGATTTACTTAATATCAAGGGG - Intergenic
1201767286 Y:17583678-17583700 CTGCTCTCCTAAATATTAAAGGG + Intergenic
1201834267 Y:18322307-18322329 CTGCTCTCCTAAATATTAAAGGG - Intergenic