ID: 903927462

View in Genome Browser
Species Human (GRCh38)
Location 1:26840853-26840875
Sequence CAGTTGAAGGGAAAGTTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903927462_903927466 0 Left 903927462 1:26840853-26840875 CCCTTCAACTTTCCCTTCAACTG 0: 1
1: 0
2: 3
3: 32
4: 300
Right 903927466 1:26840876-26840898 TAGTAGTTATCTCTCTTGTTAGG 0: 1
1: 0
2: 1
3: 13
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903927462 Original CRISPR CAGTTGAAGGGAAAGTTGAA GGG (reversed) Intronic
902078882 1:13807565-13807587 CATTTGAACAGAAACTTGAAAGG + Intronic
902200122 1:14827082-14827104 CAGGTGAGGGGAAAGAGGAAAGG - Intronic
902961290 1:19964524-19964546 CATTTGAAGGGAGAGCTGAGTGG + Intergenic
903927462 1:26840853-26840875 CAGTTGAAGGGAAAGTTGAAGGG - Intronic
904395404 1:30217817-30217839 CAGCTGAAGGGGAGGCTGAAGGG - Intergenic
905168019 1:36094516-36094538 CTGAAGAAGGGAAAATTGAAAGG + Intergenic
905312384 1:37058959-37058981 CAGAGGAAGGGAGAGATGAAAGG - Intergenic
905956264 1:41999680-41999702 CATTTGAATGGAACTTTGAATGG + Intronic
906821308 1:48933345-48933367 GAGTTTAAGGCAAAGTTGGATGG - Intronic
906832657 1:49049681-49049703 CAGCTGAAGAGAAAGTAGAGAGG + Intronic
908468459 1:64417781-64417803 CATCTGAAGGCAAAGTTGGATGG + Intergenic
910556728 1:88542682-88542704 CAGGTGAAGAGAAATTTGAGTGG + Intergenic
910720888 1:90285149-90285171 CAGTTAAAGTGAAAATTGGAAGG - Intergenic
911425900 1:97712095-97712117 CAGAAGAAAGGAAAGATGAAAGG - Intronic
911733690 1:101314965-101314987 AAGTGGAAAGGAAAGCTGAAAGG + Intergenic
914925509 1:151882999-151883021 AAGGTGAAGGGAAAGGGGAAGGG + Intronic
915734905 1:158078522-158078544 CAGCTGAGAGGAAAGTGGAAGGG - Intronic
916540440 1:165748485-165748507 GAGAGGAAGAGAAAGTTGAAAGG + Intronic
917125494 1:171683957-171683979 TAGTCGAAGATAAAGTTGAAGGG - Intergenic
917246767 1:173011523-173011545 CAAATGAAGGGAAAGTGGGATGG + Intergenic
917691530 1:177474863-177474885 AAATTGAAGGGACAGTTCAATGG + Intergenic
918047330 1:180949408-180949430 CAGCTGGAGGGGAATTTGAAAGG + Exonic
918882717 1:190146044-190146066 GACTTGGAGGGAAAGTTAAAAGG + Intronic
919621725 1:199871246-199871268 AAGTTAAAGAGAAAGTGGAAAGG + Intergenic
922372561 1:224925943-224925965 CATTTGAAGAGAATGTTGAAGGG - Intronic
1062858251 10:790280-790302 CAGCTGCAGGGAAAGCTGTAGGG + Intergenic
1063026690 10:2185912-2185934 CAGATGAAAGGAAAGTGTAATGG - Intergenic
1064753480 10:18555014-18555036 CAGTGGAATGGAGAGTGGAATGG + Intronic
1064754714 10:18563540-18563562 GAGTAGAATGGAAAGTGGAATGG + Intronic
1064756140 10:18573162-18573184 CAGTGGAATGGACAGTGGAATGG - Intronic
1067720237 10:48722589-48722611 CAGTGGAATGGGAAGTTGCATGG + Intronic
1068448469 10:57154392-57154414 CAGATGAAGGGAAATGTGATAGG - Intergenic
1069851583 10:71408852-71408874 CAGTTGAAAGGAAAGTAGGAAGG - Intronic
1071208906 10:83315542-83315564 CAGATGCAGGGAGAGTGGAAGGG - Intergenic
1073034391 10:100553089-100553111 CAGTTGAGGGGAGAGGTGCAGGG + Exonic
1075609073 10:123836855-123836877 CAGGTGAAGGGAAAATTGGTGGG - Intronic
1075847602 10:125557540-125557562 ATGTTGAAGGGAAACTTGGAGGG - Intergenic
1076947059 10:133658635-133658657 GAGTTGAAGTGAATGTTGAAGGG + Intergenic
1079179456 11:18176397-18176419 CAGTTGAAGAGAAAGATGTGAGG - Intronic
1079196576 11:18332893-18332915 AAGTTGAAGATAAAGTTGCACGG - Intronic
1079269396 11:18969588-18969610 CAGTTGAAGAGAAAGATGTGAGG + Intergenic
1080172860 11:29327229-29327251 CATTTGAAGTAAAAGATGAAGGG + Intergenic
1084507036 11:69574787-69574809 CGGGTGAAGGGAGAGTTGCAGGG - Intergenic
1085001514 11:73040863-73040885 CAGTTTGTGGGAAGGTTGAAGGG - Intronic
1085378979 11:76095294-76095316 CAGAAGTAGGGAAAGTTGAGAGG - Intronic
1086342773 11:85863848-85863870 CAACTGAAGGGAAAGAGGAAGGG + Intronic
1089507580 11:118974096-118974118 TACTTGAAGGGAAAGTGGTAAGG + Intronic
1089652307 11:119922268-119922290 TAGTAGAAGGGAAAGTGGACAGG - Intergenic
1092748642 12:11697362-11697384 CAGGTGCAGGAAAAGTTGAAAGG + Intronic
1093100303 12:15020304-15020326 ACCTTGAAGGGAAAGTTAAATGG + Intergenic
1093147135 12:15580324-15580346 CAGTGAAAGGGAAAGTAGAAAGG + Intronic
1094146145 12:27230484-27230506 CAGTTTAAGAGAAAGAAGAAGGG - Intergenic
1094295153 12:28897512-28897534 CAGTTGAAGTGGAAGGTGAAAGG - Intergenic
1095156112 12:38857111-38857133 CATTTGAAGGAAAAGTTTGAAGG - Intronic
1095646805 12:44557394-44557416 GATTTGGAGGTAAAGTTGAAGGG + Intronic
1096017127 12:48286768-48286790 CACTAGAAGGGGAAATTGAAGGG - Intergenic
1099074599 12:78090888-78090910 CAGTAAAAGTGAAAGATGAATGG + Intronic
1099748377 12:86736953-86736975 CAGTTGATGGGAAAATTTGATGG - Intronic
1100180044 12:92075095-92075117 CACTAGAAGGGGAGGTTGAATGG + Intronic
1100201030 12:92298026-92298048 TAGTTGAACTGAAAGTTGATAGG - Intergenic
1100813983 12:98367773-98367795 AAATTGAAGGGCAAGTTGAGTGG + Intergenic
1101083141 12:101209309-101209331 CAGTAGAAGGGAAAGATGCCAGG + Intronic
1101575356 12:105992242-105992264 GAGTTGGAGGGTAAGTTGGAGGG + Intergenic
1102402239 12:112639634-112639656 AACTTGAAATGAAAGTTGAAGGG + Intronic
1104034736 12:125090445-125090467 CAGTTGGATGGATAGTTGGATGG - Intronic
1106360312 13:29025373-29025395 CAGTTGCAGGGAAAGCTGCCGGG - Exonic
1106568271 13:30905759-30905781 CAGCTGAAGGAAAGGCTGAAAGG + Intergenic
1109368546 13:61391026-61391048 CACTAGAAGGTAAAGTGGAAAGG - Intergenic
1110178779 13:72590436-72590458 CAGTTGTGGGGAGAGTGGAATGG + Intergenic
1110639148 13:77801988-77802010 CAGTGCAGGGGAAAGATGAAGGG + Intergenic
1111420672 13:88006096-88006118 GAGTTCAACAGAAAGTTGAATGG - Intergenic
1111758727 13:92433917-92433939 CATTTGAAGAGAAAGGTGAAGGG + Intronic
1112717018 13:102198548-102198570 CAATTTATGGGAAAATTGAACGG + Intronic
1114305765 14:21421630-21421652 CAGTTGATGGGAATGTTAATTGG - Intronic
1114816485 14:25964918-25964940 CTGTGAAAGGGAAAGTTGAAGGG - Intergenic
1116624922 14:47252146-47252168 CAGCTAAAGGGAAAGTGGATAGG + Intronic
1116715813 14:48425059-48425081 CAGTTCAAAGAAAAGATGAATGG + Intergenic
1117229523 14:53701455-53701477 CATTGGAAGAGAAAGTTCAAGGG - Intergenic
1117325514 14:54665628-54665650 CAGATGGTGGGAAAGATGAATGG + Intronic
1119565615 14:75626688-75626710 CACTTGATGGGAATGTTGTAGGG + Intronic
1121816018 14:96929128-96929150 TAGGTGAAGGGATAGTTGGATGG - Intronic
1202921125 14_KI270723v1_random:31190-31212 GAGTTGAAGTGAATGTTGAAGGG + Intergenic
1202923785 14_KI270724v1_random:6390-6412 GAGTTGAAGTGAATGTTGAAGGG - Intergenic
1123634161 15:22286669-22286691 TAGTAGAGGGGAAAGGTGAATGG + Intergenic
1125585497 15:40816381-40816403 CTGTTGAATGGAAAACTGAATGG - Intronic
1126796895 15:52266840-52266862 CTCTTGAAGGGAGAGTTGCAGGG + Intronic
1128211389 15:65905507-65905529 CAGGTGAAGCCAAAGATGAAAGG - Intronic
1128361313 15:66963711-66963733 GAGTTGCAGGGAAAGCTCAAAGG + Intergenic
1130418211 15:83714421-83714443 CAGTTGAAGAGCTACTTGAAGGG - Intronic
1131671796 15:94627490-94627512 CAGGAGAAGAAAAAGTTGAAGGG + Intergenic
1135055006 16:19224538-19224560 GAGATGAATGAAAAGTTGAATGG + Intronic
1136381702 16:29899088-29899110 CAATTAAAGGGAAAGATAAACGG - Exonic
1136504172 16:30692246-30692268 CTGGTGAAGTGAAAGTTGGATGG - Intergenic
1140330798 16:74054923-74054945 CAGTGGAAGGAAAAGAGGAAAGG + Intergenic
1140602085 16:76488779-76488801 CTGTTGCTGGTAAAGTTGAAGGG + Intronic
1140650124 16:77079124-77079146 CAGTTGGACAGAAGGTTGAATGG + Intergenic
1140708687 16:77656155-77656177 AAGTAGAAAGGGAAGTTGAAGGG + Intergenic
1141260761 16:82451690-82451712 CAATTGATGGGAAAGTAGGAAGG + Intergenic
1142250844 16:88991198-88991220 CAGGTGGAGGGAAAGTGGGAAGG - Intergenic
1142607936 17:1092209-1092231 CAGTGGAAGGGAGGGTTGACAGG + Intronic
1145697551 17:26801058-26801080 CAATGGAATGGAAAGTAGAATGG + Intergenic
1146831287 17:36071292-36071314 GAGTTGAAGGGAAAGGGGAAAGG - Exonic
1147354602 17:39884775-39884797 CAGAAGAGGGGAAAGTGGAAGGG - Intergenic
1148696952 17:49566319-49566341 CAGAGGAAGGGAAAGTGGAAAGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149082285 17:52673578-52673600 GAGTTGAAGGGAAAGGTGAGAGG + Intergenic
1149580176 17:57744565-57744587 CAGTTCAAGTGAAAGTTACAGGG + Exonic
1151565030 17:74893087-74893109 TGGTGGAAGGGAAAGTTGAGAGG - Intronic
1151621800 17:75250177-75250199 CAGGTGAAGGAAATGTTGAGTGG - Intronic
1153519436 18:5938020-5938042 CATTTGAAGGGGAAATTCAAGGG + Intergenic
1154220677 18:12450923-12450945 AAGTTGAAAGGAAAGTTTGATGG + Intronic
1155498729 18:26466413-26466435 CAGCTTAAGGAAAAGTTAAAGGG - Intronic
1156066146 18:33145722-33145744 CAGTAGAAGAGAAAGCTGAAGGG - Intronic
1157467114 18:47956863-47956885 TAGTTGAAATGAATGTTGAAAGG - Intergenic
1159615626 18:70576106-70576128 CAGTTGGAGGAAATGATGAAAGG - Intergenic
1159883162 18:73878822-73878844 CAGTGGAAGATACAGTTGAAAGG + Intergenic
1160111860 18:76040168-76040190 CACTTGAAGGGCAAATGGAAAGG - Intergenic
1163301423 19:16449522-16449544 CTGCTGATGGGAAAGTTAAAAGG + Intronic
1163457584 19:17417086-17417108 AAGTTGAAAGGAAAGTTTGACGG - Intronic
1163804883 19:19389669-19389691 CAGGGGAAGGGAAAGTTGGAGGG + Intronic
1164557369 19:29263859-29263881 CATAGGAAGGGAGAGTTGAAAGG - Intergenic
1165292640 19:34900501-34900523 CTGTTGGTGGGAATGTTGAACGG + Intergenic
1168472117 19:56648255-56648277 CAGGTGAATGGAAAGGTGAGAGG - Intronic
925469197 2:4140671-4140693 CAAGTGAAGGGAAAGGAGAAAGG - Intergenic
926948762 2:18218188-18218210 CAGATGAAGGGAATTTTGAAGGG + Intronic
927093784 2:19732195-19732217 CAGGTGAAAGGGAAGTTGATGGG - Intergenic
927442240 2:23127465-23127487 TAATTGAAGGGACAGATGAATGG + Intergenic
928726488 2:34179771-34179793 ATGTTGAAGGGAAAGGGGAAAGG - Intergenic
929226064 2:39512793-39512815 CAGAGGAAGGCTAAGTTGAATGG + Intergenic
929935000 2:46287962-46287984 GAGCTGGAGGGAAAGATGAACGG - Intergenic
930840604 2:55841100-55841122 TACCTGGAGGGAAAGTTGAAGGG - Intergenic
935338985 2:102042955-102042977 CAGGTGTAGGGAAAGATGAGTGG + Intergenic
935582685 2:104771764-104771786 AAGTTGAAAGGAAAGTTTGATGG + Intergenic
936073258 2:109385075-109385097 CAGAGGAAGGGACAGATGAAGGG - Intronic
937179705 2:119982082-119982104 CATTTTAGGGGAAAGTTCAAAGG + Exonic
937866597 2:126756259-126756281 CATTTGAGTGGAGAGTTGAAGGG - Intergenic
939369660 2:141282887-141282909 CAGTTGGAGGCTAAGTTGAAAGG + Intronic
940604743 2:155907002-155907024 CAGTTCAAGGGAAAGAAGATAGG + Intergenic
940613136 2:156015845-156015867 CAATTCAAGGGAAACTGGAAAGG + Intergenic
940897457 2:159094592-159094614 CAGTTGAAGGGAAAGCAGCTGGG + Intronic
940944994 2:159606011-159606033 GATTTGAAGTAAAAGTTGAAGGG - Intronic
942668066 2:178343438-178343460 CAGATGGAGGCAAAGTTGAATGG + Intronic
943300790 2:186196322-186196344 CAGGTGAAGGGAGATTTGGATGG + Intergenic
944414097 2:199466529-199466551 CAGTGGCAGGGAAAGATGGAAGG + Intronic
945672033 2:212813870-212813892 CATTAGAAAGGAAAATTGAAGGG - Intergenic
946237336 2:218332275-218332297 CAGTGGAAGGCAAAATTGAGAGG + Intronic
946931870 2:224678943-224678965 CAGTTTTAGGAAAGGTTGAAGGG - Intergenic
946970340 2:225083789-225083811 AAGTTGATGGGTAAGTAGAAGGG + Intergenic
947758353 2:232585667-232585689 CAGTTGAGGGGACAGGTGAGAGG + Intergenic
947826871 2:233112354-233112376 CAACTGAAGGAACAGTTGAAAGG - Intronic
1172422999 20:34833660-34833682 AAGTCGAAAGGAAAGTTGGACGG - Intergenic
1173509946 20:43619482-43619504 CAGTTGTGTGGAAAGTGGAAAGG + Intronic
1173867445 20:46321632-46321654 AAGTAGGAGGGAAAGTAGAAAGG - Intergenic
1173918125 20:46724961-46724983 CAGATGGAGGGAAGGTTGAATGG + Intronic
1173976505 20:47190653-47190675 CAGGTGGATGGAAAGTTAAATGG + Intergenic
1174598123 20:51701037-51701059 CAGGTGAAGGAAAAGTTCATTGG - Intronic
1175239887 20:57539339-57539361 CAGGGGAAGGGAGATTTGAAGGG - Intergenic
1175781114 20:61682562-61682584 CAGAGGAAGGGAGAGATGAAGGG + Intronic
1177044674 21:16154751-16154773 CAGATGCAGGGAAAGATGGAGGG + Intergenic
1178989070 21:37336671-37336693 CAGTTGATGGGAAAGTAAAATGG - Intergenic
1179485451 21:41707282-41707304 AAGTTGAAGGGAACTTTCAAGGG - Intergenic
1179925220 21:44530423-44530445 CAGATGGAGAGAAAGATGAATGG - Intronic
1179925228 21:44530479-44530501 CAGATGGAGAGAAAGATGAATGG - Intronic
1179966036 21:44806402-44806424 CAGTATATGGAAAAGTTGAAGGG - Exonic
1181181361 22:21070741-21070763 CACTTGAAGTGAAAGGTGCAAGG - Intergenic
1182843469 22:33411036-33411058 CAGTAGAAGGGAAAGAAGGAAGG - Intronic
1183786509 22:40032027-40032049 CAGTTGGATGGCAAGTTCAAGGG + Exonic
1184425266 22:44405630-44405652 GAGTTGGAGGCAATGTTGAAGGG + Intergenic
1184956042 22:47886574-47886596 TAGATGAAGGGAAAGTAAAAAGG - Intergenic
949698811 3:6731635-6731657 CAGGTGAAGGGAAAAGTGCATGG + Intergenic
952978451 3:38715974-38715996 CAGCTGGATGAAAAGTTGAAGGG + Intronic
954099141 3:48355913-48355935 CAGTAGAATGGAAATTTGCATGG - Intergenic
954248877 3:49353112-49353134 CAGAAGAAGAGAATGTTGAAAGG - Intergenic
954382721 3:50228013-50228035 CATTTGGAGGGAAGGCTGAATGG + Intronic
957080399 3:75631781-75631803 GAGTTGAAGTGAATGTTGAAGGG - Intergenic
957892177 3:86374448-86374470 GAGTTGAAGGCGAAGCTGAAAGG + Intergenic
959435418 3:106309327-106309349 CAGTTGAGGAGGAAGTTGAGAGG - Intergenic
959541731 3:107547776-107547798 CAATAGAAGGGAAAGAAGAAGGG - Intronic
960089003 3:113620002-113620024 CAGATGGATGGATAGTTGAATGG + Intronic
961166724 3:124768840-124768862 CAGCTGATGGGAATGTAGAATGG - Intronic
961618399 3:128203300-128203322 CACCTGAAGGGAAATGTGAATGG - Intronic
961912449 3:130333165-130333187 CAGTTGATGGGAATGTAAAATGG + Intergenic
962203055 3:133415772-133415794 CAGTAGAAGGGTAAGTGGAGGGG - Intronic
963516109 3:146310311-146310333 CAATTGATGGGAAAGTAGATTGG - Intergenic
963577984 3:147086580-147086602 CAGTTAAAGTGAAAGGTGAAAGG - Intergenic
964897991 3:161621482-161621504 CAGTTGAAGAGAGAGATAAAAGG + Intergenic
965148195 3:164933768-164933790 CAGTTTATGGAAAAGATGAAAGG + Intergenic
965298792 3:166984146-166984168 CTGTTGAAGTGAAAGTTGTCAGG + Intergenic
965727968 3:171739534-171739556 AAGTGGGAGGGAAAGTTGAAGGG - Intronic
967217311 3:187221280-187221302 CAGGTGAAGGAACAGTTGAATGG + Intronic
968004203 3:195228342-195228364 CAGGTGGAGGGAAAGGGGAAAGG - Intronic
968973566 4:3809646-3809668 CAGCTGAAGGGAGAGCTGACGGG + Intergenic
970638317 4:18035303-18035325 CAGTTAAAGGAAAAGAGGAAGGG - Intergenic
970783546 4:19768310-19768332 CAATTGAAGGGAAAATGTAAGGG - Intergenic
971661031 4:29415935-29415957 GAGTTGTAAGGAAACTTGAATGG - Intergenic
971785853 4:31101702-31101724 CAGTTGAAAGGAAAATCTAAAGG - Intronic
972164115 4:36261218-36261240 CAGTTGGAAGGAAAGAAGAAAGG + Intergenic
974003296 4:56531551-56531573 TAGTTAAAGAGAAAGATGAATGG - Intronic
974154108 4:58048040-58048062 CATTTGAAGTGAAAGCAGAAGGG - Intergenic
974281256 4:59797235-59797257 GACTTGAAGGGAAAGGTGGAAGG - Intergenic
974939585 4:68449849-68449871 CCCTTGAAGGGAAAGGTGACTGG - Intronic
975895496 4:79085102-79085124 CAGTTGATGGGGATGTTGAAAGG + Intergenic
976099156 4:81542040-81542062 CAGGTGAATGGACAGGTGAATGG + Intronic
976272805 4:83247930-83247952 CAGCTGAAGGGAAAGTGCAGTGG + Intergenic
976343229 4:83967921-83967943 CACTTGAAGGATAATTTGAAAGG - Intergenic
978080541 4:104585211-104585233 CCAGAGAAGGGAAAGTTGAAAGG + Intergenic
979958496 4:126986857-126986879 AACATGAAAGGAAAGTTGAAGGG + Intergenic
979973274 4:127164083-127164105 CAGTAGAAAGAAAATTTGAAGGG + Intergenic
981589916 4:146349359-146349381 CAGTTGATGGTAAAGCTGCAGGG + Intronic
981933024 4:150210430-150210452 GAGGTGAAGGGAGAGTTGAGAGG - Intronic
983727487 4:170946377-170946399 CAGTTGAGGGGCAAGGGGAAAGG - Intergenic
984089960 4:175360866-175360888 GAATTGAAGGGAATGTAGAAAGG + Intergenic
985319180 4:188689899-188689921 GAGTTGAAGGGAGTGTTGGATGG - Intergenic
985425671 4:189828156-189828178 CCATTAAATGGAAAGTTGAAAGG - Intergenic
985450520 4:190059434-190059456 GAGTTGAAGTGAATGTTGAAGGG + Intergenic
986780571 5:11061625-11061647 AAGGGGAAGGGAATGTTGAATGG - Intronic
987617176 5:20291372-20291394 CAGTTAAAGTGAATGATGAATGG + Intronic
987945407 5:24601757-24601779 CAGTGGAAGGAAAGCTTGAATGG + Intronic
987963364 5:24839285-24839307 ACGTAGAAGGGAAAGTGGAAAGG - Intergenic
988450475 5:31337551-31337573 AAGTTTAATGGAAAGGTGAATGG - Intergenic
988637045 5:32995826-32995848 AAGATGACGGGAAAGATGAAAGG + Intergenic
992271039 5:75063112-75063134 CATTGGGAGGTAAAGTTGAAAGG + Intergenic
992999690 5:82368137-82368159 CAGTAAGAGGGAAAGTAGAATGG - Intronic
993007847 5:82447323-82447345 GTGTTGGAGGGAAAGTTGATGGG + Intergenic
993346877 5:86795048-86795070 AAGCTGAAGAGAAGGTTGAAAGG + Intergenic
993439807 5:87942038-87942060 CAGTTTATGGGAAAGTAGCATGG - Intergenic
993887225 5:93429494-93429516 TAGTTGAAAGGAAATTTCAAGGG + Intergenic
994038081 5:95225631-95225653 CAGTGGAATGTAAAGTGGAAGGG - Intronic
994159417 5:96539448-96539470 GAGTTGAAAGGAAGTTTGAATGG - Intronic
995674967 5:114653333-114653355 CAGCTGAAGGATAACTTGAAAGG - Intergenic
996217057 5:120881916-120881938 AAATTGAAGGGGAATTTGAAGGG - Intergenic
997754896 5:136386951-136386973 CAGTGGGAGGAAAAGGTGAAGGG + Intronic
998280736 5:140804771-140804793 CAGTGGTAGGGAAACTTAAATGG - Intronic
999567851 5:152885776-152885798 CAGTAGAAGATAAAGTTGGAGGG - Intergenic
1000101599 5:158022215-158022237 AAGGTGAAGGGAAAGGCGAAGGG - Intergenic
1000250462 5:159489854-159489876 CATTTGTAGGGCAAGATGAATGG + Intergenic
1001154624 5:169262413-169262435 CAGTTGAAGGACAGGCTGAAGGG + Intronic
1001490817 5:172153894-172153916 CAGAGGAAGGGACATTTGAACGG - Intronic
1002351211 5:178585054-178585076 CAGCTGAAGGGAAGGTTGATGGG - Intronic
1002840159 6:898543-898565 CCATTGAAGGGAAAGGGGAAAGG - Intergenic
1004062074 6:12207521-12207543 CAGTTACAGGGAAATTTGACAGG - Intergenic
1004301148 6:14458705-14458727 CCATTAAAGGGACAGTTGAATGG - Intergenic
1007476939 6:42125199-42125221 CAGGTGGAGGGAGAGTAGAACGG + Intronic
1007534401 6:42572645-42572667 CAGATGGAGGGAAAGAGGAAGGG - Intronic
1008451276 6:51653502-51653524 AAGTTGAAGGCAAAGATGAGTGG - Intronic
1010956004 6:82091628-82091650 AAGGTGAAGGGAATTTTGAATGG + Intergenic
1011258435 6:85448121-85448143 CAGTGGAAGGTAAAGTTGGCTGG + Intergenic
1011523362 6:88236061-88236083 CAGATTAAGGGAAGGTTGGAAGG - Intergenic
1012485028 6:99711586-99711608 GAGTTGAATGGAAGGTTGATAGG + Intergenic
1012958758 6:105599624-105599646 CAGTGAAAGGGAAAGGGGAAAGG + Intergenic
1013280643 6:108633748-108633770 CTGTTGAGGGTAAAGTTGAGGGG + Intronic
1013888308 6:114998165-114998187 CAGTGGAAGGGGAACTGGAAGGG - Intergenic
1017291506 6:152743667-152743689 CACTTGAAGAGAAAGGTGAAAGG + Intergenic
1017462420 6:154663948-154663970 CATTTTAAAGGAAAGTTGGATGG + Intergenic
1018462030 6:164007571-164007593 CATTTTAATGGAAAGTTTAATGG + Intergenic
1018653526 6:166010741-166010763 CAGCTGGAGGGAAAGCTGACGGG + Intergenic
1020393570 7:7687035-7687057 AAGTTCAAAGGAAAGTTCAAAGG - Intronic
1020581280 7:10005282-10005304 CAATTGAACGGGGAGTTGAATGG + Intergenic
1021477043 7:21073873-21073895 AAGTGGAAGAGAAAGTTAAAGGG + Intergenic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1023124896 7:36945818-36945840 CAGTTGAAAAGAAAATTGGATGG - Intronic
1024317029 7:48030135-48030157 CAGTTGAACGGAAAGCAAAAGGG - Intergenic
1024385046 7:48741417-48741439 TAGTTGAATGAAATGTTGAAGGG - Intergenic
1024599384 7:50966122-50966144 CCGTTGAATGGAAAGTGGAATGG + Intergenic
1026354039 7:69541885-69541907 CAATCGCAGTGAAAGTTGAAGGG + Intergenic
1026447612 7:70499240-70499262 CTGCTGAAGGGAAAGGAGAAGGG + Intronic
1028015170 7:85700646-85700668 CATTTGAAGTTAAAGTAGAAAGG + Intergenic
1028057162 7:86260481-86260503 GAGTTGATGAGAAAGTTTAATGG - Intergenic
1028653961 7:93181259-93181281 CAGTTTAGGGGAAAGGAGAAAGG + Intergenic
1028686643 7:93597134-93597156 CAGTTGAAGGGGAAGTAAAAGGG + Intronic
1029498101 7:100908909-100908931 CACTTACAGGGGAAGTTGAAGGG - Intergenic
1030579618 7:111337520-111337542 CAGATGGATGGACAGTTGAATGG + Intronic
1030579633 7:111337670-111337692 CAGATGTATGGACAGTTGAATGG + Intronic
1031610538 7:123821256-123821278 CTGTTGATGGGAATGTTAAATGG - Intergenic
1032466431 7:132148523-132148545 CAGGTGAGGGGAATGTGGAAAGG - Exonic
1032882344 7:136103067-136103089 CAGTTAAAGGGAAGGAGGAAGGG + Intergenic
1032978883 7:137258264-137258286 GAGTTGGAGAGAAAGTAGAATGG + Intronic
1035724337 8:1815198-1815220 CAGAAGAAGGGAAAGTGGAGGGG - Intergenic
1036190191 8:6663013-6663035 CAGTGGAAGGGCACGTTGAGGGG + Intergenic
1036991747 8:13605782-13605804 CAGTTGAACTGACATTTGAATGG - Intergenic
1037194217 8:16167716-16167738 AAGTTGAGGGGAAAGAAGAATGG - Intronic
1038077328 8:24091105-24091127 CAGTTGAAGGGAAGGTTGACTGG - Intergenic
1039060624 8:33569427-33569449 CCTTTGAAGGGAAAATTGATGGG + Intergenic
1039126729 8:34211712-34211734 CAGTTCAAGTGAATGGTGAAAGG + Intergenic
1041153754 8:54962693-54962715 CAGTTAAAAGGAAAGTAGATAGG + Intergenic
1042722690 8:71842525-71842547 CAGTTCCAGGGAAAGGGGAAGGG + Exonic
1042790797 8:72603462-72603484 CATATGAATGGAAATTTGAAAGG - Intronic
1043863960 8:85354351-85354373 TCTTTAAAGGGAAAGTTGAATGG + Intronic
1045404520 8:101852383-101852405 TAGTGAAAGGCAAAGTTGAAAGG - Intronic
1046418334 8:113944428-113944450 CAGTAGAAGGAAAGGTTTAAAGG + Intergenic
1047722862 8:127657997-127658019 CAGTAGAAGGGAAGTTGGAAGGG - Intergenic
1048486616 8:134853885-134853907 CACTTGGAGAGCAAGTTGAAAGG - Intergenic
1050041331 9:1496887-1496909 CAGTTGAAGGAAAGGAAGAAAGG - Intergenic
1053219883 9:36303624-36303646 AAGTTGAAAGGAAAGTTTTATGG - Intronic
1053330503 9:37202268-37202290 CAGCTGAAGATAAAGTTAAAGGG + Intronic
1057423069 9:94927621-94927643 CAGGTGACGGGAGAGGTGAAGGG - Intronic
1057699575 9:97353967-97353989 CAGATGAAGTGAAACTAGAAGGG - Intronic
1057868805 9:98702389-98702411 CAGTTGAAGGGAGCGGTGATGGG - Intronic
1058532017 9:105915573-105915595 TAGTTGAAGGGAGAGTTGAAGGG + Intergenic
1058661191 9:107270877-107270899 CCTTTGAAAGGAAAGTAGAAAGG - Intergenic
1059775267 9:117468394-117468416 AAATTGAAGGCAACGTTGAAAGG - Intergenic
1060293819 9:122329653-122329675 CTGTTGAAGGGAGAATTGACAGG - Intergenic
1060666905 9:125437097-125437119 CAGGTGAAGGAACAGTGGAAAGG - Intergenic
1061685802 9:132276690-132276712 CAGTTGAATGAAAATGTGAAAGG - Intronic
1062539744 9:137036283-137036305 CAGCAGAAGGTAAAGTGGAAAGG + Exonic
1186564483 X:10647468-10647490 CATTTGAAGTTAGAGTTGAAAGG - Intronic
1186578423 X:10790986-10791008 CAGTTGAATGGACGGATGAAAGG + Intronic
1186726833 X:12366819-12366841 CACTTGAGCCGAAAGTTGAATGG + Intronic
1186798709 X:13071571-13071593 CTGTTAAAGGTAAGGTTGAAAGG + Intergenic
1187483313 X:19678136-19678158 CTGATGAAGGCAAAGTTGGAAGG - Intronic
1188269849 X:28125534-28125556 CATTTGATTGGAAAGTTAAAGGG - Intergenic
1188894302 X:35647373-35647395 CAGTTAAATAGAAAGTTGAAAGG + Intergenic
1189067334 X:37824389-37824411 GGCTTGAAGGGAAAGTTGACAGG - Intronic
1189416205 X:40816594-40816616 CTGTTGAATGGAAAGTGGGATGG - Intergenic
1190179867 X:48183145-48183167 CAGTTCAATGGAATGTTGAGTGG - Intergenic
1190184681 X:48223275-48223297 CAGTTCAATGGAATGTTGAGTGG + Intronic
1190192880 X:48292381-48292403 CAGTTCAATGGAATGTTGAGTGG - Intergenic
1190580704 X:51891224-51891246 CAGGTGAAGGTAGAATTGAAAGG + Intronic
1190659398 X:52640975-52640997 CAGTTCAATGGAATGTTGAGTGG - Intergenic
1190677333 X:52793413-52793435 CAGTTCAATGGAATGTTGAGTGG + Intergenic
1190966949 X:55309834-55309856 TAATTGAAATGAAAGTTGAAAGG - Intergenic
1191600242 X:62995862-62995884 CAGTTGAAGAGAAAGTAGAAAGG - Intergenic
1192433153 X:71126016-71126038 CACCTGAGGGGACAGTTGAAAGG - Exonic
1194490937 X:94548574-94548596 TAGTTGAAAGGAGAGTAGAAAGG - Intergenic
1194774100 X:97942113-97942135 CAAATGAAAGGAAATTTGAAGGG - Intergenic
1195402512 X:104476399-104476421 TAGTTGAAGGGAAGGTGGTATGG + Intergenic
1195676878 X:107513300-107513322 CAGCTGAAGAGGAAGTTGCAGGG + Intergenic
1195726278 X:107920270-107920292 AAGTTGAAAGAAAAGGTGAAGGG - Intronic
1197970396 X:132109484-132109506 GAATTGAAGGGACAGTAGAAAGG - Intronic
1198021460 X:132662549-132662571 CAGTTGAAGGGAGAGAAAAATGG + Intronic
1198146670 X:133864242-133864264 CAGATGAAGGGAAGGTTAAAGGG + Intronic
1199271177 X:145883937-145883959 CAGTGGATCTGAAAGTTGAAGGG - Intergenic
1201266116 Y:12208375-12208397 CAGTTGAAGAGGGAGATGAATGG - Intergenic
1201893542 Y:18969550-18969572 CAGTAGAGGGACAAGTTGAAAGG - Intergenic
1202305543 Y:23466345-23466367 TAGTAGAGGGGAAAGGTGAATGG + Intergenic
1202565266 Y:26204244-26204266 TAGTAGAGGGGAAAGGTGAATGG - Intergenic