ID: 903928441

View in Genome Browser
Species Human (GRCh38)
Location 1:26848594-26848616
Sequence CTGTGTTGTCTGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 326}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903928441_903928447 6 Left 903928441 1:26848594-26848616 CCTCCTTCCCTCAGACAACACAG 0: 1
1: 0
2: 0
3: 42
4: 326
Right 903928447 1:26848623-26848645 CTACATACCGGCCACCCCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 45
903928441_903928446 -6 Left 903928441 1:26848594-26848616 CCTCCTTCCCTCAGACAACACAG 0: 1
1: 0
2: 0
3: 42
4: 326
Right 903928446 1:26848611-26848633 ACACAGGCAGTTCTACATACCGG 0: 1
1: 0
2: 1
3: 10
4: 131
903928441_903928448 12 Left 903928441 1:26848594-26848616 CCTCCTTCCCTCAGACAACACAG 0: 1
1: 0
2: 0
3: 42
4: 326
Right 903928448 1:26848629-26848651 ACCGGCCACCCCCTCGGACCCGG 0: 1
1: 0
2: 1
3: 5
4: 96
903928441_903928459 30 Left 903928441 1:26848594-26848616 CCTCCTTCCCTCAGACAACACAG 0: 1
1: 0
2: 0
3: 42
4: 326
Right 903928459 1:26848647-26848669 CCCGGGAGGTGCTGATCAACGGG 0: 1
1: 0
2: 1
3: 8
4: 96
903928441_903928457 29 Left 903928441 1:26848594-26848616 CCTCCTTCCCTCAGACAACACAG 0: 1
1: 0
2: 0
3: 42
4: 326
Right 903928457 1:26848646-26848668 ACCCGGGAGGTGCTGATCAACGG 0: 1
1: 0
2: 1
3: 7
4: 166
903928441_903928450 13 Left 903928441 1:26848594-26848616 CCTCCTTCCCTCAGACAACACAG 0: 1
1: 0
2: 0
3: 42
4: 326
Right 903928450 1:26848630-26848652 CCGGCCACCCCCTCGGACCCGGG 0: 1
1: 1
2: 5
3: 31
4: 269
903928441_903928451 16 Left 903928441 1:26848594-26848616 CCTCCTTCCCTCAGACAACACAG 0: 1
1: 0
2: 0
3: 42
4: 326
Right 903928451 1:26848633-26848655 GCCACCCCCTCGGACCCGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903928441 Original CRISPR CTGTGTTGTCTGAGGGAAGG AGG (reversed) Exonic
900704843 1:4073962-4073984 CTGTGAGCCCTGAGGGAAGGGGG + Intergenic
903229539 1:21913495-21913517 GTGGGCTGTCTGAGGGCAGGTGG - Intronic
903928441 1:26848594-26848616 CTGTGTTGTCTGAGGGAAGGAGG - Exonic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
904963288 1:34351501-34351523 CTGTGTTTTCTGTTGGAATGGGG + Intergenic
905042666 1:34973182-34973204 CTGCGTTGACTCAGGGAAGGAGG - Intergenic
906175260 1:43765890-43765912 CTGTTATGGCTGAGGGAAAGAGG - Intronic
906468698 1:46108715-46108737 CTGTGCTAGCTCAGGGAAGGAGG - Intronic
909512808 1:76474103-76474125 ATGTGTTGACTGAGGCAAGCTGG - Intronic
911036209 1:93551455-93551477 CTGTGTTTTCTGAAGTAAAGGGG - Intronic
911295948 1:96115000-96115022 CTGTGTTGTGTGGTGGAAGCAGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912988753 1:114461527-114461549 CTGTGTTGTGTGAGTATAGGAGG + Intronic
913301009 1:117368244-117368266 CTGTGATGTGGGAAGGAAGGCGG - Exonic
913389647 1:118296202-118296224 GTGTGTTGTGGGAGGGAAGGTGG - Intergenic
913490454 1:119374876-119374898 CTCTCCTGACTGAGGGAAGGAGG - Intronic
913971225 1:143419879-143419901 CTGTGTTGTCCGAGTGGAGGTGG - Intergenic
914065602 1:144245492-144245514 CTGTGTTGTCCGAGTGGAGGTGG - Intergenic
914113549 1:144720862-144720884 CTGTGTTGTCCGAGTGGAGGTGG + Intergenic
915169712 1:153969179-153969201 CAGTGTTCTTTGTGGGAAGGGGG + Intronic
915871533 1:159564875-159564897 CTGTGGTCTCTGAAGGAAGGTGG + Intergenic
916051660 1:161040744-161040766 CAGTGATGTCTGAGGGGAGGAGG - Intronic
916171765 1:162006540-162006562 CTGTGTGCTCTGAGCGAAGATGG - Intronic
917192227 1:172430122-172430144 CTGTGGTGTGTGTGGGAAAGGGG - Intronic
917656360 1:177130213-177130235 CTTTGTTGACTGAGACAAGGTGG - Intronic
919656435 1:200201443-200201465 CTGTGGTGGCTGTGGGGAGGTGG - Intergenic
919894818 1:202002983-202003005 CTGTGTTGTCAGAGCCAAGTTGG - Intronic
920388041 1:205581676-205581698 CTGTCTTGGCTGTGGGATGGAGG + Intronic
921580049 1:216885828-216885850 TTGTTTTATCTGAGGGAGGGAGG - Intronic
923155377 1:231273782-231273804 TTCTGTTGTCTGAGGGCATGTGG + Intronic
923866770 1:237947949-237947971 CTGTGTTGTCCTGGGGAGGGGGG + Intergenic
923999520 1:239535151-239535173 CAGTGTTTGCTGAAGGAAGGGGG + Intronic
1062910062 10:1206406-1206428 CTGTGTGGTCTGAGAGAACTGGG + Intronic
1064128311 10:12684347-12684369 CTGTGTTGGGTCAGAGAAGGGGG + Intronic
1066364467 10:34763434-34763456 CTGTGTCCTCTGGGGGAAGGTGG + Intronic
1067067210 10:43110852-43110874 CTTTGTTGTCTGAGTGAGGGAGG + Intronic
1067242234 10:44506715-44506737 CTGTGTTGGCAGAGGGCTGGGGG + Intergenic
1067565535 10:47333614-47333636 CTGTGTTGTTTGAGGCAAAGAGG - Intergenic
1067680732 10:48437900-48437922 CTGTGTTGTCTAAAAGATGGAGG + Exonic
1067901979 10:50251362-50251384 CTATGTTTTCTTGGGGAAGGAGG - Intergenic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1068116800 10:52744805-52744827 CGTTGATGTCTGTGGGAAGGTGG - Intergenic
1069559528 10:69419744-69419766 CTGTGGTGTGTGAGAGAAGTGGG + Intergenic
1069722244 10:70557232-70557254 CTGTGTGCTTTGAGGGATGGTGG + Intronic
1070170288 10:73927711-73927733 CTGTGCTGGCTGAGGGAATGAGG + Intergenic
1072430004 10:95362518-95362540 CTGGGTTGTGTGATGGAAGATGG - Intronic
1072623577 10:97096706-97096728 CTGGGTTTGCTGGGGGAAGGGGG - Intronic
1073244206 10:102078016-102078038 CAGTCATGTCTGAGGCAAGGAGG + Intergenic
1073500169 10:103929741-103929763 CGGTCTTGGCTGAGGGGAGGCGG - Intergenic
1075242749 10:120793137-120793159 GTGTGTTGTGTGAGGGAGGGGGG - Intergenic
1075988003 10:126804808-126804830 ACGTGTGGGCTGAGGGAAGGAGG - Intergenic
1076035735 10:127196903-127196925 GTGTGTTCTCTCAGGGATGGGGG + Intronic
1076628185 10:131834532-131834554 CGGTGGTCTCTGAGGCAAGGGGG - Intergenic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1076851786 10:133096835-133096857 GTGTGGGGTCTCAGGGAAGGGGG - Intronic
1079849262 11:25510555-25510577 CTGCTGTGTCTGTGGGAAGGTGG - Intergenic
1080116240 11:28624393-28624415 CTGTGTCGTCTCATGGAAGAAGG + Intergenic
1080145725 11:28980840-28980862 ATGTGCTGTCTGAAGGAAGGTGG - Intergenic
1080637195 11:34134435-34134457 CTGGTGTGTCTGAGGGAAGCTGG + Intronic
1082126268 11:48434736-48434758 CTGTGTTGTGGGTGGGGAGGGGG - Intergenic
1082559854 11:54605564-54605586 CTGTGTTGTGGGTGGGGAGGGGG - Intergenic
1082775643 11:57242472-57242494 TGGTGTTATCTGAGGGAAAGGGG + Intergenic
1083740920 11:64711487-64711509 CTGTGGTGTCGGGGGGCAGGGGG - Intronic
1084322298 11:68380347-68380369 CTGTGTTGACTGAGGCAGGCTGG + Intronic
1084411630 11:69009329-69009351 CTAGGTTGGCTGAGGGCAGGAGG + Intronic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1088020311 11:105111316-105111338 CTCCCTTGCCTGAGGGAAGGAGG - Intergenic
1090080423 11:123608906-123608928 CTGAGGTGGCCGAGGGAAGGAGG - Intronic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090563782 11:127964188-127964210 CATTGTTGTCTGAGAAAAGGAGG + Intergenic
1093306960 12:17532390-17532412 CTGTTTTGTCTCAGGGAATAGGG - Intergenic
1093556705 12:20484485-20484507 CTGTGATTTCTGAAGGAAAGGGG + Intronic
1094490921 12:30960111-30960133 CTGTGGTGTCTGTGGGTGGGTGG + Intronic
1096590053 12:52652041-52652063 CTGTGGTGTCTGGTGGAAGCCGG - Exonic
1097119544 12:56720825-56720847 GGGTGTTGTCTGAGGAAGGGAGG + Exonic
1097261945 12:57725390-57725412 CTGGGTTGGCTGAGGGAGGCAGG + Intronic
1101900132 12:108785881-108785903 TTTTGTTGGCTGAGGGAAAGGGG + Exonic
1102480007 12:113216351-113216373 CAGTGTTGTCTAAGGGCTGGGGG + Intronic
1103167523 12:118783107-118783129 CCGTGTTGTCTGAGGGATGAGGG + Intergenic
1104459400 12:128942652-128942674 CTGTGTGGTCTGGGAGAAGTGGG - Intronic
1105659150 13:22473900-22473922 CTGTGTTGACTGATGGGGGGTGG - Intergenic
1105929659 13:25040736-25040758 ATGTGTTGTCTGCAGGAAGAGGG - Intergenic
1106256306 13:28025316-28025338 CTGTATTATGTGAGGGAAAGTGG - Intronic
1108912746 13:55577238-55577260 CTGTGTTGTTGGTGGGAATGGGG - Intergenic
1110957420 13:81572616-81572638 CTGTGTGGTCTGACTGAAGCAGG + Intergenic
1111215789 13:85139714-85139736 CTGTGGCGTCTGAGGAGAGGAGG - Intergenic
1111658879 13:91184539-91184561 CTGTGTTGTGGCAGGGATGGAGG + Intergenic
1112384878 13:98930393-98930415 CTGTTGTGTGTGACGGAAGGAGG - Intronic
1112495553 13:99901063-99901085 TTGGGTTGTCTGAGGGAAGAAGG + Intergenic
1112646657 13:101340433-101340455 CTGTGTTATTTGAGGGAAAATGG - Intronic
1112890220 13:104220256-104220278 CTGTGTAGGCTGGGGGGAGGGGG + Intergenic
1113322346 13:109246368-109246390 GTGTCTTGTCTGAGTGAAGGGGG + Intergenic
1113878860 13:113611416-113611438 CTGTGCTGTTTGAGGAAAGATGG + Intronic
1114496564 14:23137053-23137075 CTGTACTTTCTGAGGGCAGGGGG + Intronic
1115418528 14:33165768-33165790 CAGTTTTGTTTGGGGGAAGGAGG - Intronic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1115860560 14:37681633-37681655 GTCTGATGTCTGAGGGCAGGGGG - Intronic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1119102272 14:71891006-71891028 CTGTGATGTCTGGGGGACAGGGG + Intergenic
1119630743 14:76229824-76229846 GAGTGTTGTCTCAGGGCAGGGGG - Intronic
1119716870 14:76865886-76865908 CTCTTTTGTGGGAGGGAAGGGGG + Intronic
1120871410 14:89340211-89340233 GCGTGTGTTCTGAGGGAAGGGGG + Intronic
1121113952 14:91330853-91330875 GTGTGTGGGCTAAGGGAAGGCGG + Intronic
1121222793 14:92299171-92299193 CTGTGATTTCTCAGGGATGGTGG + Intergenic
1121775035 14:96584754-96584776 CTGTGAGGACTGAGGGAGGGTGG + Intergenic
1121874729 14:97440828-97440850 CTGTATTGTATCAGGGAAGGAGG + Intergenic
1124037920 15:26073492-26073514 AAGTGGTGGCTGAGGGAAGGAGG + Intergenic
1125999435 15:44195216-44195238 CGGTGGCGGCTGAGGGAAGGAGG - Exonic
1128613250 15:69090281-69090303 CTGAATTGTCTGAGAGAGGGAGG - Intergenic
1129024828 15:72561101-72561123 GTGGGGTGTCTGAAGGAAGGTGG + Intronic
1130071885 15:80654441-80654463 CTGAGTGTTGTGAGGGAAGGAGG - Intergenic
1130103168 15:80909314-80909336 CAGAGTTCCCTGAGGGAAGGAGG - Intronic
1131231169 15:90660683-90660705 TTGTGCTGTCTGGAGGAAGGCGG + Intergenic
1132920570 16:2388319-2388341 CTGTGCTCTCTGAAGGGAGGTGG - Intergenic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1133555737 16:6904904-6904926 TTTTGTTGTCTGAGGGAATTGGG - Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1136276098 16:29180310-29180332 CTGTGTTCTCTGGGGTCAGGAGG + Intergenic
1137598798 16:49742595-49742617 ATGTTTTGTCTCTGGGAAGGGGG + Intronic
1137751227 16:50862560-50862582 GGGTGTTGGCTGTGGGAAGGGGG + Intergenic
1138081714 16:54096947-54096969 CTGTGTTGTCCTAGGGCTGGAGG + Intronic
1138726464 16:59145784-59145806 CTGTCTTGTTTGAGAGAAAGTGG - Intergenic
1139193369 16:64890751-64890773 ATGTGGTGGCTCAGGGAAGGAGG - Intergenic
1139648933 16:68352056-68352078 GTTTGTTGACTGAGGGAGGGAGG + Intronic
1142080477 16:88146372-88146394 CTGTGTTCTCTGGGGTCAGGAGG + Intergenic
1142260733 16:89041434-89041456 CTGTGGTGTCAGAGAAAAGGAGG - Intergenic
1142280445 16:89145147-89145169 CGGTGTCCTCTGAGGAAAGGGGG - Intronic
1143968041 17:10770870-10770892 AGGTGTTGTCTGAGTAAAGGTGG - Intergenic
1144044999 17:11447484-11447506 CTGTGTTAACTCAAGGAAGGTGG - Intronic
1144219035 17:13083427-13083449 AGGTGCTGTGTGAGGGAAGGAGG + Intergenic
1144995282 17:19263877-19263899 CTGTGGTGGCTGAAGGAAAGAGG + Intronic
1145009379 17:19358994-19359016 ATGTGAGGTCTGAGAGAAGGAGG - Intronic
1145770299 17:27487952-27487974 AGGTGTTGTCTGGTGGAAGGTGG - Intronic
1146453562 17:32993025-32993047 CGGTGCTCTCGGAGGGAAGGTGG + Intronic
1148792485 17:50181235-50181257 CTGTGATGTCAGCGGAAAGGAGG + Intergenic
1149247279 17:54725266-54725288 ATGTGTTGTCAGATGGAAGGAGG + Intergenic
1150768419 17:68020744-68020766 GGATGTTGGCTGAGGGAAGGGGG - Intergenic
1152001665 17:77649764-77649786 CTGTGTGGTTGGAGGGATGGAGG + Intergenic
1152971891 18:169966-169988 CTGTCTTGTCTCAGGGAATAGGG - Intronic
1153292329 18:3513731-3513753 CTATGTTGGCTGTGGGAAAGGGG + Intronic
1158856692 18:61549964-61549986 CTGTGTTATCTGAAAGAAGGAGG - Exonic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1159387186 18:67741880-67741902 CTGTCTTGGCTGGGGGAGGGAGG - Intergenic
1160741311 19:687325-687347 CTGTGTTGGCAGAAGGAACGGGG - Intronic
1161325598 19:3662194-3662216 CTGTGTGGCCCGAGGGAGGGTGG - Intronic
1163659503 19:18568388-18568410 CTGGGATATCTGGGGGAAGGAGG - Exonic
1165244024 19:34487647-34487669 CTTTGTTGACTGAGGAAAGGCGG + Intronic
1165711161 19:38011951-38011973 CTGTGGAGGATGAGGGAAGGAGG + Intronic
1166283584 19:41810448-41810470 CTGTGTGTTTTGGGGGAAGGTGG - Intronic
1167414537 19:49363144-49363166 CTTTGGTGCCTGAGGGAAGATGG + Intronic
1167706116 19:51082218-51082240 TTTTGTTGTCAGAGGGAAGGTGG - Intronic
1168145660 19:54419017-54419039 CTGGGATGTCAGAGTGAAGGTGG - Intronic
1168630125 19:57949902-57949924 CAGTGCTGGCTGAGGGCAGGAGG + Intergenic
925341808 2:3142982-3143004 CGGCGTTGTCTGTGGGATGGTGG - Intergenic
926119269 2:10232738-10232760 CTGTGTTGTGGGAGAGAAGGTGG + Intergenic
926307382 2:11648277-11648299 CGGTGATATCTGAGTGAAGGAGG + Intergenic
926828451 2:16933742-16933764 CTCTCTTTTCTGAGGGAAAGAGG - Intergenic
927219252 2:20691840-20691862 CTGTGTTTTCTGCAGGAAAGTGG + Intronic
927943196 2:27118658-27118680 CTGTGTACCCTGAGGGCAGGTGG - Intronic
928228390 2:29475327-29475349 CTGTGTTACCTGAGGGGATGTGG - Intronic
929136292 2:38626873-38626895 GTCTGATGTCTGAGGGCAGGAGG + Intergenic
930810089 2:55531079-55531101 CGCTGTTGTCTGTGGGTAGGGGG + Intronic
932500514 2:72179078-72179100 CTGTGTTATCTTAGAGATGGTGG - Exonic
933247117 2:79987971-79987993 CTGTGTGGTTTAAGGGAAGTTGG + Intronic
933771195 2:85745285-85745307 CTTTCTTTTCTGAGGGAATGGGG + Intergenic
933979156 2:87536564-87536586 CTGTGTTCTCCCAGGGAGGGGGG - Intergenic
934036419 2:88092242-88092264 CTGTGCTGTCTCAGAAAAGGGGG - Intronic
934175919 2:89580812-89580834 CTGTGTTGTCCGAGTGGAGGTGG - Intergenic
934286230 2:91655174-91655196 CTGTGTTGTCCGAGTGGAGGTGG - Intergenic
934652083 2:96098575-96098597 CTGTTTTCTCTGAGGGAAGTAGG - Intergenic
934792246 2:97071186-97071208 CTGTGCTGTGTGAGGGAGGTAGG - Intergenic
935525207 2:104157210-104157232 CTCTGATGTCTGAAGGCAGGAGG + Intergenic
936314671 2:111414228-111414250 CTGTGTTCTCCCAGGGAGGGGGG + Intergenic
938392732 2:130917636-130917658 CTGTGTTCACTGGGGGAGGGGGG - Intronic
938678636 2:133665381-133665403 CTGTTGTGTCTCAGGGAAGTGGG + Intergenic
939841830 2:147198597-147198619 CTGTTTTGTCCGTGGCAAGGAGG - Intergenic
940766740 2:157797916-157797938 CTGTGTTGTCTCATGGTAGAAGG - Intronic
941288691 2:163647557-163647579 CTGTGTGATCTGAGGCCAGGTGG - Intronic
942132563 2:172895040-172895062 TTCTGGTGTGTGAGGGAAGGTGG + Intronic
943048732 2:182890296-182890318 CTGGGTTTTCTGAGGGATGCAGG - Intergenic
944710142 2:202328185-202328207 CTTTCTTTTCTGAGAGAAGGTGG - Intergenic
945527989 2:210912697-210912719 CTGTGTTGTCGGAGGGACCCAGG + Intergenic
945922170 2:215766101-215766123 GTGTGTTCTCTGTGGGAAGGAGG - Intergenic
946761201 2:222994923-222994945 CAGGGTTTTCTGAGGGAATGTGG + Intergenic
947136715 2:226983331-226983353 CTGTGTTTTCTGCGGGAATGTGG + Intronic
947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG + Intergenic
948169565 2:235890092-235890114 CTGTGTAGGTTGAGAGAAGGAGG + Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948304353 2:236935636-236935658 CTGTGTTCTCAGAGGAAATGGGG - Intergenic
1171971388 20:31567170-31567192 CTCTGTGGTCTGAGGCAAGTGGG + Intronic
1173519213 20:43686721-43686743 CAGTGTTGCCTGAGGGGATGTGG + Intronic
1173546583 20:43902689-43902711 GTGTGTGGTATGGGGGAAGGAGG - Intergenic
1173952325 20:47003119-47003141 TTGTGGTGTCTGGGGGAGGGTGG + Intronic
1173960955 20:47072171-47072193 CTGTTGTGCCTGTGGGAAGGAGG - Exonic
1175222517 20:57425576-57425598 CTGTGTTGTAAGAGGGTGGGAGG - Intergenic
1175239177 20:57534007-57534029 CTGTGATGTCTGAGAGGAGAAGG - Intergenic
1175652858 20:60742737-60742759 CTTTGTTGACAGCGGGAAGGTGG - Intergenic
1176031414 20:63014812-63014834 CTGTGCTGACTGAGGGCAGGCGG - Intergenic
1177201551 21:17962517-17962539 CTGTGCTGTCTGGGGTAGGGTGG + Intronic
1177983853 21:27948628-27948650 GTGTGTTGTGTGAGGGAGGAGGG - Intergenic
1178451314 21:32704034-32704056 CTCTGTTTTCTAAAGGAAGGTGG - Intronic
1182446588 22:30393242-30393264 CTGTGGTGCCAGGGGGAAGGGGG - Intronic
1182530120 22:30948996-30949018 TTGTTTTGTTTGAGGGAGGGTGG - Intronic
1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG + Intronic
1184207345 22:43013929-43013951 CTTGGGTGCCTGAGGGAAGGTGG - Intronic
1184316689 22:43698724-43698746 CTGAGTTCCCTGAGGAAAGGTGG + Intronic
1184567477 22:45300739-45300761 CTGTGTGATCTGGGGCAAGGAGG + Intergenic
1184666049 22:45989721-45989743 CTGTGTGGTGTGGGGGAAGCAGG - Intergenic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950666610 3:14499354-14499376 TTGTTTTGTCTGTGGGCAGGTGG - Intronic
952198814 3:31103697-31103719 CTGTGTAGAATGAGGGAATGGGG + Intergenic
953591216 3:44256680-44256702 TTGTTTTGTTTGAGGGAAGGGGG + Intronic
954681874 3:52350276-52350298 CTCTGCTGTCTGGGGGTAGGGGG + Intronic
955010873 3:55013071-55013093 CTCTGTAGTCTGTGGAAAGGAGG - Intronic
955949195 3:64225114-64225136 CTGTTTTCCCTGAGGGAATGTGG - Exonic
956712211 3:72048638-72048660 CTCTGCTGTGTGAGGGAAGCAGG + Intergenic
957709011 3:83829255-83829277 CTGTGTGGTCTGTGGCAGGGGGG - Intergenic
958564475 3:95791158-95791180 CTCTGATGTCTGAATGAAGGAGG + Intergenic
959921296 3:111871289-111871311 CTGTGTTGTGTTAGAGAAGAGGG - Intronic
959937348 3:112042969-112042991 CTGTGTAGAATGAGGAAAGGTGG + Intronic
960774643 3:121235948-121235970 CTGTGTTTTTTTAGGGTAGGAGG - Intronic
961518750 3:127455160-127455182 CTGGGTTGCCTGGGGAAAGGGGG - Intergenic
962237431 3:133718460-133718482 CTGTGTTTTCTCTGGGAAGCAGG + Intergenic
962324679 3:134423262-134423284 TTGTGTTGCCTGATGGAAGAGGG + Intergenic
964091830 3:152886310-152886332 CTGTGTTGGAGGAGAGAAGGTGG + Intergenic
964187652 3:153965884-153965906 CTGTGTGGGGTGGGGGAAGGGGG + Intergenic
966708225 3:182941317-182941339 CTTTGATTTCTGAGGGAAAGGGG - Exonic
967041983 3:185702344-185702366 CTTTCTTGTCTAAAGGAAGGAGG - Intronic
967057983 3:185846836-185846858 ATGTCTTTTCTGAGAGAAGGAGG + Intergenic
967997340 3:195176815-195176837 CTGTGCTCTGTGAGGTAAGGAGG - Intronic
968243867 3:197121197-197121219 CTCTGTTGTCTGAGAGTATGTGG - Intronic
968494911 4:910228-910250 CTGTGCTGAGTGAGGGAGGGTGG - Intronic
968516317 4:1017117-1017139 CTGAGTGGCCTGGGGGAAGGGGG - Intronic
968905791 4:3449956-3449978 CTGTGGGGGCTGAGGGAGGGAGG + Intergenic
968940574 4:3635405-3635427 CTGTGTTGACTGAGGATGGGAGG - Intergenic
973857582 4:55028785-55028807 CAGTTATGTCTGAGGGGAGGAGG - Intergenic
975554205 4:75644325-75644347 TTGTGTTCTCTGTGGGAGGGAGG - Exonic
975760319 4:77613663-77613685 CTGGAGTGTCTGAGGAAAGGCGG + Intergenic
977215025 4:94272277-94272299 ATGTATTGTCAGTGGGAAGGAGG + Intronic
977688345 4:99874887-99874909 CTGTTGTGTCTCAGGGAAGGGGG + Intergenic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
978716019 4:111843256-111843278 CTGTGTTGACTGAGTGAATTTGG - Intergenic
982326068 4:154129193-154129215 CTTTCTGGTCTGAGGGCAGGTGG + Intergenic
982536131 4:156608437-156608459 CTGTGTTTTCCTTGGGAAGGTGG - Intergenic
983809872 4:172048462-172048484 CTGTGGTGACTGAGGGAAAATGG - Intronic
983939568 4:173525625-173525647 CTGTGCAGGCTGCGGGAAGGGGG - Intronic
984288826 4:177766902-177766924 GTGTGATGTCTGAGGACAGGAGG + Intronic
985428600 4:189855826-189855848 CTGTGCTGACTTAGGGGAGGAGG + Intergenic
985886816 5:2686478-2686500 CTTTGTTGTCTGTGGGATTGCGG - Intergenic
985938814 5:3117455-3117477 CAATGCTGTCTAAGGGAAGGAGG + Intergenic
986674508 5:10171252-10171274 GTGTCTTGGGTGAGGGAAGGAGG + Intergenic
986845460 5:11747148-11747170 TTGTGTTGTCTGGGGGAACTAGG - Intronic
986968256 5:13301580-13301602 GTGTGTTGGGTGAGGGGAGGTGG + Intergenic
988730484 5:33967942-33967964 CTCTCTTATCTTAGGGAAGGGGG + Intronic
989324671 5:40178179-40178201 CTGTTTTGTCTCAGGGAATAGGG + Intergenic
990091261 5:52052700-52052722 CTGTGTTCTCACATGGAAGGAGG + Intronic
990131693 5:52594466-52594488 CTGTGTTGACTGAGGTCAGTTGG - Intergenic
990816218 5:59788360-59788382 CTTGGCTGTCTGAAGGAAGGAGG + Intronic
991573251 5:68077371-68077393 CTATGCAGACTGAGGGAAGGGGG + Intergenic
992368182 5:76114608-76114630 CTGTCTTTTCTGAGGGAATCAGG - Intronic
995277619 5:110294809-110294831 CTGGGTTGTCTGAGGCATTGGGG + Intronic
995853668 5:116572806-116572828 ATGTGCAGTCTGAGGGAAGCCGG - Intronic
996111226 5:119569068-119569090 CTGTTTTGTCTTAGGCAAGTAGG + Intronic
998227389 5:140337491-140337513 CTGTGCTTTCTCTGGGAAGGAGG + Intronic
998367278 5:141639631-141639653 CTGTGTTCTCTGTGGGCAGGTGG + Exonic
998536427 5:142935740-142935762 CATTGTTGTATGAGGGAAGGAGG + Intronic
998728282 5:145043974-145043996 GTGTGTGGTGTGGGGGAAGGGGG + Intergenic
999187725 5:149725159-149725181 TTGTGTTGAATGAGGGAGGGAGG - Intergenic
999248723 5:150168967-150168989 CTGTGTTCTATGAGAGGAGGTGG + Intronic
999508805 5:152226347-152226369 CTGTCTTGTCTCAGGGTAGGCGG + Intergenic
1000186647 5:158865054-158865076 TTGGGTTGTCTCAGGGAAGGAGG - Intronic
1000527218 5:162372298-162372320 ATTTGTGGTCTTAGGGAAGGAGG + Intergenic
1001868154 5:175123802-175123824 CAGTGTCTTCTGAAGGAAGGAGG + Intergenic
1002059370 5:176617288-176617310 CTGAGTTGTCTGAGGAGGGGAGG - Intergenic
1003215686 6:4108328-4108350 CTGTGTTTTCTGAAGTAAAGGGG - Intronic
1003665976 6:8111685-8111707 CTGTGTTATCTGAGAGCAGTTGG + Intergenic
1006583120 6:35088005-35088027 CTCTGTTCTGTGAGGGAAGAAGG - Intronic
1006751594 6:36381268-36381290 CTGTGGGGTCTGAGGGATGCCGG + Intronic
1007124471 6:39413774-39413796 ATGTGTTGTCTCAGGTAAGTGGG - Intronic
1007760602 6:44131369-44131391 CCATGTGGTCTGAGGGGAGGAGG - Intronic
1007809140 6:44474129-44474151 CTCCGTTGTCAGAGGGATGGTGG + Intergenic
1008498660 6:52157736-52157758 CTGTGTTCTTTGGGGGAAGTAGG - Intergenic
1009508185 6:64512606-64512628 CTGTGTTATTTGAGGAAAGTGGG + Intronic
1010014845 6:71092449-71092471 GTGGGTTGCCTGAGGGACGGTGG + Intergenic
1012289694 6:97437502-97437524 CTGAGGCATCTGAGGGAAGGGGG - Intergenic
1015426001 6:133068146-133068168 GTGGGTTGTCTGAGTGGAGGTGG + Intergenic
1015937451 6:138417509-138417531 CTGTGATCTCTGCGAGAAGGGGG + Exonic
1016548490 6:145250602-145250624 CAGTGTTGTCCCAGGGCAGGTGG + Intergenic
1017096949 6:150812978-150813000 CAGGGGTGTCTGAGGGAAAGTGG + Intronic
1018650269 6:165986926-165986948 CTGTGATGTCATAGGGGAGGAGG - Intergenic
1019436992 7:1027695-1027717 CTTTCTTGCCTGAGGCAAGGCGG - Intronic
1019557442 7:1639799-1639821 CTTTGGTGTCGTAGGGAAGGGGG + Intergenic
1020905831 7:14062988-14063010 CTGTGTGGGGTGAGGGGAGGGGG - Intergenic
1021292715 7:18865608-18865630 CTGTGTTGTGTGAGGCACTGGGG + Intronic
1022147957 7:27565706-27565728 CTGTGTTGTCTGATCTCAGGGGG + Intronic
1022674008 7:32481400-32481422 CTGAGTTGCCTGAGGGAGTGTGG - Intergenic
1026353237 7:69535571-69535593 CTGGCATGTCTCAGGGAAGGTGG - Intergenic
1026646129 7:72170567-72170589 CTCTGTTCTCTGGAGGAAGGTGG - Intronic
1027241192 7:76330353-76330375 TTGTGTGGGCTGGGGGAAGGGGG + Intronic
1027349143 7:77292839-77292861 CATTTTTGTCTGAAGGAAGGAGG - Intronic
1028646035 7:93097646-93097668 CAGTGCTGTCTGAGGGATTGGGG + Intergenic
1029164214 7:98575168-98575190 CTGGGCTGTCAGAGGGCAGGGGG - Intergenic
1030074709 7:105726381-105726403 CTGTGCTGCCTGAGGGATGGGGG - Intronic
1032057952 7:128698509-128698531 CTGGGCTGTCTGTGGGAGGGAGG + Intergenic
1032765923 7:134993511-134993533 CTGTGTAGTCCGGGGGAAGAAGG - Exonic
1033145528 7:138867679-138867701 CTGTGAAGTCTGAGAGAACGGGG + Intronic
1033151309 7:138917040-138917062 CTCTGTGGGCAGAGGGAAGGGGG + Exonic
1033413049 7:141137910-141137932 CCATGTTGTATGATGGAAGGGGG + Intronic
1035080915 7:156215359-156215381 CTGGGGTGGCTGAGGGCAGGAGG - Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035284987 7:157800088-157800110 CTGTGGTGCCTCAGGGATGGAGG - Intronic
1035390574 7:158501599-158501621 CTGTGCTGTCTGGAGGCAGGAGG - Intronic
1035486755 7:159232068-159232090 CTGTGCTGTGTGAAGGCAGGTGG + Intergenic
1038092757 8:24272359-24272381 CAGTGTAGTCAGAAGGAAGGTGG - Intergenic
1039882325 8:41632690-41632712 CTGGGCTGGCGGAGGGAAGGAGG + Intergenic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1042773546 8:72405012-72405034 CTCTCTTGGCTGGGGGAAGGAGG - Intergenic
1045254595 8:100509096-100509118 CTTTGTAGGCTAAGGGAAGGAGG + Intergenic
1046243160 8:111526039-111526061 CTGTGTTGTGTGAGGAGAAGAGG + Intergenic
1046353506 8:113047093-113047115 CTGAGTGGTCTGAGGGAGGCTGG + Intronic
1048344218 8:133565022-133565044 CTGTGTGGCCTTAGGCAAGGGGG + Intronic
1048351236 8:133618380-133618402 CTGTGTTGACTTAGGGAATCAGG + Intergenic
1048815924 8:138333519-138333541 CTCTGTTGTCTAAGGGCCGGGGG + Intronic
1049386796 8:142346977-142346999 CAGTGCTGTCTGGGGGCAGGAGG - Intronic
1049923484 9:387025-387047 CTATGTGGTCTGAGGGATGGAGG + Intronic
1050186351 9:2979119-2979141 CAGTGGTGGCTGAGGGATGGTGG - Intergenic
1050785560 9:9396640-9396662 CAGTCTAGTCTGAGGGAAGGGGG + Intronic
1051254137 9:15194891-15194913 TTGTTTTGTCTGAGGGAATAGGG - Intronic
1051347420 9:16164786-16164808 CTGGGGGCTCTGAGGGAAGGAGG - Intergenic
1052998451 9:34564330-34564352 CTATGTTGTCAGAGGGAATAGGG + Intronic
1053018157 9:34675837-34675859 CTGGGGTGTCAGAGGGAAGTAGG + Intergenic
1053139619 9:35674434-35674456 CTCTGTTCACTCAGGGAAGGAGG + Intronic
1057157492 9:92856091-92856113 CTGTGTTTTCTGAGGTATGTGGG - Intronic
1058283834 9:103151188-103151210 CTGTGTTGTGAGAGGGATGCAGG + Intergenic
1059011310 9:110464623-110464645 CTGTGTAGCCTGAGAGAAGTAGG + Intronic
1059640663 9:116213506-116213528 CAGTGTTGTATGAGGGGATGGGG - Intronic
1060298264 9:122357611-122357633 CTTTGTTGTTGGAAGGAAGGAGG + Intergenic
1185763916 X:2708979-2709001 CTGTGGCCTCTGAGGGCAGGTGG + Intronic
1185894609 X:3846397-3846419 CTGTGAGGTCTGATGGAAGATGG + Intergenic
1185899727 X:3884821-3884843 CTGTGAGGTCTGATGGAAGATGG + Intergenic
1185904843 X:3923250-3923272 CTGTGAGGTCTGATGGAAGATGG + Intergenic
1185931308 X:4206268-4206290 CTGTGATGTCTGTGGGAATATGG + Intergenic
1186507449 X:10104265-10104287 CTTTGGTGTCTGAGGGCAGAAGG + Intronic
1187277355 X:17827830-17827852 CTCTGCAGGCTGAGGGAAGGTGG + Intronic
1187556955 X:20361237-20361259 ATGTGTTATCTAAGGCAAGGGGG + Intergenic
1187571025 X:20502301-20502323 CTGGGTGGGCTGAGGGGAGGTGG - Intergenic
1188246470 X:27841098-27841120 CTGAGGTGTCAGAGGCAAGGTGG - Intergenic
1188844435 X:35056207-35056229 CTGTCATGTCTCAGGGAAGGAGG + Intergenic
1188998561 X:36916672-36916694 CTTATTTGTCTCAGGGAAGGCGG - Intergenic
1190765472 X:53472650-53472672 CTGTGTTGGGTGGGGGAAGCAGG + Intergenic
1191682210 X:63852750-63852772 GTGTGTGGTTTGAGAGAAGGAGG - Intergenic
1192219264 X:69186123-69186145 CAATGTTGTCAGAGGGGAGGAGG + Intergenic
1193198999 X:78665949-78665971 TTGTGTGGTCTGAGGGATGGTGG - Intergenic
1194072044 X:89337950-89337972 CTCTGATGTCTAAGGGAAGAAGG + Intergenic
1196345043 X:114645088-114645110 CTCTATTGTTTGAGGGCAGGGGG + Intronic
1197443204 X:126515018-126515040 CTGTTTGGTCTGAAGTAAGGTGG - Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1199565460 X:149211156-149211178 CTGTGTTTAGTTAGGGAAGGGGG - Intergenic
1200068349 X:153515646-153515668 CTGTGGTGCCTGAGGGCATGGGG + Intergenic
1200685005 Y:6250257-6250279 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1200990535 Y:9341527-9341549 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1200993197 Y:9361844-9361866 CTATGTTGTTTCAGGGAAGAGGG + Intronic
1200995851 Y:9382115-9382137 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1200998515 Y:9402467-9402489 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1201001025 Y:9470997-9471019 CTATGTTGTTTCAGGGAAGAGGG + Intronic
1201003692 Y:9491325-9491347 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1201006348 Y:9511606-9511628 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1201470042 Y:14323042-14323064 CTGTTTTGGCTAAGGGCAGGTGG + Intergenic
1201695112 Y:16816201-16816223 CTGTTTTGGGTGGGGGAAGGGGG + Intergenic