ID: 903926127

View in Genome Browser
Species Human (GRCh38)
Location 1:26831953-26831975
Sequence CCACTAGACCATAAGCCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903926121_903926127 15 Left 903926121 1:26831915-26831937 CCTGTGTGGCAATTCCCTGTTTA 0: 1
1: 0
2: 0
3: 10
4: 128
Right 903926127 1:26831953-26831975 CCACTAGACCATAAGCCACAAGG 0: 1
1: 0
2: 4
3: 18
4: 137
903926120_903926127 16 Left 903926120 1:26831914-26831936 CCCTGTGTGGCAATTCCCTGTTT 0: 1
1: 0
2: 0
3: 16
4: 210
Right 903926127 1:26831953-26831975 CCACTAGACCATAAGCCACAAGG 0: 1
1: 0
2: 4
3: 18
4: 137
903926122_903926127 1 Left 903926122 1:26831929-26831951 CCCTGTTTACATGTCTTGTTTTC 0: 1
1: 0
2: 1
3: 47
4: 466
Right 903926127 1:26831953-26831975 CCACTAGACCATAAGCCACAAGG 0: 1
1: 0
2: 4
3: 18
4: 137
903926123_903926127 0 Left 903926123 1:26831930-26831952 CCTGTTTACATGTCTTGTTTTCC 0: 1
1: 0
2: 0
3: 30
4: 352
Right 903926127 1:26831953-26831975 CCACTAGACCATAAGCCACAAGG 0: 1
1: 0
2: 4
3: 18
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903926127 Original CRISPR CCACTAGACCATAAGCCACA AGG Intronic
900310540 1:2031317-2031339 CCACTGGACCAAAGGCCTCAGGG - Intergenic
903926127 1:26831953-26831975 CCACTAGACCATAAGCCACAAGG + Intronic
905287095 1:36888583-36888605 CCACTAGATTATAAGCTCCATGG + Intronic
905341116 1:37278223-37278245 CCACTAGATTATAAGCCTCTTGG - Intergenic
908710734 1:67011424-67011446 CCACTTGACCAGATTCCACAGGG - Intronic
910946558 1:92598190-92598212 CCACTAGAGCATAAGCTCCATGG - Intronic
913025402 1:114833174-114833196 CCACCAGACCATCCACCACAGGG - Intergenic
913306893 1:117438000-117438022 ACAGTAAACCATAAGCCATAGGG - Intronic
913466698 1:119150208-119150230 CCTCTAGAACATAAGCAGCATGG + Intergenic
914690084 1:150017999-150018021 TCCATAGACCATAAGCAACATGG - Intergenic
915740597 1:158115825-158115847 CCACTAGACCAGGAGCCTCCGGG + Intergenic
915977046 1:160398345-160398367 CCCTTAGACCATAGGGCACATGG + Intergenic
916020850 1:160790849-160790871 CCACTAGACTGTAAGCAACACGG - Intergenic
916611335 1:166394960-166394982 CCACTTGACCATAAGCTCCTTGG - Intergenic
917185670 1:172352478-172352500 TCACTACAGCATAAGCCTCAGGG + Intronic
918357318 1:183717708-183717730 CCACTAGTTTATCAGCCACAAGG - Intronic
921608274 1:217180107-217180129 TCACAAGACCTTCAGCCACATGG + Intergenic
1063168027 10:3481458-3481480 CCACTAGAACATAAGACAAGAGG + Intergenic
1063327724 10:5121781-5121803 CCATTAGACTAGAAGGCACAGGG - Intronic
1065275705 10:24083492-24083514 ACCCTAAACCTTAAGCCACAAGG - Intronic
1068549189 10:58386597-58386619 CCTCTAGACCAAAGGCAACAAGG - Intronic
1069298310 10:66874919-66874941 CTACTAGACTGTAAGCCAAATGG - Intronic
1072031659 10:91527802-91527824 CCACAAGAATATAAGCCAAACGG + Intergenic
1072681856 10:97513257-97513279 CAAGTAGACCATAAGCCATCTGG - Intronic
1074518189 10:114191343-114191365 ACACCAGAACATAAGCAACAAGG - Intronic
1075443351 10:122496529-122496551 ACACTAGATCTTAAGCCCCATGG - Intronic
1075762082 10:124864655-124864677 CCACTTGGCCAAAAGCCACTTGG + Intergenic
1078109544 11:8381615-8381637 TCACTAGACCAGAAGCCAGGTGG - Intergenic
1081784090 11:45734064-45734086 CCATGAGAAGATAAGCCACAGGG - Intergenic
1082184735 11:49165273-49165295 CCACTAGACGATAAGTCCCCTGG + Intronic
1089651262 11:119914935-119914957 CCACTAGGCCATAATCCACTAGG - Intergenic
1089975632 11:122729272-122729294 CCACAAGACCAAAAGTGACAAGG - Intronic
1092315831 12:7412689-7412711 CCAAAAGAACATAAGCCAGATGG + Intronic
1094415316 12:30209659-30209681 ACATTAGACCACAGGCCACAAGG + Intergenic
1095244641 12:39904718-39904740 AAACTAGACTACAAGCCACAGGG + Intronic
1095918602 12:47506137-47506159 TCACCAGTCAATAAGCCACATGG + Intergenic
1097271086 12:57774624-57774646 TCACTAGACCATAAGCTCCTTGG - Intronic
1098313890 12:69174131-69174153 CGCCTAGTCCATAAGCCACAGGG + Intergenic
1102358700 12:112263967-112263989 TCACAAGAATATAAGCCACAAGG + Intronic
1102497580 12:113330143-113330165 CCACTAGAGTATAAGCTCCAGGG + Intronic
1103172739 12:118835560-118835582 CCACTAGACCGTGAGCTACACGG - Intergenic
1104272559 12:127295049-127295071 CTCCTATAACATAAGCCACAAGG + Intergenic
1106312642 13:28567350-28567372 CCACTAGACCGTAAGGCCCATGG - Intergenic
1117847117 14:59922992-59923014 CCACAAAACCAGAAGCCACCAGG - Intronic
1118318590 14:64740507-64740529 TCTCTAGACCCTAATCCACATGG + Intronic
1118651118 14:67895578-67895600 CCACTAGACTATAAGCAGTATGG + Intronic
1121635116 14:95448896-95448918 CCATTATCCCACAAGCCACAGGG - Intronic
1121753859 14:96385384-96385406 CCACTAGACCACCAGATACATGG - Intronic
1125402920 15:39323149-39323171 CCACTGGACCAATAGCCACAGGG - Intergenic
1125891882 15:43273322-43273344 CCCCAAAACCATCAGCCACAAGG + Intergenic
1126147437 15:45489227-45489249 CTACTAGAACATAAGCTCCATGG - Intronic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1138099900 16:54244246-54244268 CCTCTAGACCTAAAGCCACAAGG + Intergenic
1138731015 16:59195281-59195303 CCTCCAGAGCATAAGACACATGG + Intergenic
1140244880 16:73239024-73239046 CCATTTGACCATGAGACACATGG + Intergenic
1141485748 16:84339277-84339299 CCACTAGACTATAGGCAGCAGGG - Intergenic
1144331557 17:14228744-14228766 ATACAAGTCCATAAGCCACATGG + Intergenic
1144506840 17:15838849-15838871 CAACTACACCAAAAGCCCCATGG + Intergenic
1145089551 17:19975684-19975706 CCAGTAGACAATAAGCTCCATGG + Intronic
1145171023 17:20656781-20656803 CAACTACACCAAAAGCCTCATGG + Intergenic
1147251813 17:39157149-39157171 CTACTAGACAGTAAGCCTCAGGG - Intronic
1147510471 17:41064871-41064893 CCATTAGACCATAAGCTTCTTGG + Intergenic
1147981472 17:44277164-44277186 CCTCTAGAACATAAGCTTCATGG + Intergenic
1149061891 17:52432505-52432527 CCAGTAGAGCATAAGCTCCATGG - Intergenic
1149985576 17:61344535-61344557 CCTCTAGAATATAAGCCCCATGG - Intronic
1150068206 17:62129474-62129496 CCACTAGACTATAAGCTTCATGG + Intergenic
1152923620 17:83078095-83078117 CCACCAGACCTTGAGCCTCAGGG + Intergenic
1158875213 18:61727255-61727277 CCACTAGACTATGAGCAACTTGG + Intergenic
1167035880 19:46994702-46994724 CCACTAGACCGTAAGCGGCAGGG + Intronic
1167370013 19:49075090-49075112 CCACTAGACCATGGTCCACTTGG - Intergenic
925156771 2:1654577-1654599 ACACTACATCATTAGCCACAAGG + Intronic
925916171 2:8608066-8608088 CCCCTAGACCCTCAGCCACGAGG - Intergenic
926977397 2:18529014-18529036 GCACTGGAACATAAGCCTCACGG - Intergenic
927099714 2:19778781-19778803 CCACTTCTCCATAAGCCACTGGG + Intergenic
927877724 2:26670093-26670115 CCACTAGAATATGAGCCCCATGG - Intergenic
930781350 2:55227333-55227355 CTACTAGATCATAAGCTTCAAGG - Intronic
931459273 2:62436200-62436222 CCACTAGAACATACGCTGCATGG - Intergenic
932479158 2:72028300-72028322 CCACTAGACTATAAGTTCCAAGG - Intergenic
938507772 2:131904841-131904863 CCACTAGCCCAGAATCCAAAAGG + Intergenic
939316452 2:140556428-140556450 CTATTAGATCATAACCCACACGG + Intronic
942034121 2:171994329-171994351 CCTCTTGACTATAAGCCCCATGG - Intronic
942910411 2:181236916-181236938 CCATTAGACCATAAGCTTCTTGG - Intergenic
944325199 2:198396279-198396301 CCACTAGAATATAAGCCCCAGGG + Intronic
945947052 2:216004366-216004388 CCACTAGAACAAAAGCCACGAGG + Intronic
947175369 2:227361510-227361532 CCATTAGACTATAAGCTCCAGGG - Intergenic
948945152 2:241215594-241215616 CCACAAGACCATAAGGTGCAGGG + Intronic
949068951 2:242011861-242011883 CCACTAGAGCACCAGCGACACGG - Intergenic
1168796462 20:613005-613027 CCACTAGAGTATAAGCTCCATGG + Intergenic
1170732739 20:18988601-18988623 CCACAAGAACATAAGCTCCATGG + Intergenic
1171369082 20:24649017-24649039 CCACTAGACCATAATCCCCAAGG - Intronic
1171445950 20:25205166-25205188 CCACTAGGCCATGAGCCCCCAGG - Intronic
1172029507 20:31971799-31971821 CCATAAGACCATAAGATACAAGG + Intronic
1173191111 20:40876199-40876221 CCACTGGACCATAAGCCCCAGGG - Intergenic
1174974565 20:55317004-55317026 CCATTAGACTATAAGCTGCATGG + Intergenic
1177983746 21:27947410-27947432 CCACTAGCCCAGAATCCAAAAGG - Intergenic
1181347919 22:22233832-22233854 CCACTAGACTCTAAGCTTCATGG + Intergenic
1184384242 22:44165302-44165324 CCACTAGAACAGAAGCCTCAAGG + Intronic
949453317 3:4211656-4211678 CCATTAGACTATAAACTACAAGG + Intronic
950686023 3:14619196-14619218 CCACTAGAATGTAAGCCCCATGG - Intergenic
951069577 3:18311078-18311100 GCAATAGACCATAACTCACAAGG - Intronic
956453700 3:69399834-69399856 ACACCAGACCATAAGCTCCATGG + Intronic
960652980 3:119972038-119972060 TGACTTGACCATAAGCCAGAAGG - Intronic
960708780 3:120506676-120506698 CCTCTGGACCATCTGCCACAGGG + Intergenic
961213949 3:125145268-125145290 CCACTAGACTATGAGCCAGGTGG + Intronic
961360483 3:126364301-126364323 CCCCTAGACCATGAGCACCATGG + Intergenic
962630866 3:137274201-137274223 CCACTAGACTTTAACCCAAAAGG + Intergenic
966889538 3:184396760-184396782 CCACTAGACTATAAACCACATGG - Intronic
967217420 3:187222288-187222310 CCACTTGACCATGAGCCCAAGGG + Intronic
967460975 3:189744964-189744986 CAACCACACCCTAAGCCACAAGG + Intronic
972101994 4:35431728-35431750 CCACTAGGCAATAACCCAGAGGG - Intergenic
972966735 4:44519612-44519634 CCACTAGACTGTAAGCTCCAGGG - Intergenic
975377843 4:73666067-73666089 CCACTAGACCATGGTCCACTTGG + Intergenic
975679620 4:76863330-76863352 CCAATAGAATATAAGCCGCATGG + Intergenic
976226018 4:82796538-82796560 GCACTGGACCAGGAGCCACAAGG - Intronic
980019069 4:127686750-127686772 CCATTAGAACATAAGCTTCATGG + Intronic
980143621 4:128952585-128952607 CTGCTAGAACATAAGCCACAAGG + Intronic
982634589 4:157877967-157877989 CCACTTGACATTAATCCACATGG + Intergenic
985348234 4:189030089-189030111 CAACTATATCATTAGCCACAAGG + Intergenic
986409520 5:7463349-7463371 CCACTACACCATATGCACCATGG - Intronic
989699480 5:44244755-44244777 ACATTAGACCATGAGCCCCAAGG + Intergenic
990294670 5:54388723-54388745 CCAATAGATCATAATCCAGAAGG - Intergenic
994068070 5:95565629-95565651 CCACTAGACTGTAAGCTTCATGG + Intronic
994835162 5:104842649-104842671 ACACTGGAACAAAAGCCACATGG - Intergenic
995012170 5:107268707-107268729 CCAAGACACCATAATCCACATGG - Intergenic
995054119 5:107740478-107740500 CCACTAAACTATAAGCCCCAGGG + Intergenic
995640055 5:114245565-114245587 CCACTACACTATAAACCAAAAGG - Intergenic
996833320 5:127764025-127764047 CCACTATACCATATAACACATGG + Intergenic
998800591 5:145864931-145864953 CCCCTAGAGCATAAGCAACTGGG - Intronic
998809163 5:145948865-145948887 CTACTAGACTATAAGCTCCATGG + Intronic
1002163003 5:177327877-177327899 CCACTAGACTATGAGCTCCATGG + Intergenic
1004465693 6:15882924-15882946 CCACTAGACCCTCAGAGACAGGG - Intergenic
1006255226 6:32827422-32827444 CCACTAGACCATGAGCACCTGGG - Intronic
1006800295 6:36755556-36755578 CCACTAGAATATAAGCACCAGGG + Intronic
1011471423 6:87711717-87711739 CCACTAGACTATAAGCGTAAGGG - Intergenic
1012327157 6:97935644-97935666 CCACCAAACCATTAACCACAAGG - Intergenic
1012608269 6:101185266-101185288 CTACTACACCATAAGCCATCTGG + Intergenic
1015297801 6:131618225-131618247 CCACAATAGCATAAACCACAGGG + Intronic
1017180815 6:151550315-151550337 CCACTAGCCCTTCACCCACAAGG - Intronic
1022574110 7:31481220-31481242 CAACTAAAACATGAGCCACAGGG - Intergenic
1024399108 7:48903630-48903652 CCAGCTGACCATTAGCCACAAGG + Intergenic
1033002508 7:137522416-137522438 CCAAGAGTCCAGAAGCCACAGGG + Intronic
1034471018 7:151254359-151254381 CAAGTCGACCAGAAGCCACAAGG - Intronic
1040707182 8:50143190-50143212 CCACTAGAACATTTCCCACATGG - Intronic
1045340917 8:101253692-101253714 TCACTAGAATATAAGCTACAAGG + Intergenic
1045392103 8:101725796-101725818 CCACTAGACTATAAGTGCCACGG - Intronic
1045505661 8:102776761-102776783 CCACTAGGGCAAAAGCCACTAGG + Intergenic
1048607787 8:135987691-135987713 CTACTAGAATATAAGCTACATGG - Intergenic
1049038197 8:140093159-140093181 CTACTAGAACAAAAGCCACAGGG - Intronic
1050619519 9:7438095-7438117 TCACTTGAATATAAGCCACATGG + Intergenic
1050877222 9:10653909-10653931 CAACTACACCATAAACCAAATGG + Intergenic
1051151239 9:14081396-14081418 CCACTAAACCCACAGCCACAGGG + Intergenic
1051516613 9:17936892-17936914 CCCTCAGACCAAAAGCCACATGG - Intergenic
1060050928 9:120377602-120377624 CCACGTGACCACAAGCCACGAGG - Intergenic
1186352478 X:8754419-8754441 CAACTAGAACATAAGCTCCATGG + Intergenic
1191697987 X:64008798-64008820 CCACTAGACTATAAGCCACTTGG + Intergenic
1192608102 X:72541024-72541046 CCACTAGAGCATAAGCTTCATGG - Intronic
1194853294 X:98896009-98896031 CCACTAGACTATACACTACAAGG + Intergenic
1196047026 X:111267260-111267282 CCACTAGCCCTCAGGCCACAGGG - Intronic
1196727786 X:118912790-118912812 CCATTAGACCATAAAGCACAAGG - Intergenic
1201707560 Y:16954024-16954046 CCACTAGACCATGGTCCACTTGG - Intergenic