ID: 903922659

View in Genome Browser
Species Human (GRCh38)
Location 1:26811812-26811834
Sequence TTGTGGGTCTGGTGGCAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903922659_903922666 9 Left 903922659 1:26811812-26811834 CCTTGTTGCCACCAGACCCACAA No data
Right 903922666 1:26811844-26811866 AATCTCAGCATTCTCCAAGGAGG No data
903922659_903922665 6 Left 903922659 1:26811812-26811834 CCTTGTTGCCACCAGACCCACAA No data
Right 903922665 1:26811841-26811863 TGCAATCTCAGCATTCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903922659 Original CRISPR TTGTGGGTCTGGTGGCAACA AGG (reversed) Intergenic
No off target data available for this crispr