ID: 903920957

View in Genome Browser
Species Human (GRCh38)
Location 1:26800333-26800355
Sequence CACCTAGCTGTGGCATTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 352}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903920957 Original CRISPR CACCTAGCTGTGGCATTGTT AGG (reversed) Intergenic
900774599 1:4572877-4572899 CACCTAGCAGTGGAATTTCTGGG + Intergenic
901377813 1:8852223-8852245 CACCTGGGTGTGGAATTGCTGGG - Intergenic
902524656 1:17048499-17048521 CACCCAGGTGTGTAATTGTTGGG + Intronic
902559714 1:17269944-17269966 TACCTAGCAGTGGAATTGCTGGG + Intronic
903087372 1:20874201-20874223 CACCTAGTAATGGGATTGTTGGG + Intronic
903920957 1:26800333-26800355 CACCTAGCTGTGGCATTGTTAGG - Intergenic
904681976 1:32235491-32235513 CAGCTAGTTTTTGCATTGTTAGG + Intergenic
904865980 1:33579328-33579350 CTACTAGCTGTGGGATTATTAGG - Intronic
905670176 1:39786292-39786314 CTCCCAGCTGTGGCCTAGTTCGG - Intronic
906857285 1:49321556-49321578 TACCTAGAAGTGGGATTGTTGGG - Intronic
907199340 1:52712852-52712874 CACCTAGGAGTGGAATTGCTGGG - Intergenic
907533058 1:55121353-55121375 CAACTACCTGTGACATTGTCGGG - Intronic
908012239 1:59790458-59790480 CACCTAGGAGTAGCATTGTTGGG + Intergenic
909515972 1:76507788-76507810 TACCTAGAAGTGGAATTGTTAGG + Intronic
910596578 1:88987007-88987029 TACCTAGCAGTGGAATGGTTGGG - Intronic
912655614 1:111484000-111484022 CTCCTAGCTTTGACATTCTTGGG - Intronic
912760519 1:112362266-112362288 TACCTAGGAGTGGAATTGTTGGG - Intergenic
912902220 1:113663712-113663734 TACCTAGGAGTGGAATTGTTGGG + Intronic
913698472 1:121351224-121351246 CACCTAGATGTGGAATTGATGGG - Intronic
914139076 1:144928819-144928841 CACCTAGATGTGGAATTGATGGG + Intronic
914254687 1:145952113-145952135 CACATAGCTATGGCAGAGTTGGG + Intronic
914924076 1:151868760-151868782 TACCTAGCAGTGGAATTGCTGGG + Intergenic
916514657 1:165504684-165504706 TACCTAGGAGTGGAATTGTTGGG - Intergenic
916840296 1:168593690-168593712 TACCTAGCAGTGGAATTGCTGGG + Intergenic
917604386 1:176611678-176611700 CTCCTATCTGTAGCATTCTTGGG + Intronic
918282050 1:183016486-183016508 TACCTAGGAGTGGAATTGTTGGG - Intergenic
918329057 1:183438942-183438964 TACCTAGGAGTGGTATTGTTGGG - Intergenic
918436845 1:184523243-184523265 CACCTGGCTGAGGTATTGTCAGG - Intronic
919303518 1:195800604-195800626 TACCTAGGAGTGGAATTGTTGGG - Intergenic
920485876 1:206369880-206369902 CACCTAGATGTGGAATTGATGGG - Intronic
922877663 1:228952867-228952889 AACCCAGCTGTGGGATTGCTGGG + Intergenic
923617251 1:235548187-235548209 CACCTAGGGGTGGAATTGTTAGG + Exonic
923732833 1:236569760-236569782 TACCTAGGAGTGGAATTGTTGGG - Intronic
924726562 1:246676704-246676726 AATCTAGCTGTGGAATTGCTGGG - Intergenic
1063869202 10:10400097-10400119 CACCCAGCAGTGGGATTGCTGGG + Intergenic
1064178376 10:13095160-13095182 CACCTAGAAGTGGAATTGCTGGG + Intronic
1064466996 10:15593732-15593754 CACCTACCTGTAGGACTGTTTGG - Intronic
1066514146 10:36137139-36137161 CACCCAGCAGTGGGATTGCTGGG + Intergenic
1066529340 10:36319321-36319343 CATCTAGGTGTGGGATTGCTGGG + Intergenic
1067264216 10:44723143-44723165 CCCCTATCTGTGGCCTTGTGAGG + Intergenic
1067698038 10:48549467-48549489 CACCTTCCTGGGGCATTGCTGGG + Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1068735100 10:60405155-60405177 CATCTAGATGTGGAATTGCTAGG - Intronic
1070755714 10:78992217-78992239 CACCTTGCTGTAGCATTTTTAGG - Intergenic
1071529130 10:86376081-86376103 TACCTAGCAGTGGAATTGCTGGG + Intergenic
1071981240 10:91006010-91006032 CAGCCAGCTGTGGAAGTGTTTGG + Intergenic
1072375246 10:94808945-94808967 TACCTAGCAGTGGGATTGCTGGG + Intronic
1072678355 10:97485954-97485976 TACCTAGTAGTGGGATTGTTGGG - Intronic
1073231868 10:101978470-101978492 CACCTAGTAGTGGAATTGCTGGG - Intronic
1075688780 10:124381508-124381530 CACCCATCTGTGGCATTGCTGGG - Intergenic
1076164665 10:128272083-128272105 TACCTAGCAGTGGAATTGCTAGG - Intergenic
1077371573 11:2184515-2184537 GACCTAGAGGTGGCATTGTTGGG + Intergenic
1077577932 11:3398498-3398520 CACCTCGCTGTGACCTTGTGAGG - Intergenic
1078725639 11:13928350-13928372 CACCTAGGAGTGGAATTGCTGGG + Intergenic
1078766201 11:14300888-14300910 CACCACTCTGTGGCAGTGTTTGG - Intronic
1078811339 11:14768875-14768897 TACCTAGCTGTGGAATTCCTGGG + Intronic
1079666809 11:23116411-23116433 CACCTAGCTGTGATAATGCTAGG + Intergenic
1079982761 11:27168724-27168746 TACCTAGAAGTGGGATTGTTGGG + Intergenic
1080856838 11:36119325-36119347 TACCTAGAAGTGGAATTGTTGGG + Intronic
1080861826 11:36156640-36156662 CACCCTGATGTGGCATTATTTGG + Intronic
1081005696 11:37734971-37734993 TATCTAGATGTGGAATTGTTAGG + Intergenic
1081539392 11:44019290-44019312 TACCTAGCAGTGGAATTGTTGGG + Intergenic
1083114796 11:60450398-60450420 TAACTAGCAGTGGAATTGTTGGG - Intronic
1083492005 11:63020386-63020408 AACCTACCTATGGGATTGTTGGG + Intergenic
1084231877 11:67759399-67759421 CACCTCGCTGTGACCTTGTGAGG - Intergenic
1085229704 11:74955206-74955228 CACCTAGGAGTGGAATTGTTGGG - Intronic
1086416086 11:86590173-86590195 CACGCTGCTGTGGGATTGTTGGG - Intronic
1087191585 11:95259686-95259708 CACCCACCTGGGGCCTTGTTTGG - Intergenic
1090777763 11:129980174-129980196 TACCTAGCAGTGGAATTGCTTGG - Intronic
1091724482 12:2836135-2836157 CACCTAGGAGTGGAATTGCTGGG + Intronic
1092102590 12:5898372-5898394 CACCTAGGAGTGGAATTGCTGGG - Intronic
1092814747 12:12303023-12303045 CACCTAGGAGTGGAATTGTTGGG - Intergenic
1093311734 12:17596322-17596344 CACCTAGCAGTGCAATTGTTGGG + Intergenic
1095256579 12:40043971-40043993 CACCTATCTGTGGAATTGCTAGG - Intronic
1095527154 12:43140806-43140828 AACCTAGCAGTAGAATTGTTGGG - Intergenic
1096132348 12:49169746-49169768 CACCTAGAAGTGGAATTGCTGGG - Intergenic
1096753388 12:53778183-53778205 TACCTAGCAGTGGGATTGCTGGG + Intergenic
1097769235 12:63561792-63561814 CACCTAGGAGTGGAATTGCTGGG + Intronic
1097778551 12:63676134-63676156 CACCTAGGAGTGGAATTGCTGGG + Intergenic
1100621337 12:96277273-96277295 CACCTAGGAGTGGAATTGCTGGG - Intergenic
1100994262 12:100285437-100285459 TACCTAGGTGTGGGATTGCTAGG + Intronic
1101332315 12:103767058-103767080 TACCTAGGGGTGGCATTTTTGGG - Intergenic
1101887917 12:108684403-108684425 CACCTAGAAGTGGCATTGCTGGG - Intronic
1102235531 12:111292071-111292093 CACCTAGCCGTGGCGCTGCTGGG - Intronic
1102462110 12:113106257-113106279 AACCTGGCTGTGGCATGGTGGGG - Intronic
1104186298 12:126435269-126435291 CACCTAGGAGTGGAATTGCTGGG + Intergenic
1104700419 12:130898987-130899009 CCCCTAGAAGTGGAATTGTTGGG + Intergenic
1105468550 13:20670375-20670397 CTCCACACTGTGGCATTGTTAGG - Intronic
1107107683 13:36663993-36664015 CACCTGGCTGAGGTAGTGTTTGG - Intergenic
1107775951 13:43841249-43841271 CACCTAGGTGGAGAATTGTTTGG + Intronic
1108178664 13:47819863-47819885 CACATGGCTGTGGCAGTGCTGGG - Intergenic
1108836567 13:54557401-54557423 GACCCAGCAATGGCATTGTTGGG - Intergenic
1110144834 13:72178111-72178133 CTCCTAGGTGTGACATTCTTTGG - Intergenic
1110311898 13:74059295-74059317 CACCCAGCAGTGGGATTGCTGGG + Intronic
1110392861 13:74995309-74995331 CCCCTACATATGGCATTGTTTGG + Intergenic
1110877305 13:80526062-80526084 ACCCTAGCTGGGCCATTGTTGGG + Intergenic
1111564440 13:89996269-89996291 AAGCTAGCTGTTTCATTGTTTGG + Intergenic
1111764121 13:92505589-92505611 CACCAAGCAGTGGGATTGCTGGG - Intronic
1112604425 13:100890213-100890235 CACCCAGATGTGGCCTTGTATGG - Intergenic
1112983225 13:105412942-105412964 TACCTAGCTGCGGAATTGCTGGG + Intergenic
1113210893 13:107979244-107979266 CACCCAGCAGTGGAATTGCTGGG + Intergenic
1113452088 13:110417913-110417935 TACCTAGGAGTGGGATTGTTGGG + Intronic
1114180362 14:20361762-20361784 CACCTAGTAGTGGAATTGCTAGG - Intergenic
1115053585 14:29094832-29094854 TACCTAGCAGTGGGATTGCTAGG + Intergenic
1116308561 14:43291025-43291047 CATCTAGATGGGGGATTGTTGGG - Intergenic
1116359826 14:43979650-43979672 CACCCAGCAGTGGAATTGCTGGG + Intergenic
1116549694 14:46220954-46220976 CACCTAGTAATGGGATTGTTGGG + Intergenic
1116725356 14:48555892-48555914 TACCTAGGTGTGGAATTGCTGGG - Intergenic
1116741477 14:48760746-48760768 TACCCAGCAGTGACATTGTTGGG + Intergenic
1117155905 14:52940964-52940986 TACCTAGGTGTGGGATTGCTGGG - Intronic
1117397412 14:55324437-55324459 TACCTAGCAGTGGAATTGCTGGG + Intronic
1119634439 14:76262572-76262594 TACCTAGGAGTGGAATTGTTGGG + Intergenic
1120663384 14:87277345-87277367 CACCGAGCAGTGGGATTGTTGGG + Intergenic
1121032365 14:90669908-90669930 CACCTAGGAGTGGAATTGCTTGG - Intronic
1121581728 14:95037042-95037064 CAACTATCAGTGGCATTGTAGGG - Intergenic
1123711940 15:22994717-22994739 CACCTAGGAGTGGGATTGCTGGG + Intronic
1125138789 15:36377956-36377978 AACCTAGCAGTGGGATTGCTGGG + Intergenic
1125380140 15:39078680-39078702 TACCTAGGAGTGGAATTGTTAGG - Intergenic
1126046602 15:44647393-44647415 TACCTAGCTGTGGAATTACTGGG - Intronic
1126409968 15:48363124-48363146 CACCTAGAGGTGGAATTGCTGGG + Intergenic
1129075411 15:72991406-72991428 TACCTAGTTGTGGAATTGCTGGG - Intergenic
1130874483 15:88000862-88000884 CACCTAGAAGTGGAATTGGTAGG + Intronic
1131464186 15:92642290-92642312 CACCTAGGAGTGGAATTGCTGGG - Intronic
1131982893 15:98012646-98012668 TACCTAGTTGTGGGATTGCTGGG - Intergenic
1132158587 15:99515189-99515211 CACCTAGGAGTGGAATTGCTGGG + Intergenic
1133398842 16:5470011-5470033 TACCTAGGAGTGGAATTGTTGGG + Intergenic
1133429681 16:5725764-5725786 CAGCTAGCAGTGCCATTCTTGGG - Intergenic
1134421007 16:14089640-14089662 CACCTAGGAGTGGAATTGCTGGG + Intronic
1134692569 16:16200604-16200626 CACCTAGCTCTGGCATGCTCAGG + Intronic
1135223379 16:20634322-20634344 GACCTAGATGTGGAATTGCTGGG - Intronic
1135424723 16:22326602-22326624 CTACTAGCTTTGCCATTGTTTGG + Intronic
1137325335 16:47429448-47429470 TACCTAGGAGTGGAATTGTTGGG + Intronic
1137727749 16:50668589-50668611 GAACAGGCTGTGGCATTGTTGGG + Intronic
1138086395 16:54137636-54137658 CACCTAGAAGTGGAATTGCTGGG + Intergenic
1139685547 16:68600545-68600567 TACCTAGGTGTGGAATTGCTGGG - Intergenic
1139717411 16:68824526-68824548 CAGCTAGATGTGGCTGTGTTTGG - Intronic
1139742814 16:69050090-69050112 TACCTAGAAGTGGAATTGTTGGG + Intronic
1141188720 16:81808151-81808173 CACCTAGGAGTGGAATTGCTGGG + Intronic
1143325575 17:6096143-6096165 CACCTAGCTGTAGGGTTGTTAGG - Intronic
1143752692 17:9041686-9041708 TACCTAGCAGTGGAATTGTTGGG + Intronic
1144725823 17:17502032-17502054 TACCTAGGTGTGGAATTGTTAGG - Intergenic
1144730681 17:17524294-17524316 CACCTAGGAGTGGAATTGCTGGG + Intronic
1144750532 17:17645191-17645213 CACCTAGGAGTGGGATTGCTGGG - Intergenic
1146381671 17:32334266-32334288 TACCTAGGTGTGGAATTGCTAGG + Intronic
1146995131 17:37313833-37313855 TACCTAGCTATGGGATTGCTGGG - Intronic
1148272758 17:46276726-46276748 CAACTTGCTGTTGCATTTTTAGG - Intronic
1148992411 17:51677859-51677881 TACCTAGGAGTGGCATTGTTGGG - Intronic
1149035542 17:52130283-52130305 CACCTAGAAGTGGGATTGCTGGG - Intronic
1149249117 17:54747714-54747736 TACCTAGCAGTGGGATTGCTGGG + Intergenic
1149299384 17:55290229-55290251 CACCCAGCAGTGGCACTGCTGGG - Intronic
1152186923 17:78863065-78863087 CACCCAGCAGTGGGATTGCTGGG + Intronic
1152693139 17:81730422-81730444 CACCTAGGAGTGGCATTGCTGGG - Intergenic
1154141794 18:11830604-11830626 CACCTAGGAGTGGAATTGCTGGG - Intronic
1154353346 18:13605540-13605562 CAGCTAGCTTTGCCATTCTTGGG + Intronic
1155136242 18:22995901-22995923 TACCTAGGAGTGGAATTGTTGGG + Intronic
1155282828 18:24258097-24258119 TACCTAGCAGTGGGATTGCTGGG - Intronic
1155534370 18:26801638-26801660 TACCTAGCAGTGGGATTGCTGGG - Intergenic
1155608432 18:27634961-27634983 CACCCAGTAGTGGGATTGTTGGG - Intergenic
1156275466 18:35579962-35579984 CGCCTAGGAGTGGAATTGTTGGG + Intergenic
1156481614 18:37439995-37440017 CACCTTGCTGTGGCCTTGAGTGG - Intronic
1158091857 18:53724176-53724198 CAACTAACAGTTGCATTGTTGGG - Intergenic
1159123468 18:64196531-64196553 CACCTACCTCTGGGAATGTTTGG + Intergenic
1160214338 18:76914425-76914447 TACCTAGGAGTGGAATTGTTTGG + Intronic
1160280177 18:77482433-77482455 CACCAAGCTCAGGCATTCTTCGG - Intergenic
1162119530 19:8454583-8454605 TACCTAGCAGTGGAATTGCTGGG + Intronic
1162948292 19:14056614-14056636 CACCCAGCTGGGGCAGGGTTCGG + Intronic
1163789227 19:19296698-19296720 TACCTAGGTGTGGAATTGCTGGG - Intronic
1164450524 19:28359010-28359032 CACCTAAGAGTGGAATTGTTCGG - Intergenic
1164665043 19:30024298-30024320 TACCTAGGAGTGGAATTGTTGGG + Intergenic
1164951683 19:32342694-32342716 CACCCAGTAGTGGGATTGTTGGG - Intergenic
1166982838 19:46641437-46641459 CACCTAGGAGTGGAATTGCTGGG - Intergenic
1167569766 19:50279850-50279872 CACCTAGGAGCGGGATTGTTGGG + Intronic
1168388028 19:55982272-55982294 TACCTAGCAGTGGGATTGCTAGG - Intronic
925022036 2:578490-578512 CACATAGCAGTGGAATTGGTGGG - Intergenic
925659392 2:6186309-6186331 CAGAAAGATGTGGCATTGTTTGG + Intergenic
925782649 2:7396607-7396629 TACCTAGCAATGGGATTGTTGGG + Intergenic
927240311 2:20915125-20915147 CCCCCAGCTGTGGGATTGCTGGG + Intergenic
928555862 2:32424470-32424492 TACCTAGGAGTGGAATTGTTGGG + Intronic
929369459 2:41204705-41204727 CTCCTTGATGTGGCATCGTTTGG - Intergenic
929972572 2:46595612-46595634 CACCTAGGAGTGGAATTGTTAGG + Intronic
930732212 2:54738874-54738896 CACCTAGGAGTGGTATTGTTAGG + Intronic
930923050 2:56781295-56781317 TACCTAGGAGTGGGATTGTTGGG - Intergenic
931764977 2:65447000-65447022 CATCTAGCAGTGGGATTGCTGGG + Intergenic
932364857 2:71143945-71143967 CACCTAGGAGTGGCATTGCTGGG + Intronic
933215201 2:79621753-79621775 CACCTGGCTGAGGTAGTGTTAGG - Intronic
935186050 2:100733898-100733920 CTGCCAGCTGTGGCATTGTGTGG + Intergenic
935241439 2:101181763-101181785 TACCTAGGGGTGGAATTGTTAGG + Intronic
936257302 2:110927801-110927823 CACCTGGCTGTGGGATTGCTTGG + Intronic
937137864 2:119570892-119570914 TACCTAGAAGTGGAATTGTTAGG + Intronic
938907161 2:135848508-135848530 TACCTAGGAGTGGAATTGTTGGG - Intronic
939178439 2:138779225-138779247 CACTTAGCTCTTGCCTTGTTAGG - Intronic
939883145 2:147652421-147652443 CACCTAGCTGCTCCATTCTTGGG + Intergenic
940559369 2:155275055-155275077 TACCTAGCAGTGGGATTGTTGGG + Intergenic
941077332 2:161020642-161020664 CAGTTAGCTGTGGCATTGATTGG - Intergenic
942009139 2:171741294-171741316 TACCTAGGAGTGGGATTGTTGGG + Intronic
942773128 2:179546739-179546761 CACCTAGCAGTGGGATTGTTGGG + Intronic
943637565 2:190322958-190322980 TACCTAGGTATGGAATTGTTGGG - Intronic
943667482 2:190625084-190625106 TACCTAGCACTGGCATTGCTGGG - Intergenic
944619497 2:201499433-201499455 CATCTATCTCTGGAATTGTTAGG + Intronic
944766332 2:202868450-202868472 TACCTAGCGGTGGAATTGCTAGG - Intronic
945925761 2:215802342-215802364 AAGCTAGCTGTGACATTGATAGG - Intergenic
947134091 2:226959763-226959785 TACCTAGGAGTGGAATTGTTGGG + Intronic
947354579 2:229278917-229278939 CACCTAGAAGTGGAATTGCTGGG - Intergenic
948775156 2:240283652-240283674 TACCTAGCGGTGGGATTGCTGGG - Intergenic
1169718603 20:8647429-8647451 CATCTAGCTTTGGGATTGCTGGG + Intronic
1170196580 20:13695025-13695047 CATCTAGGAGTGGCATCGTTGGG + Intergenic
1172249069 20:33466104-33466126 CACCTAGAAGTGGAATTGCTGGG - Intergenic
1172585216 20:36078529-36078551 CGCCTAGCAGTGGAATTGCTGGG - Intergenic
1173642275 20:44612128-44612150 TACCTAGTAGTGGGATTGTTGGG + Intronic
1175187405 20:57188078-57188100 CGCCTAGGAGTGGAATTGTTGGG - Intronic
1175207184 20:57320146-57320168 CACCTAGGCGTGGAATTGCTGGG - Intergenic
1176518313 21:7803869-7803891 TACCTAGGAGTGGAATTGTTGGG - Intergenic
1178642658 21:34357959-34357981 TACCTAGAAGGGGCATTGTTGGG + Intergenic
1178652341 21:34433882-34433904 TACCTAGGAGTGGAATTGTTGGG - Intergenic
1183443478 22:37837286-37837308 AACCTAGGAATGGCATTGTTGGG - Intronic
1184125540 22:42484068-42484090 CTCCTGGTGGTGGCATTGTTGGG + Intergenic
1184134024 22:42535566-42535588 CTCCTGGTGGTGGCATTGTTGGG + Intergenic
1184661878 22:45969206-45969228 CACCTGGCTGTGGCAGGGTGGGG - Intronic
1185044134 22:48520535-48520557 CACCCAGCAGTGCCTTTGTTGGG + Intronic
1185375357 22:50480563-50480585 CACCTAGGTGTGGCTATGTGAGG - Intergenic
950217277 3:11168582-11168604 CAACCAACTGTGGCATTGTGCGG - Intronic
950564096 3:13754968-13754990 CACCTAGGAGTGGAATTGCTGGG + Intergenic
950770326 3:15306008-15306030 CCCCTAGGTGTGGCTTTGTCAGG - Intronic
950886450 3:16366789-16366811 CACCTAGCGGTTGCTTTGTGTGG - Intronic
950907097 3:16548952-16548974 CACCTAGGAGTGGAATTGCTGGG - Intergenic
951487064 3:23224855-23224877 TACCTAGCAGTGGAATTGCTGGG + Intronic
953918376 3:46935240-46935262 CACCTCCCTGTGGCTTTGTATGG - Intronic
954486677 3:50859651-50859673 CACCAAGCTGAGGCTTTGTGTGG + Intronic
955397053 3:58565031-58565053 CAGCTATCTGTGGCAGTTTTGGG + Intronic
957048511 3:75394702-75394724 CACCTCGCTGTGACCTTGTGAGG - Intergenic
958760595 3:98303014-98303036 TACCTAGCAGTGGGATTGCTGGG - Intergenic
960169165 3:114438158-114438180 TAGCTAGCAGTGGCATTGGTGGG + Intronic
960668732 3:120136242-120136264 TACCTAGCAGTGGGATTGCTGGG - Intergenic
961265763 3:125641181-125641203 CACCTAGGAGTGGAATTGCTGGG - Intergenic
961672071 3:128540693-128540715 CACCTAGGAGTGGAATTGCTGGG + Intergenic
961833284 3:129636051-129636073 TACCTAGGAGTGGCATTGCTGGG - Intergenic
963701216 3:148629342-148629364 TACCTAGAAGTGGGATTGTTGGG - Intergenic
964781599 3:160345070-160345092 TACCTAGCAGTGGGATTGCTTGG - Intronic
965480890 3:169218424-169218446 ACCCAAGCTGTGGCATTATTGGG - Intronic
965509415 3:169551685-169551707 GACCTAGCTGTGAAATTGTTGGG - Intronic
965769861 3:172170389-172170411 CACCTTGCTGTGACAGTGGTTGG + Intronic
966142772 3:176774651-176774673 TACCTAGCAGTGGGATTGCTGGG - Intergenic
967309693 3:188094336-188094358 CACCTAGGAGTGGAATTGCTGGG + Intergenic
967676967 3:192311658-192311680 CATCTAGCCGTGGAACTGTTGGG + Intronic
969165818 4:5310669-5310691 TACCTAGTAGTGGGATTGTTGGG - Intronic
969178517 4:5419221-5419243 GACCTATCTGTTGTATTGTTTGG + Intronic
969822491 4:9731203-9731225 CACCTCGCTGTGACCTTGTGAGG + Intergenic
970109602 4:12623010-12623032 CACCCAGCAATGGGATTGTTGGG - Intergenic
970305875 4:14732221-14732243 TACCTAGGAGTGGGATTGTTGGG + Intergenic
971812817 4:31449250-31449272 CACTTAGTAGTGGAATTGTTGGG + Intergenic
972081556 4:35157945-35157967 TACCAAGCAGTGGTATTGTTAGG - Intergenic
973215232 4:47660806-47660828 TACCTAGCAGTGGGATTGCTGGG - Intronic
974198319 4:58605539-58605561 CACCTAGTAATGGCATTGCTGGG + Intergenic
974867513 4:67598291-67598313 TACCTAGCAGTGGGATTGCTGGG + Intronic
975083941 4:70314221-70314243 TACCTATCTGTTGCATTTTTAGG - Intergenic
975336052 4:73176429-73176451 CACCTAGGAGTGGGATTGCTGGG - Intronic
975375583 4:73640390-73640412 TACCTAGCTGTGGGATTGCTGGG + Intergenic
975598801 4:76077714-76077736 CACCTAGTAGTGGAATTGCTGGG + Intronic
976205857 4:82622798-82622820 CACCTAGTTGTGACAATATTTGG - Intergenic
976273118 4:83249930-83249952 CACTCAGCTGCTGCATTGTTTGG - Intergenic
976520419 4:86020445-86020467 CACCTAGAAGTGGAATTGCTGGG + Intronic
976768376 4:88622496-88622518 TACCTAGAAGTGGAATTGTTGGG + Intronic
976775377 4:88700303-88700325 CACCTAGCAGTGGGATTGCTGGG + Intronic
976909497 4:90283840-90283862 CACCCAGCAGTGGGATTGCTGGG + Intronic
977577218 4:98688025-98688047 TACCTAACAGTGGAATTGTTGGG + Intergenic
977975675 4:103263360-103263382 TACCTAGAAGTGGGATTGTTGGG + Intergenic
978465292 4:109002190-109002212 TACCCAGCTGTGGGATTGCTAGG - Intronic
981610913 4:146592740-146592762 CACCCAGGAGTGGAATTGTTGGG - Intergenic
981796648 4:148603458-148603480 TACCTAGTTGTGATATTGTTGGG - Intergenic
982797924 4:159667767-159667789 GTCCTAGCAGTGGGATTGTTGGG + Intergenic
983256574 4:165407102-165407124 AACCTAGCAGTGGAATTGCTGGG + Intronic
983698387 4:170561039-170561061 CAAATGGCTGTGGGATTGTTTGG + Intergenic
983715645 4:170778019-170778041 CACCTAGCAATGGGATTGCTGGG - Intergenic
984815904 4:183835877-183835899 CACCTAGGAGTGGAATTGCTGGG + Intergenic
986270810 5:6229041-6229063 GACCTGGCTGTGGGACTGTTGGG + Intergenic
986613401 5:9592204-9592226 AACCTAGCTGTTGGATTGATAGG + Intergenic
986771996 5:10982628-10982650 CACCCAGCAGTGGGATTGCTAGG - Intronic
986945544 5:13014583-13014605 CACCTAGGAGTTGAATTGTTGGG - Intergenic
988838159 5:35054288-35054310 CACCTAGAGGTGGAATTGTTGGG - Intronic
990209534 5:53467722-53467744 CACCTGGGTGTGGAATTGCTGGG - Intergenic
990973436 5:61535256-61535278 CATCTAGCTGTGGGACAGTTAGG + Intronic
992075361 5:73187802-73187824 CACCAAGCTGTGCCGTGGTTAGG - Intergenic
992101622 5:73413374-73413396 CTCCTTGCTGTGCCTTTGTTGGG - Intergenic
992182238 5:74209843-74209865 GACCTAGCAGTGGAATTGCTGGG - Intergenic
994001000 5:94778959-94778981 CAACACGCAGTGGCATTGTTAGG + Intronic
994105775 5:95946664-95946686 AACATAGCTGAGCCATTGTTGGG - Intronic
994309718 5:98254733-98254755 TACCCAGCAATGGCATTGTTGGG + Intergenic
994392119 5:99201465-99201487 CACCTTCCTGTGATATTGTTCGG - Intergenic
995577310 5:113552672-113552694 CACCTAGGAGTGGAATTGCTGGG + Intronic
995758245 5:115535723-115535745 TACCTAGGAGTGGCATTATTGGG - Intronic
996033162 5:118729448-118729470 TACCTAGGTGTGGAATTGCTGGG - Intergenic
996271414 5:121608956-121608978 CACCTAGGAGTGGAATTGTTGGG - Intergenic
996631649 5:125639925-125639947 GACCTAGCTTTGGAATTGATGGG + Intergenic
996759008 5:126968249-126968271 CACCTAGGAGTGGAATTGCTAGG + Intronic
997055352 5:130436850-130436872 CACCCAGCAGTGGGATTGCTGGG + Intergenic
997168494 5:131688641-131688663 CATCTCGCTGTTGCATTATTTGG - Intronic
997764515 5:136486706-136486728 CAGCAAGCTGTGGGATAGTTAGG + Intergenic
998546652 5:143034226-143034248 CACCTAGGAGTGGCATCGCTGGG - Intronic
998594350 5:143512961-143512983 TACCTAGCTGTGGAATTGCTGGG + Intergenic
1000018459 5:157299077-157299099 GACCTAGGAGTGGAATTGTTGGG + Intronic
1002095350 5:176827662-176827684 CACCTAGGAGTGGAATTGCTGGG + Intronic
1002314766 5:178336215-178336237 TACCTAGCAGTGGAATTGCTGGG - Intronic
1002545172 5:179937678-179937700 TACCTAGCAGTGGAATTGCTGGG - Intronic
1003215073 6:4101807-4101829 CACCTAGTAGTGGGATTGCTGGG - Intronic
1003594917 6:7465898-7465920 TACCTAGGAGTGGAATTGTTGGG - Intergenic
1003808254 6:9751286-9751308 CACCTAGGAGTGGGATTGCTGGG - Intronic
1004998480 6:21216886-21216908 TACCTAGGAGTGGCATTGCTGGG + Intronic
1006983065 6:38161237-38161259 TGCCTAGCAGTGGCATTGCTGGG - Intergenic
1008614386 6:53212076-53212098 TACCTAGCAGTGGGATTGCTGGG + Intergenic
1008881673 6:56386450-56386472 TACCTAGGAGTGGAATTGTTGGG + Intronic
1009044747 6:58225110-58225132 TACCTAGGAGTGGAATTGTTTGG - Intergenic
1009220562 6:60979424-60979446 TACCTAGGAGTGGAATTGTTTGG - Intergenic
1009696919 6:67117862-67117884 CACCCAGTTATGGGATTGTTGGG - Intergenic
1009948937 6:70372740-70372762 TACCTAGGAGTGGCATTGCTGGG + Intergenic
1010638181 6:78285794-78285816 TACCCAGCAGTGGCATTGTGGGG + Intergenic
1013289514 6:108708354-108708376 CCCCTAGCTGAGGCTTTGTGTGG - Intergenic
1015438333 6:133216985-133217007 TACCTAGGTGTGGCACTGCTGGG + Intergenic
1015996120 6:138996943-138996965 TACCTAGGAGTGGGATTGTTTGG + Intergenic
1017189731 6:151639872-151639894 TACCTAGGAGTGGAATTGTTAGG + Intergenic
1017605512 6:156128371-156128393 CACCCAGCTGCGGCACTGCTGGG - Intergenic
1017669793 6:156759126-156759148 CACCTAGGAGTGGAATTGCTAGG + Intergenic
1018767048 6:166942585-166942607 CAGCTAGATGTGGTATTGTGCGG - Intronic
1020269699 7:6587014-6587036 CACCTAGAAGTGGCACTGCTGGG + Intronic
1020445713 7:8265115-8265137 GACCTAGGAGTGGAATTGTTGGG - Intergenic
1021527340 7:21603416-21603438 CACCTAGGAGTGGAATTGCTGGG + Intronic
1022367676 7:29740997-29741019 CACCTAGGAGTGGAATTGCTCGG - Intergenic
1022451268 7:30517632-30517654 CACCTAGGTGTGGAATTGCTGGG - Intronic
1022928506 7:35082870-35082892 CACCTAGGAGTGGAATTGCTGGG + Intergenic
1022937482 7:35193799-35193821 CACCTAGGAGTGGAATTGCTGGG + Intergenic
1024702131 7:51915465-51915487 CACCTAGCAATGGAATTGTTGGG - Intergenic
1026903107 7:74047811-74047833 CACCTCGCTGGGGCAGGGTTGGG + Intronic
1027392196 7:77715604-77715626 GCCCTAGCAGTGGAATTGTTGGG + Intronic
1027778504 7:82495460-82495482 TTCCAAGCTGTGGCATTGTCAGG + Intergenic
1029824618 7:103176544-103176566 CACCTAGGAGTGGAATTGCTGGG + Intergenic
1029833643 7:103286442-103286464 CACCTAGGAGTGGAATTGCTGGG + Intergenic
1030314641 7:108102080-108102102 TACCTAGCTGTGGAATTTCTGGG - Intronic
1031018904 7:116605271-116605293 CACCTGGCTTTGACATTATTTGG + Intergenic
1031412188 7:121453037-121453059 TACCTAGCAGTGGGATTGTTGGG + Intergenic
1033517229 7:142119531-142119553 TACCTAGAAGTGGAATTGTTAGG - Intronic
1035026151 7:155827621-155827643 CACCCATCTGTGGCACTGTTGGG + Intergenic
1038130995 8:24731451-24731473 CACTTAGCTGGGGAATTGATTGG - Intergenic
1038582083 8:28756604-28756626 TACCTAGGAGTGGAATTGTTGGG + Intergenic
1040475600 8:47774613-47774635 CACCTAGGAGTGGCATTGATGGG + Intronic
1042124443 8:65523655-65523677 CACCTAGCAGTAGGATTGCTGGG - Intergenic
1042574910 8:70206985-70207007 CAACTAGCTGTGGAACTGTAGGG - Intronic
1043744520 8:83856646-83856668 TACCTAGCAGTGGGATTGCTGGG - Intergenic
1044464121 8:92483915-92483937 CACCTAGGTGTGGCCTCGTGAGG + Intergenic
1045339261 8:101237598-101237620 TACCTAGAAGTGGAATTGTTGGG + Intergenic
1045556112 8:103216272-103216294 TACCTAGGAGTGGAATTGTTGGG + Intronic
1045669818 8:104537726-104537748 TACCTAGTTGTGGAATTGTTAGG - Intronic
1047423140 8:124723855-124723877 CACCTGGCTGAGGCCTTGGTTGG + Intronic
1047755410 8:127914441-127914463 CACCTAGGAGTGGAATTGCTGGG - Intergenic
1049815025 8:144595071-144595093 TACCTAGTTGTGGAATTGCTGGG - Intronic
1051030134 9:12664601-12664623 TACCTAGCAGTGGAATTGCTGGG - Intergenic
1052498732 9:29261227-29261249 GACCTTCCTGGGGCATTGTTGGG - Intergenic
1054361193 9:64122147-64122169 CACTTAGCTGAGGCATGGTGGGG + Intergenic
1055983151 9:82026175-82026197 CACCTAGAAGTGGAATTGCTGGG + Intergenic
1056381253 9:86059173-86059195 CACCTACAAGTGGGATTGTTGGG - Intronic
1057500343 9:95592703-95592725 TACCTAGGTGTGGAATTGCTGGG - Intergenic
1057597417 9:96426768-96426790 TACCTAGGTGTGGAATTGCTGGG + Intergenic
1057846102 9:98525645-98525667 CACCTAGAAGTGGAATTGCTGGG - Intronic
1058561531 9:106233855-106233877 TACCTACCTGTAGGATTGTTAGG + Intergenic
1058569873 9:106329390-106329412 TACCTAGGAGTGGAATTGTTGGG - Intergenic
1059340771 9:113596498-113596520 CACCCAGGTGTGGCACTGCTAGG + Intronic
1062180463 9:135188670-135188692 GACCTAGGTGTGGCATGGTGGGG - Intergenic
1203759778 EBV:6226-6248 CATTTAGCTGTGACATTGCTAGG - Intergenic
1186399929 X:9248332-9248354 TACCTAGGAGTGGAATTGTTGGG - Intergenic
1187322411 X:18251757-18251779 AACCTAGGAGTGGAATTGTTGGG - Intronic
1187351632 X:18523852-18523874 TACCTAGGAGTAGCATTGTTGGG + Intronic
1188919754 X:35958388-35958410 CACCTAAGAGTGGAATTGTTGGG + Intronic
1189714369 X:43850140-43850162 GACCTAGCTCTGCCATTGCTAGG - Intronic
1189866094 X:45328862-45328884 AACCTAGCTATTGCATTCTTGGG - Intergenic
1190032894 X:46991568-46991590 CACATAGGAGTGGAATTGTTGGG + Intronic
1190267214 X:48834485-48834507 CATGTGGCTGTGGCAGTGTTGGG - Intronic
1192037273 X:67577489-67577511 CACCTAGGAGTGGAATTGCTGGG + Intronic
1192899817 X:75484695-75484717 TACCTAGCTGTGGGATTCTTGGG - Intronic
1193149275 X:78107747-78107769 CACCTAGGAGTGGAATTGCTGGG + Intronic
1194218343 X:91160676-91160698 CACCCAGCAGTGGGATTGCTGGG + Intergenic
1194754081 X:97716554-97716576 AACCTAGAAGTGGAATTGTTGGG + Intergenic
1194887882 X:99340368-99340390 GACCCAGCAGTGGCATTGCTGGG + Intergenic
1195547651 X:106130998-106131020 TACCCAGCAGTGGGATTGTTGGG - Intergenic
1196091306 X:111746696-111746718 TACCTAGCAGTGGAATTGCTGGG + Intronic
1196336413 X:114541567-114541589 TACCTAGGAGTGGAATTGTTGGG - Intergenic
1196383142 X:115116183-115116205 TACCTAGCAGTGAAATTGTTAGG - Intronic
1196723425 X:118875673-118875695 CCCCTATCTATGGCTTTGTTGGG - Intergenic
1196750506 X:119112822-119112844 TACCTAGGAGTGGAATTGTTGGG - Intronic
1196888892 X:120273107-120273129 CACCTACCTGTGGACTTGTGAGG - Intronic
1198505791 X:137300131-137300153 CACCTAGAAGTGGAATTGCTGGG - Intergenic
1199611328 X:149617655-149617677 TACCTAGGTGTGGGATTGCTGGG - Intronic
1199725602 X:150577321-150577343 TACTTAGGTGTGGCATTGCTGGG + Intronic
1199855391 X:151755369-151755391 CTCCAAGCTGTGGCTTTGTAGGG - Intergenic
1200554856 Y:4624464-4624486 CACCCAGCAGTGGGATTGCTGGG + Intergenic
1201725575 Y:17147011-17147033 TACCCAGCTGTGGGATTGCTGGG - Intergenic
1202096463 Y:21253732-21253754 TATCTAGTTGTGGCATTGCTGGG + Intergenic