ID: 903928837

View in Genome Browser
Species Human (GRCh38)
Location 1:26850639-26850661
Sequence GGAACTGAGGTCCCTTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903928831_903928837 5 Left 903928831 1:26850611-26850633 CCTTTGTCAGCTAGAGGACACTC 0: 1
1: 0
2: 0
3: 7
4: 94
Right 903928837 1:26850639-26850661 GGAACTGAGGTCCCTTCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 152
903928829_903928837 17 Left 903928829 1:26850599-26850621 CCAGCAAGATATCCTTTGTCAGC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 903928837 1:26850639-26850661 GGAACTGAGGTCCCTTCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903928837 Original CRISPR GGAACTGAGGTCCCTTCACT GGG Intronic
900416243 1:2536043-2536065 GGGACTGAGGCTCCTGCACTGGG + Intergenic
903928837 1:26850639-26850661 GGAACTGAGGTCCCTTCACTGGG + Intronic
904305340 1:29585283-29585305 GGAACTGAGCCTCCTGCACTAGG - Intergenic
904343328 1:29852242-29852264 GGAACTGAGCCTCCTGCACTGGG - Intergenic
905272447 1:36795907-36795929 GGAACTGAGGCCCCTACCATGGG + Exonic
905530065 1:38670914-38670936 GGTACTGAGGTCAGCTCACTTGG + Intergenic
913528333 1:119714142-119714164 AGAAATGAGGACCCTTCAGTGGG - Intronic
914197234 1:145453879-145453901 GCAGCTGCAGTCCCTTCACTGGG - Intergenic
918002223 1:180508671-180508693 GGATCTGTGGGCCCTGCACTTGG + Intergenic
918254774 1:182739424-182739446 GGAACTGATGTTCTTTCAATGGG + Intergenic
919284481 1:195537962-195537984 GAAACTGAGATCACTTCTCTTGG - Intergenic
919594956 1:199549690-199549712 GAAACTGATGTCACTTCAATTGG + Intergenic
919878764 1:201888940-201888962 GGTCCTGCGGTCCCTTCTCTGGG + Exonic
924861482 1:247927988-247928010 GGTACAGATGTCCCTTCAATAGG + Intergenic
1065089621 10:22218898-22218920 GGTACTGAAGACCCATCACTGGG + Intergenic
1066207085 10:33199970-33199992 AGAACTGAGGTACCATGACTTGG - Intronic
1066998144 10:42582344-42582366 TGATCAGAGGTCCCTTCACATGG + Intronic
1067848412 10:49740296-49740318 TGCACTGAGATCCCTTCTCTGGG - Intronic
1072285069 10:93906316-93906338 GGAACTGAGGCCCTGACACTTGG + Intronic
1073179107 10:101573453-101573475 GGAATTCAGATCCCTTGACTGGG + Intronic
1073825680 10:107317783-107317805 GGAACTGACGTCATTTCTCTGGG + Intergenic
1076495493 10:130894743-130894765 GGCACTGAGCTCCCCACACTCGG - Intergenic
1077333092 11:1991908-1991930 GGAAGTGAAGTCCCTTCAACAGG - Intergenic
1081625433 11:44652517-44652539 GGGACTGGGGAGCCTTCACTTGG - Intergenic
1081825972 11:46052078-46052100 GGAACTGGAGTCCCCTCATTAGG - Intronic
1083490868 11:63014506-63014528 GGAACTGAGGACAGGTCACTGGG - Intronic
1083621026 11:64049490-64049512 GAAACTGAGGCCCCTTCCCCAGG + Intronic
1084792564 11:71483817-71483839 GAAACTGTGGTCCATTCACACGG + Intronic
1086056139 11:82649363-82649385 AGAACTGGGGTTCCATCACTTGG - Intergenic
1088739099 11:112752197-112752219 GAAACTGAGGGCCCTCAACTGGG - Intergenic
1089088742 11:115848095-115848117 GGAACTAAAGTCCCTACAGTGGG + Intergenic
1090853868 11:130594818-130594840 GGAGCAGAGGTACCTTCGCTGGG - Intergenic
1202816074 11_KI270721v1_random:47086-47108 GGAAGTGAAGTCCCTTCAACAGG - Intergenic
1091642543 12:2248414-2248436 GGAACCGAGGCCGCCTCACTGGG + Intronic
1092916207 12:13191600-13191622 GGAACCGAGATCCCATTACTCGG + Intergenic
1092969675 12:13680747-13680769 GGAACTGATTTTACTTCACTTGG - Intronic
1094023953 12:25942699-25942721 GGAACAGAAGTTCCTTCCCTGGG + Intergenic
1096876208 12:54632354-54632376 GGACCTGAGATCTCTTCATTAGG + Exonic
1097924517 12:65112683-65112705 GGCCCTGACCTCCCTTCACTGGG + Intronic
1099285632 12:80711188-80711210 GGAACAGAGTTTCCTGCACTTGG + Intergenic
1102211482 12:111130512-111130534 GGAACTGAGGTCACTGAATTTGG - Intronic
1102266272 12:111488545-111488567 GGACCTGAGGTCACTTCCCAAGG - Exonic
1104847554 12:131854258-131854280 AGAACCGAGGTCCCATCACGAGG - Intergenic
1104921306 12:132292097-132292119 GGGACTGAGGTGCCGTCACCGGG - Intronic
1105307384 13:19178653-19178675 GGAGCTTATTTCCCTTCACTGGG - Intronic
1114263509 14:21056965-21056987 GGAGCTGCGATCCCTTCACTAGG + Intronic
1115525637 14:34278170-34278192 GGAACTGTAGTCCCTACACATGG + Intronic
1118664556 14:68053305-68053327 GGAACTTAGATCACTTCATTGGG + Intronic
1118881485 14:69830134-69830156 GTAACTGAGGTCTCATCACCTGG - Intergenic
1121331186 14:93050740-93050762 GTCACTGAGGTCCCGTGACTTGG - Intronic
1128148153 15:65344227-65344249 GGGACTGTGGTGGCTTCACTGGG + Intronic
1128900289 15:71414605-71414627 TGAAATGTGGTCTCTTCACTGGG + Intronic
1129335548 15:74850254-74850276 GGATGGGAGGTCCCTTCTCTAGG + Intronic
1133239771 16:4407585-4407607 GGAACTGCAGTACCTCCACTGGG + Exonic
1133310097 16:4839914-4839936 GGAACGGAGGACACTCCACTGGG + Intronic
1137491119 16:48933560-48933582 GGGACTGAGGCCTTTTCACTGGG + Intergenic
1138256359 16:55566586-55566608 GGAACTCAGGTATCTTCAGTAGG + Intronic
1140457746 16:75114717-75114739 GGACCGGAGGTCCTTTCCCTCGG + Intronic
1140953237 16:79839030-79839052 GGACATGTGGTCCATTCACTCGG + Intergenic
1142522293 17:513707-513729 GGAAATGAGATTCCTTCCCTAGG - Exonic
1142522321 17:513891-513913 GGAAATGAGATTCCTTCGCTAGG - Exonic
1142522333 17:513983-514005 GGAAATGAGATTCCTTCGCTAGG - Exonic
1142522347 17:514075-514097 GGAAATGAGATTCCTTCCCTAGG - Exonic
1142522366 17:514213-514235 GGAAATGGGGTTCCTTCGCTAGG - Exonic
1142522376 17:514259-514281 GGAAATGGGGTTCCTTCCCTAGG - Exonic
1142522386 17:514305-514327 GGAAATGGGGTTCCTTCCCTAGG - Exonic
1142522425 17:514535-514557 GGAAATGGGGTTCCTTCCCTAGG - Exonic
1142522433 17:514581-514603 GGAAATGGGGTTCCTTCTCTAGG - Exonic
1142815031 17:2418656-2418678 GGAACTGCTGTGCCTTAACTTGG - Exonic
1144761419 17:17709637-17709659 GGTCCTGAGCTCCCTTCTCTGGG + Intronic
1148051096 17:44770236-44770258 GGCCCTGAAGTCCCCTCACTTGG + Intronic
1149155066 17:53618935-53618957 GGAGCTGAGATTCTTTCACTTGG - Intergenic
1149188451 17:54030092-54030114 GGAACTCAGGTCTGTCCACTGGG - Intergenic
1150007497 17:61478892-61478914 GCTTCTGAGGTCCCTGCACTGGG - Intronic
1151043858 17:70896207-70896229 TGACCTGATGTCCCTTCAGTCGG - Intergenic
1151551376 17:74824391-74824413 GGATCTGAAGTCCCTGCGCTGGG - Intronic
1157527005 18:48391206-48391228 GGAGAGGATGTCCCTTCACTTGG - Intronic
1157611444 18:48958918-48958940 GAAAGTGAGGTCCCTGCAGTGGG + Intergenic
1158738974 18:60117359-60117381 GGATTTGATATCCCTTCACTTGG - Intergenic
1161662399 19:5554993-5555015 GGCCCTGAGGTCCCCTGACTTGG - Intergenic
1161737352 19:5999645-5999667 AGAAGTGAGGTCCCGGCACTCGG + Intronic
1163059200 19:14746137-14746159 GCCACTGAGGTCCCTTCTCAGGG - Intronic
1163325979 19:16603577-16603599 GGGGCTGAGGTCCCTTCCCCAGG - Intronic
925864414 2:8213940-8213962 GCAACTGCAGTCCCTTCACTAGG - Intergenic
930018387 2:46986334-46986356 GGAACTGAGGGCCTTTCTCTGGG - Intronic
934035523 2:88085773-88085795 GAAACTGAGGTGTCTTCACAGGG - Intronic
936859569 2:117001240-117001262 GGTACTGGGGTCGTTTCACTGGG + Intergenic
937086620 2:119176041-119176063 GTACCTTAGGTCCCTTCTCTGGG + Intergenic
937314358 2:120921589-120921611 GGAAATTATGTCCCTTCTCTGGG - Intronic
938087883 2:128413252-128413274 GGAACTGAGGTCCCTTGGGCAGG + Intergenic
942843547 2:180395169-180395191 AGAAATCAGGTCTCTTCACTAGG + Intergenic
944034202 2:195273830-195273852 GGGACTGAAGTCAATTCACTGGG + Intergenic
944745028 2:202646461-202646483 GATACTGAGGTCTCTTCCCTGGG - Intronic
948875843 2:240827491-240827513 GGAACAGAGGCTCCTGCACTCGG + Intergenic
1168860184 20:1040667-1040689 GGTACTGAGTTCCCATCACAAGG + Intergenic
1172270063 20:33650061-33650083 GGAAAGGTGGTCCCTACACTAGG + Intergenic
1178629260 21:34244732-34244754 GCAGATCAGGTCCCTTCACTGGG + Intergenic
1181058263 22:20269898-20269920 GGAACTGAGCTCTCTCCACAGGG + Intronic
1183625596 22:38999587-38999609 GGAAATGAGGACCCTGCACCGGG + Intergenic
952837941 3:37620307-37620329 GGCACTGAGGTCCCGTGACCTGG + Intronic
952956492 3:38560968-38560990 GGATCTGAGAGCCCCTCACTGGG - Intronic
959081081 3:101801709-101801731 AGAACTCTGATCCCTTCACTGGG - Exonic
960384869 3:117010523-117010545 GGAACTGAGTTCTTTTCAGTGGG + Intronic
960399074 3:117173796-117173818 TGAACTCAAGTCCCTTCACTTGG - Intergenic
962328159 3:134453276-134453298 GGCACTGAGATTCATTCACTGGG - Intergenic
962841980 3:139241777-139241799 GCAACTGAGGTCCCTTCACCAGG - Intronic
963056271 3:141188632-141188654 GAAATTGCGGGCCCTTCACTGGG - Intergenic
963989789 3:151639868-151639890 GGAATTGTGGTTCCTTCCCTAGG + Intergenic
967197510 3:187041330-187041352 GGGTCTGAGGTCCCTTCCCATGG - Intronic
969310163 4:6348287-6348309 GGAACTGATGCACCCTCACTGGG - Intronic
970692017 4:18630861-18630883 GGCTCTGAGGGCCCTACACTCGG - Intergenic
972694252 4:41429363-41429385 AGAAATGAGTACCCTTCACTCGG - Intronic
981561314 4:146051237-146051259 AGAACTGAGGACCTTACACTTGG + Intergenic
983136029 4:164081646-164081668 GTAGCTAAGGTCCCTTAACTTGG + Intronic
984047992 4:174826483-174826505 TGAACTGTAGTCTCTTCACTTGG + Intronic
985733360 5:1563828-1563850 GGACCTGAGGACCCTCCACAAGG - Intergenic
987185325 5:15411594-15411616 CTAACTGAGGTTCCTTCTCTTGG + Intergenic
989114402 5:37938535-37938557 AGACCTGAGGTTCCTTCATTGGG - Intergenic
989645742 5:43630870-43630892 GAAAGTGAGGCTCCTTCACTAGG - Intronic
992358838 5:76014927-76014949 TTAACTGTGGTCCCTTAACTAGG - Intergenic
999192209 5:149756810-149756832 TGATCTGAGGTTCCTTGACTAGG + Intronic
1001567902 5:172712477-172712499 GTAACAGAGGTCCCTTCATAGGG - Intergenic
1002470932 5:179435802-179435824 GGGCCTGAGTTCCCTTCACCTGG + Intergenic
1003762749 6:9198839-9198861 TGAACTGAGGCCCCCTGACTAGG - Intergenic
1006387459 6:33739301-33739323 GAAACTGAGGCCCTTTCTCTTGG + Intronic
1006789529 6:36690466-36690488 AGCACTGAGCTCCTTTCACTAGG + Intergenic
1007688322 6:43680712-43680734 GGAACTGAGGTCCAGGCTCTTGG + Intronic
1009831735 6:68946307-68946329 TGAACTCAGGCACCTTCACTGGG + Intronic
1016872991 6:148837479-148837501 GTAGCTGAAGTTCCTTCACTTGG + Intronic
1019555972 7:1631587-1631609 GGAACTGAGATCCCATCATAGGG + Intergenic
1022535120 7:31093721-31093743 GGAGCTGAGGTATCTTCACTGGG + Intronic
1023837033 7:44074330-44074352 CCGACTCAGGTCCCTTCACTGGG + Intronic
1024294890 7:47833888-47833910 GGAACGGAGCTCCCAGCACTGGG + Intronic
1024547858 7:50537630-50537652 GGAACTGAGTGCCCTGCCCTGGG + Intronic
1026073899 7:67148388-67148410 GGAACTAAGGTCACTTAACAAGG + Intronic
1026702984 7:72663801-72663823 GGAACTAAGGTCACTTAACAAGG - Intronic
1029064531 7:97836239-97836261 TGAACTAAGCTCCCTGCACTAGG + Intergenic
1030715907 7:112806560-112806582 GGAAATGAGGGCCCTTAATTAGG - Intergenic
1039116083 8:34092663-34092685 TGAACTGGGGTCCGCTCACTTGG + Intergenic
1042738166 8:72012169-72012191 GGATCTCAGGTCCCTGCCCTAGG - Intronic
1045339138 8:101236174-101236196 GGAACTTAGTTCCAATCACTAGG - Intergenic
1045348831 8:101319255-101319277 GGAACAGAGATTCCTTAACTTGG - Intergenic
1046648444 8:116810839-116810861 GGAAATGAGGTCCCATCTCGGGG + Intronic
1047795239 8:128248506-128248528 GGAACTGAGTCTCCTTCAATTGG - Intergenic
1048957933 8:139552266-139552288 GGAAGTGAGGCACCTTCACAAGG + Intergenic
1049152832 8:141046513-141046535 GGGACTGAGTTCCCTTCCCTTGG - Intergenic
1049429363 8:142552085-142552107 TACACTGAGGTCCCTTCTCTGGG - Intergenic
1050071295 9:1817391-1817413 GGAACTGAGCTTCCTACTCTAGG - Intergenic
1051262206 9:15275619-15275641 TGAAGTGAGGTCCCTTTACCTGG - Intronic
1053020635 9:34691610-34691632 GGAACTGTGCTCCCTTCCTTAGG + Intergenic
1053471096 9:38346604-38346626 GGTCATGTGGTCCCTTCACTTGG + Intergenic
1060224924 9:121784838-121784860 GCCACTGGGGTGCCTTCACTGGG + Exonic
1061470417 9:130820700-130820722 GGAACTGAGCAGCCCTCACTGGG + Intronic
1185843625 X:3416661-3416683 GGAGCTGAGGCCTCTCCACTTGG - Intergenic
1186366713 X:8902755-8902777 GGAACTGAGATGCATTTACTTGG - Intergenic
1186511324 X:10132021-10132043 GGAACTGGGGTCCATTCGCCCGG + Intronic
1190640358 X:52478316-52478338 GGGACTGATGTCCTTCCACTCGG + Intergenic
1190647314 X:52534549-52534571 GGGACTGATGTCCTTCCACTCGG - Intergenic
1199966531 X:152825004-152825026 GTAACTGAGGTCAGTTCACGTGG - Intergenic
1201433771 Y:13933662-13933684 TGAACTGGGGTCCCTTCAGATGG - Intergenic