ID: 903929860

View in Genome Browser
Species Human (GRCh38)
Location 1:26855963-26855985
Sequence CTGAGGCAGGGGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1532
Summary {0: 1, 1: 0, 2: 6, 3: 128, 4: 1397}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903929860 Original CRISPR CTGAGGCAGGGGAAGGTGGA GGG (reversed) Exonic
900000660 1:13141-13163 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900020377 1:183660-183682 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900104066 1:974747-974769 CTGGGGCAGGGAAGGGTGGGAGG + Exonic
900422116 1:2560164-2560186 TGGAGGCAGGGGAAGGGGCAAGG + Intronic
900432441 1:2609291-2609313 CCGAGGCAGGGGACGGGGGCGGG - Intronic
900575818 1:3382019-3382041 CTGTGGCAGAGGAAGATGGCAGG + Intronic
900599453 1:3496876-3496898 CTGAGGGGGTGGAAGATGGAGGG - Intronic
900884756 1:5407147-5407169 CAGAGGCATGGGAACGTAGAAGG - Intergenic
901040315 1:6359469-6359491 CTGAAGCAGGGGTTGGGGGAAGG - Intronic
901057504 1:6455478-6455500 CTGAGGCAGCGGCAGGCGGTGGG + Intronic
901130411 1:6959301-6959323 GGGAGGCTGGGGCAGGTGGAGGG + Intronic
901263109 1:7888321-7888343 CTGAGGGATGGGGAGGAGGAAGG - Intergenic
901740987 1:11341773-11341795 CTGAGGCAGGTGAGTGTGGTTGG + Intergenic
901757697 1:11451272-11451294 CTGGGGCTGGGGAAGCGGGAGGG + Intergenic
901932044 1:12602183-12602205 CTTGTGCAGGGGAAGTTGGATGG + Intronic
902234776 1:15050420-15050442 CTGAGGCAGGAAAAGGTTAAAGG - Intronic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902374948 1:16026280-16026302 CTGGGGCAGGGTAGGGTGGGCGG - Intronic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
902403566 1:16171360-16171382 CTGAGGCATGGGGAAGTGAAGGG + Intergenic
902692468 1:18118386-18118408 CAGAGGCTGGGGCAGCTGGAGGG + Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902814395 1:18907960-18907982 CTGAAGGAGAGAAAGGTGGAAGG - Exonic
902876212 1:19342379-19342401 CTGAAGCATGGGGGGGTGGACGG + Intronic
903139497 1:21330730-21330752 CTGAGTCAGGGGGAGGAAGAAGG - Intronic
903140271 1:21335075-21335097 CAGAGGCAGTGGAGGGTGGAGGG - Intronic
903184851 1:21623081-21623103 GTGAGGCATGGGAAGCAGGATGG - Intronic
903204865 1:21773892-21773914 CTTTGGGAGGGCAAGGTGGAAGG + Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903557859 1:24206398-24206420 CTGGGGCTGGGGAAGGGAGAGGG - Intergenic
903750686 1:25618406-25618428 CTGAGGCAAGGGAAAGGGGTGGG - Intronic
903894562 1:26595415-26595437 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
903934091 1:26882872-26882894 CTGAGGCAGGAAAAGGAGGAGGG - Intronic
903959885 1:27050227-27050249 CAGATACAGGAGAAGGTGGAGGG + Intergenic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904144556 1:28379515-28379537 CTCTGGCAGGCCAAGGTGGATGG - Intronic
904155294 1:28478053-28478075 CAGAGGCAGGGAAGGGTAGAGGG - Intronic
904231855 1:29080626-29080648 GGGAGGCTGGGGAGGGTGGATGG - Intronic
904497094 1:30893144-30893166 CTGAGGGTGGGGAAGGTGCAGGG + Intronic
904609364 1:31716589-31716611 CTGAGGGAGGTGGAGCTGGATGG - Intergenic
904771935 1:32885790-32885812 CAGAGGCTGGGGAGGGAGGAAGG + Intergenic
904857479 1:33510046-33510068 CTGAGGCAGGGGAATCAGGCAGG + Intergenic
904921152 1:34009348-34009370 CGGGGGTGGGGGAAGGTGGAAGG + Intronic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905274383 1:36807544-36807566 CTGGGGCATGGGCAGGGGGATGG + Intronic
905295695 1:36953188-36953210 ATGAGGCAGGGGCAGGGGGAGGG - Intronic
905322854 1:37130171-37130193 CTGGGGTGGGGGAAGGGGGATGG - Intergenic
905547098 1:38808508-38808530 CTGAGGCAGAGGAAGTGGAAGGG + Intergenic
905743251 1:40390548-40390570 TTGAGGAAGGGGAGTGTGGATGG + Intronic
905786542 1:40762495-40762517 CTGGGGCAGGTGAATTTGGAGGG - Intronic
906256912 1:44357401-44357423 CTTTGGCAGGCCAAGGTGGAAGG + Intergenic
906528255 1:46508912-46508934 CTGGGGCAGGGGAAGGAGTGGGG - Intronic
907052800 1:51341070-51341092 CTGAGGCAGGAGAACCTGGAAGG + Intronic
907124387 1:52036497-52036519 CAGAGGCAGAAGAGGGTGGAAGG + Intronic
907159476 1:52360080-52360102 CCAAGGCAGGGGGAGCTGGAGGG + Exonic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907766117 1:57412212-57412234 CAGAGGAAGGGGAAAGTAGACGG - Intronic
907834082 1:58092818-58092840 CTGAGGAATGGCACGGTGGATGG - Intronic
907897008 1:58701481-58701503 CTAAGGCAGGGGAATGCAGAAGG - Intergenic
907908683 1:58808426-58808448 AAGAGGCAGGGGAAGGAGGGCGG + Intergenic
907909005 1:58810829-58810851 CTGGGGCAGGGGAAGAGGAAGGG - Intergenic
908199601 1:61780604-61780626 CTAAGGCAGAGGCAGGAGGAGGG - Intronic
908330976 1:63070932-63070954 CTTAGGGAGGCCAAGGTGGAGGG - Intergenic
908771975 1:67605780-67605802 CTGAGGCAGAGGAAACTGGAGGG + Intergenic
909048929 1:70745413-70745435 CTGGGGTTGGGGGAGGTGGAGGG + Intergenic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
910457539 1:87413535-87413557 CTGCGGCTGGGCATGGTGGAAGG - Intergenic
910880665 1:91919791-91919813 CTGAGGAAGGGAAAGGTGGTTGG - Intergenic
911109082 1:94164048-94164070 TTGAGGAAGAGGAATGTGGATGG - Intronic
911694242 1:100870529-100870551 ATGAGGGAGGGGAAGAAGGAGGG + Intergenic
911748563 1:101468612-101468634 CTGAGGAATGGGAAGGGGAAGGG + Intergenic
911778218 1:101842292-101842314 GGGAGGCTGGGGCAGGTGGATGG + Intronic
911884309 1:103278327-103278349 CTGAGGCAGGGGAATCCGGGAGG - Intergenic
912401271 1:109395829-109395851 CTGTGGCAGGCTAAGGTGGGTGG + Intronic
913017464 1:114753672-114753694 CTGTGGCAGGCCAAGGTGGGAGG + Intronic
913137925 1:115910818-115910840 ATGAGGCTGGGGGAAGTGGATGG - Intergenic
913286608 1:117232484-117232506 CTGAGGCACAGAAAGGTGAAGGG - Intergenic
913586234 1:120278059-120278081 CCGAGGCAGGGGCAGGGGCAGGG + Intergenic
913621952 1:120620310-120620332 CCGAGGCAGGGGCAGGGGCAGGG - Intergenic
913665895 1:121048700-121048722 CTGAGGCAGGTGAGGGGGCAAGG - Intergenic
913688542 1:121256815-121256837 TTCAGTCAGGGGAAGGTGGGGGG + Intronic
913975082 1:143449632-143449654 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
914017293 1:143831976-143831998 CTGAGGCAGGTGAGGGGGCAAGG - Intergenic
914040398 1:144044458-144044480 TTCAGTCAGGGGAAGGTGGGGGG + Intergenic
914069474 1:144275248-144275270 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
914109681 1:144691106-144691128 CTGACGCAGGGGAAGCCGGCCGG - Intergenic
914149058 1:145023462-145023484 TTCAGTCAGGGGAAGGTGGGGGG - Intronic
914412475 1:147444265-147444287 GTGAGGTAGGGGAAGGAGGGAGG + Intergenic
914568243 1:148889917-148889939 CCGAGGCAGGGGCAGGGGCAGGG + Intronic
914604582 1:149240332-149240354 CCGAGGCAGGGGCAGGGGCAGGG - Intergenic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
915208239 1:154287016-154287038 CTGAGGCAGGAGAATCAGGAAGG - Intergenic
915247223 1:154565039-154565061 GGGAGGCTGGGGCAGGTGGATGG - Intergenic
915476583 1:156156178-156156200 CAGAGGCAGGGTAATGGGGACGG - Intronic
915622977 1:157097530-157097552 CTGGGGCAGGTGAAGGAGGTGGG - Intronic
915930926 1:160060638-160060660 CTGGGGCCTGGGAGGGTGGATGG - Intronic
916046679 1:161005282-161005304 GGGAGGGAGGGGAAGGAGGAAGG - Intronic
916328717 1:163592287-163592309 CTAAGGGAGAAGAAGGTGGAAGG - Intergenic
916713316 1:167431108-167431130 CAGGGGCATGGGAAGGTGGGCGG - Exonic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
916863975 1:168836748-168836770 GAGAGGGAGGGGAAGGGGGAGGG - Intergenic
916874907 1:168958790-168958812 TTGAGATAGGGGAAGGAGGAGGG - Intergenic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
917452884 1:175161855-175161877 ATGAGGAAGAGGAAGGTAGAAGG - Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917595985 1:176529532-176529554 CTGGGGCAAGGGGAGGAGGAGGG + Intronic
917754803 1:178088431-178088453 AGGTGGCAGGGGAAGGAGGACGG + Intergenic
917838729 1:178960734-178960756 CTGAGGGAGGGGTGGGTGGCAGG - Intergenic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
918138863 1:181703035-181703057 GAGAGGCAGAGGAAGGAGGATGG - Intronic
918143418 1:181736487-181736509 GTGAGGCAGGGCAGGGTGAAGGG + Intronic
919157295 1:193782584-193782606 CAGAGGCTGGGGAGGGTAGAGGG + Intergenic
919640224 1:200039230-200039252 CTGAGCCAGAGGGCGGTGGAGGG + Intronic
919758754 1:201083323-201083345 CTGAGGGAGGGGACAGAGGATGG + Intronic
919804956 1:201376008-201376030 CTGATGCAGGGGAAAGAGGTGGG + Intronic
919967146 1:202539214-202539236 CTGAGGCAGGGGACACTGGAAGG + Intronic
920093180 1:203468720-203468742 CTGAGGAAGAGTCAGGTGGAGGG + Intergenic
920162720 1:204011654-204011676 CTGAGGCAGGGGGAGCAGGAGGG + Intergenic
920347966 1:205318839-205318861 CTGAGGGAAGGGCAGGTGGGCGG - Intronic
920475864 1:206275314-206275336 TTCAGTCAGGGGAAGGTGGGGGG + Intronic
920536072 1:206737339-206737361 GTGAGGCTGGGGAAAGTGGCTGG + Intergenic
920569898 1:207008646-207008668 CTGAGGCAAAGGAAGGGGGCTGG + Intronic
920677415 1:208047968-208047990 ATGAGGCATGGGGAGGTTGAGGG + Intronic
921023849 1:211259766-211259788 CTGGGGGAGGGGAAGAGGGAGGG - Intronic
921148510 1:212381644-212381666 CCCAGGCCTGGGAAGGTGGAGGG - Intronic
921238576 1:213153300-213153322 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
921262296 1:213395034-213395056 CTGCGGCAGGGGAAGGAGGGTGG - Intergenic
922025715 1:221746668-221746690 CTGAGACTGGGGAAGTTGTAAGG - Intergenic
922239767 1:223748068-223748090 CAGATGGAGGGGAAGGTGGCAGG - Intronic
922303639 1:224325326-224325348 CTTAGGGAGGCGAAGGTGGAAGG + Intronic
922462339 1:225823472-225823494 CTGAGTCTGGGGAAGCTTGATGG - Intronic
922819766 1:228476264-228476286 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
922821616 1:228488633-228488655 CTCAGGCAGGGCAGGGTGTAGGG + Intronic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
923514189 1:234680855-234680877 CTGAGGAAGTGAAAGATGGAGGG + Intergenic
923660971 1:235957068-235957090 CTTAGGGAGGGGACAGTGGAGGG - Intergenic
923687006 1:236160477-236160499 AGGAGGCAGGGAAGGGTGGAGGG - Intronic
923712141 1:236395910-236395932 CTGCGGCATGGGCAGGGGGAAGG - Intronic
924250516 1:242128406-242128428 CTGAGGCTGGGGCAGATGAAAGG + Intronic
924315643 1:242792606-242792628 ATTAGGGAGCGGAAGGTGGAAGG - Intergenic
924405376 1:243739731-243739753 CTGAGGCTGGAAAAGGAGGAGGG - Intronic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
924530656 1:244891109-244891131 GTGAGGCTGTGGCAGGTGGAGGG - Intergenic
924680212 1:246223315-246223337 CTGATGAAGGGGATGGTGGTAGG + Intronic
924857323 1:247886783-247886805 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1062784894 10:256190-256212 GTGAGGCAGGGGAAGGTGATGGG - Intergenic
1062813331 10:481675-481697 CTGAGGCAGTGGAAGGTCTCCGG + Intronic
1063039766 10:2325225-2325247 AGCAGGCAGAGGAAGGTGGACGG + Intergenic
1063103592 10:2973332-2973354 CTGAGGCAGGGGCAAGGGGGAGG + Intergenic
1063245747 10:4216454-4216476 CTTAGGAAGGGGAAGAAGGATGG + Intergenic
1063337399 10:5229176-5229198 CTGAGGCAGGTCCAGGTGAAGGG + Intergenic
1063367509 10:5500026-5500048 CTGAGGCTGGGGCTGGTGGAAGG + Intergenic
1063579528 10:7293195-7293217 CTGAGGCTGGAGATGGTGGTGGG - Intronic
1063790978 10:9447521-9447543 GAGAGGAAGGGGAAGGGGGAAGG - Intergenic
1063960576 10:11302224-11302246 CTGAGGCATGAGAAGGTGAGAGG - Intronic
1064203377 10:13302421-13302443 CTGGGGCGGGTGCAGGTGGAGGG + Intergenic
1064587305 10:16851940-16851962 TTGAGGGAGGGAAAGATGGAGGG - Intronic
1064587358 10:16852127-16852149 GTGAGGGAGGGAAAGATGGAGGG - Intronic
1064587396 10:16852267-16852289 GTGAGGAAGGGAAAGATGGAGGG - Intronic
1064587430 10:16852399-16852421 GTGAGGGAGGGAAAGATGGAGGG - Intronic
1064624747 10:17251045-17251067 CTGGGGTAGAGGCAGGTGGATGG - Intergenic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1064772206 10:18735080-18735102 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1065611537 10:27476001-27476023 CTGAGGCAGGCCCAGGTGGGTGG + Intergenic
1065679826 10:28217684-28217706 ATGAGGCAGGGGAAGGGAAAAGG + Intronic
1065696828 10:28388114-28388136 GGAAGGGAGGGGAAGGTGGAAGG + Intergenic
1065877198 10:30007745-30007767 CTGGGGCAGGGGCAGCTGGTGGG - Intergenic
1066248008 10:33603316-33603338 GAGAGGCAGGAGAAGGAGGAAGG + Intergenic
1066265049 10:33768665-33768687 CTGTGGGAGGCCAAGGTGGACGG + Intergenic
1066397587 10:35041249-35041271 CTGAGAGAGGTGAAGGAGGATGG + Intronic
1066407551 10:35133395-35133417 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1066746456 10:38606480-38606502 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1067062463 10:43084847-43084869 TGGAGGAAGGGGAAGGTGCAAGG + Intronic
1067101747 10:43339230-43339252 CCGAGGCAGGGCCACGTGGAGGG + Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067229728 10:44397720-44397742 CTGGGGCAGGGAATGGGGGAGGG + Intergenic
1067338731 10:45384112-45384134 CTGATGCAGGGGGAGGGGGAAGG + Intronic
1067713622 10:48670788-48670810 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1067777506 10:49174244-49174266 CTGAGGCAGGGGCAGGGGCAGGG - Intronic
1067803577 10:49377245-49377267 CTGGGGCAGAGGTAGGTGGAAGG + Intronic
1067852683 10:49764320-49764342 GTGAGGTTGGGGCAGGTGGAAGG - Intergenic
1068175602 10:53453424-53453446 CTGAGGCAGGGCAGAGTGAAAGG + Intergenic
1068353273 10:55878193-55878215 CTTTGGCAGGCCAAGGTGGAGGG + Intergenic
1069595764 10:69669048-69669070 CTGAGGCTGGGGATGGGGGTGGG + Intergenic
1069796548 10:71056304-71056326 TTGATGGTGGGGAAGGTGGAAGG + Intergenic
1070442850 10:76463639-76463661 CGGTGGCAGGGGAGGGGGGAAGG + Intronic
1070567590 10:77615424-77615446 CTGAGGCTGCAGAAGGTGGGTGG + Intronic
1070675088 10:78406736-78406758 GTGAGGCCGGGGAAACTGGATGG + Intergenic
1070784194 10:79153702-79153724 CTGAGGCAGAGAGAGGTGCAGGG + Intronic
1070838495 10:79467043-79467065 CAGGGGCTGGGGAGGGTGGAGGG + Intergenic
1072088990 10:92108435-92108457 ATGAGGCAGGGGGTGGTGGTGGG + Intronic
1072211930 10:93254215-93254237 CTGAGGCAGAGGTTGGTGGGAGG - Intergenic
1072686445 10:97540046-97540068 CTGAGGAAGGGGGAGGGGCATGG + Intronic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1072955226 10:99882203-99882225 CAGAGGCTGGGGGTGGTGGAAGG + Intronic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073343929 10:102767685-102767707 CAGAGGTTGGGGGAGGTGGAAGG - Intronic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074473443 10:113747870-113747892 GGGAGGCAGGGGACGATGGAGGG + Intergenic
1074813600 10:117127968-117127990 CTGAGGAAGGGGAACGTGATTGG - Intergenic
1074819644 10:117168507-117168529 CTGCTGCTGGGGAACGTGGAGGG - Intergenic
1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG + Intergenic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1075011559 10:118874733-118874755 CTGAAACAGGGGAATGTGGATGG + Intergenic
1075237694 10:120745898-120745920 ATAAGGGAGGGGAAGGGGGAAGG - Intergenic
1075269069 10:121033278-121033300 CTGAGGCAGGGGTTAGGGGATGG + Intergenic
1075544299 10:123342883-123342905 AGGAGGCAGGGGAATTTGGAGGG + Intergenic
1075565464 10:123500481-123500503 CAGAAGCAGAGGAAGGAGGAAGG - Intergenic
1075724585 10:124604881-124604903 CAGGGGCAGGGGAAGGGGCAGGG - Intronic
1075808805 10:125209387-125209409 CTGAGCTAGAGGAATGTGGAAGG - Intergenic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076599504 10:131647790-131647812 TTGAGGCAGAGGAAGGGAGACGG - Intergenic
1076934101 10:133555958-133555980 GTGAGACCAGGGAAGGTGGATGG - Intronic
1077019102 11:409654-409676 CTGGGGCAGGAGAGGGTGCAGGG + Intronic
1077114915 11:879788-879810 CTGAGGCAGGGCTGGGTGCATGG + Intronic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077294250 11:1817156-1817178 CAGGGGCTGGGGGAGGTGGAGGG + Intergenic
1077513594 11:2986714-2986736 CTGAGGCAGGAGAAACTGGGAGG - Intronic
1077670147 11:4149998-4150020 TTGAGGCTGGGGAAGGTAGGGGG + Intergenic
1077806591 11:5596547-5596569 ATGGGGGAGGGGAAGGGGGAAGG - Intronic
1077874677 11:6294111-6294133 CAGGGGCAGGGGAAGGGGCAGGG + Intergenic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078258606 11:9683157-9683179 GTGAGGCTGAGGCAGGTGGATGG + Intronic
1078858478 11:15225904-15225926 CTGAGGCAGGGGAGAGAGCATGG + Intronic
1079025999 11:16948162-16948184 CAGAGGCTGGGGTGGGTGGAGGG + Intronic
1079130012 11:17741791-17741813 CTGAGGCAGGGGAACCTGGCAGG - Intronic
1079175708 11:18138098-18138120 CTGAGGTGGATGAAGGTGGAGGG + Exonic
1079181455 11:18197275-18197297 CTGAGGTGGATGAAGGTGGAGGG + Intronic
1079201951 11:18384051-18384073 GTGAGGCAGGGGCAGGTGTCAGG + Intergenic
1079263760 11:18910482-18910504 CTGAGGTGGATGAAGGTGGATGG - Intergenic
1079265999 11:18933867-18933889 CTGAGGTGGATGAAGGTGGAGGG - Exonic
1079360314 11:19765451-19765473 CAGAGGGAGGGGAAGGGGAAGGG - Intronic
1080121605 11:28684435-28684457 CCAAGGGAGGGGATGGTGGAGGG + Intergenic
1080422295 11:32121269-32121291 ATGAGGCAGGAGCAGGTGGCTGG + Intergenic
1080694862 11:34594693-34594715 CTGAGGCAGGGGTAGGGGTAGGG - Intergenic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1081385147 11:42463327-42463349 GGGAGGGAGGGGAAGGTGGAAGG + Intergenic
1081497700 11:43632005-43632027 GTGAGGGAGGGGGAGGAGGAGGG + Intronic
1081623763 11:44634722-44634744 GGGAGGGAGGGGAAGGAGGAGGG - Intergenic
1081710565 11:45212974-45212996 CTGATGCTGGGGAAGCTGGTGGG - Intronic
1081928643 11:46852115-46852137 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1083112950 11:60429859-60429881 CTGAGGCAGGGGAAAGGCTAGGG + Intronic
1083120631 11:60509626-60509648 ATGAGGGAGGGGGAGGGGGAGGG - Intergenic
1083208643 11:61168698-61168720 CTGATGCAGGGGAAGGAGATGGG - Intergenic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083593746 11:63909479-63909501 CAAAGGAAGGGGAGGGTGGATGG + Exonic
1083618546 11:64037831-64037853 CTGAGGCACAGGGAGGTGGAGGG - Intronic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083845250 11:65328099-65328121 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084178886 11:67437010-67437032 CTGAGGCCTGGGATGGGGGATGG + Intronic
1084194462 11:67516557-67516579 CTGAGGCCTGGGGAGGTGGTGGG + Intergenic
1084203003 11:67574661-67574683 CTTAGGGAGGCCAAGGTGGATGG - Intergenic
1084557364 11:69883080-69883102 CGGAGGCAGGGGCTGGTGGGAGG - Intergenic
1084971379 11:72774094-72774116 CAGGGGCAGGAGATGGTGGAGGG + Intronic
1085073579 11:73571342-73571364 CTGAGGCAGGGGAATCAGGCAGG - Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085219154 11:74859009-74859031 CTCAGGGTGGGGAAAGTGGAAGG - Intronic
1085527047 11:77170364-77170386 CTCAGGCAGGGCAAGGAGGCTGG + Intronic
1085638225 11:78174339-78174361 CTCAGGCAGGTCAAGGTGGGAGG + Exonic
1085765306 11:79276909-79276931 CTGAGGCAGCAGAAGTTGGGGGG - Intronic
1086193462 11:84108631-84108653 CTGAGGCAAGAGAAGGTAGCAGG + Intronic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1086365852 11:86109761-86109783 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087153936 11:94883047-94883069 CACAGGCAGGGTAAGGTGCAGGG - Intergenic
1087487170 11:98770779-98770801 AAGAGGGAGGGGAAGGGGGAGGG + Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1088194090 11:107256919-107256941 CCGAGGCGGGGCAAGGTGGGTGG + Intergenic
1088913942 11:114212800-114212822 CCGAGGCAGGCGATGGGGGATGG - Intronic
1088928759 11:114328071-114328093 CTGAGGGTGGGGAAGGAGGTTGG - Intergenic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089016067 11:115166460-115166482 ATGGGGCTGGGGAAGGAGGAGGG + Intergenic
1089151987 11:116371491-116371513 CAGAGGCAGGGGATGGGGGCAGG + Intergenic
1089163521 11:116457672-116457694 CTGAGGAAGGGGAAGAGGCAGGG + Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089447539 11:118565502-118565524 CTGAGGCGGGGTAGGGTGGGAGG + Intronic
1089540014 11:119184128-119184150 CAGAGGCAGTGGAGGCTGGAAGG + Intergenic
1090114079 11:123947665-123947687 GTAAGGGAGGGGAAGGTTGAAGG + Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090138230 11:124223212-124223234 CAGAGCCAGTGGAAGGTGGGAGG - Intergenic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090464748 11:126924180-126924202 CTGAGCCAGGGAAAGGGGGAAGG - Intronic
1090705145 11:129329530-129329552 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1090789004 11:130073740-130073762 CTGAGGCAGGAGAATCTGGGAGG + Intronic
1091073550 11:132592312-132592334 CTGAGGGAGGGGCATATGGAGGG + Intronic
1091079974 11:132657325-132657347 GTGAGGCAGGGAGTGGTGGAGGG + Intronic
1091454688 12:598345-598367 CAGAGGGAGGGCAAGGAGGAGGG - Intronic
1091583236 12:1801159-1801181 CTGAGGCAGGGGCAGGGGGTGGG - Intronic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1091703042 12:2676615-2676637 CGGAGGGAGGGGCTGGTGGAAGG - Intronic
1091768475 12:3137057-3137079 CTGAGGCAGGGGACTGCGGCCGG + Intronic
1091787977 12:3254425-3254447 CTGACCCAGGGGAAGGGGCAAGG - Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092261787 12:6956796-6956818 GTGGGGCAGGGGTAGGAGGAAGG - Intronic
1092322095 12:7487082-7487104 GAGAGAGAGGGGAAGGTGGATGG + Intronic
1092468785 12:8760086-8760108 GTGGGGTAGGGGAAGGGGGAGGG - Intronic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1094122122 12:26985916-26985938 CTGAGGCAGAGGCAGGAGAATGG - Intronic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094816117 12:34186491-34186513 CTGAGCCAGTCGAATGTGGAAGG - Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1096098788 12:48956668-48956690 AGGAGGCAGGAGAAGGAGGAGGG - Intronic
1096382798 12:51173068-51173090 CTGGGGCGGCGGACGGTGGAAGG - Intronic
1096627060 12:52902480-52902502 CTGAGGCAGGGGCAGGAGAATGG - Intronic
1097192704 12:57227052-57227074 CGGAGGCAGGGGTTGGGGGAGGG - Intergenic
1097249698 12:57625742-57625764 GTGAGGCAGGGGTAAGTGGCTGG + Exonic
1097726249 12:63078757-63078779 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1098641097 12:72839185-72839207 CTCAGGCTGGGGAAGGAGCAAGG + Intergenic
1098696005 12:73555690-73555712 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1100511177 12:95275485-95275507 CTGAGGCAGGAGAACCCGGAAGG + Intronic
1100769931 12:97910543-97910565 TGGAGGCTGAGGAAGGTGGATGG - Intergenic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101303636 12:103505472-103505494 CTGAGTCATGGGAACGTGGTAGG + Intergenic
1101534114 12:105601839-105601861 GTTAGGCAGGGGAAGGTTGTGGG - Intergenic
1101548676 12:105741146-105741168 GTCAGGCAGGAGAAGGTGGCAGG + Intergenic
1101634542 12:106527524-106527546 CTGAGTCAGAGGAAGTTAGAGGG - Intronic
1101911229 12:108861517-108861539 CGGAGGCAGAGGCAGGAGGATGG - Intronic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102243346 12:111339354-111339376 CTGAGGCAGAGGAGGGAGGGAGG - Intronic
1102373719 12:112404132-112404154 CTGAGGCAGGAGAATTTGGACGG - Intergenic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1103115953 12:118332066-118332088 CTGTGGGAGGCCAAGGTGGAAGG - Intronic
1103123369 12:118399574-118399596 TTGAGGGAGGGGAGGATGGATGG + Intronic
1103175725 12:118861650-118861672 CTGAGACGGGGGAAGGGGAAAGG - Intergenic
1103359501 12:120345572-120345594 CTGAAGCAGGGGACGGTGGCAGG - Exonic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1103576696 12:121882829-121882851 CTGAGGCAGGAGAAGCTGGGAGG - Intergenic
1103598464 12:122038734-122038756 CACAGCCAGGGGAAGGTGCAGGG - Intronic
1103606140 12:122087388-122087410 CTGGGGCTGGGGAGGGTGGGTGG + Intronic
1103766505 12:123283967-123283989 CTGTGGGAGGGCAAGGTGGGTGG - Intergenic
1103938210 12:124487597-124487619 CGGAGGGAGGGGTCGGTGGATGG - Intronic
1104224967 12:126822655-126822677 CTGAGGCAGAGGAAGGGAGGGGG + Intergenic
1104571968 12:129933667-129933689 CTGAGGCAGGAGAAGGTCAGGGG - Intergenic
1104638668 12:130453402-130453424 CTGAGAGAGAGGATGGTGGAAGG - Intronic
1104736396 12:131138264-131138286 CCGAGCCTGGGGAAGGAGGATGG - Intronic
1104808774 12:131607209-131607231 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1104915219 12:132260883-132260905 CTTAGGAGGGGGATGGTGGAGGG + Intronic
1104916690 12:132269184-132269206 CTGAGGCAGGGGGAGGCGTCGGG + Intronic
1104987743 12:132606466-132606488 CTGAGGCAGGGGAAAGAAGGTGG - Intronic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1106020709 13:25912379-25912401 CAGAGGCTGGGGATGGGGGATGG + Intronic
1106615461 13:31323097-31323119 CTGTTGCAGGGGACGGAGGAGGG + Intronic
1106936606 13:34729480-34729502 GTGAGGCAGGGGCAGAAGGAGGG - Intergenic
1107112545 13:36713454-36713476 CAGAGGCTGGGGAGGGTGGAGGG - Intergenic
1107440741 13:40425387-40425409 CTGGAGCAGGGTGAGGTGGAGGG - Intergenic
1107842614 13:44474737-44474759 GGGAGGTAGGGGAAGGAGGACGG + Intronic
1108171041 13:47742185-47742207 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1108326857 13:49341572-49341594 CAGAGGCTGGGGAAGGTAGGAGG + Intronic
1109285403 13:60402785-60402807 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1109405123 13:61887611-61887633 ATGAGGCATGGGAAGGAGAAAGG - Intergenic
1110368082 13:74709887-74709909 CTGAGGCATGGACAGGTGAAGGG - Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1111057062 13:82964846-82964868 CTGAGGCAGAAGGAGGTTGAGGG + Intergenic
1111542577 13:89688739-89688761 CTGATGCTGGGGGATGTGGATGG - Intergenic
1111542973 13:89692293-89692315 CAGAGGCTGGGGAAGGTAGTTGG + Intergenic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1112498989 13:99927839-99927861 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1112810203 13:103209510-103209532 CTTTGGCAGGCCAAGGTGGACGG - Intergenic
1112953515 13:105031716-105031738 CTGAAGCAGAGGAAGTTAGATGG + Intergenic
1113406520 13:110045969-110045991 GTGATGCAGGAGAAGGTGGGAGG - Intergenic
1113902327 13:113804040-113804062 TGGGGGCTGGGGAAGGTGGAGGG + Intronic
1114174585 14:20309261-20309283 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1114288494 14:21268890-21268912 GTGGGGGAGGGGAAGGGGGAAGG - Intronic
1114450093 14:22819683-22819705 CTGAGTCAGGGGAGAGGGGAAGG + Intronic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1114740117 14:25088234-25088256 CTGTGGGAGGCCAAGGTGGAAGG + Intergenic
1114840475 14:26257028-26257050 CTTAAGCAGGTGAATGTGGATGG + Intergenic
1115085772 14:29513171-29513193 CTCTGCCAGGGCAAGGTGGAAGG - Intergenic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1115776797 14:36724329-36724351 CTCAGGCAGGGGTATGGGGAAGG - Intronic
1116149150 14:41116452-41116474 CTGATGTGGGGGATGGTGGAGGG - Intergenic
1116382114 14:44282514-44282536 GGGAGGCAGAGGCAGGTGGATGG - Intergenic
1116485799 14:45446556-45446578 CAGAGACTGGGGAAGGTGCATGG - Intergenic
1116962805 14:50983993-50984015 CTGAGGGAGGGGAGGAGGGATGG + Intronic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1117689307 14:58289836-58289858 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1117763837 14:59059696-59059718 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118281291 14:64431162-64431184 CTGAGGCAGGAGAACTTGGGAGG - Intronic
1118638582 14:67771121-67771143 TTGAGACAGAGGAGGGTGGAAGG - Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119487737 14:75002809-75002831 CTCAGGCAGAGGAAGGGGGCGGG + Intergenic
1119505261 14:75167372-75167394 AAGAGGCAGGGGAGGGAGGAAGG - Intronic
1119513148 14:75227462-75227484 CGGAGGCCGAGGCAGGTGGATGG + Intergenic
1119655429 14:76413886-76413908 CAGGGGCAGGGGACGGTGCAGGG - Intronic
1119655480 14:76414028-76414050 CAGGGGCAGGGGACGGTGCAGGG - Intronic
1120510117 14:85403013-85403035 GGAAGGCAGGGGAAGGTGGCAGG - Intergenic
1120515639 14:85466221-85466243 CAGAGGCTGGGGCAGGGGGAGGG + Intergenic
1120586934 14:86323087-86323109 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1120854891 14:89203683-89203705 CTGGGGCTGGACAAGGTGGAGGG + Intronic
1120949323 14:90026601-90026623 GTGGGGCAGGGGGAGGGGGAGGG - Intronic
1121186691 14:91978601-91978623 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1121553680 14:94820575-94820597 CTGAGGCTGGGCAAGGTCGAGGG + Intergenic
1121739864 14:96243725-96243747 CTGAGGCAGAGGAGAGTGGGTGG - Exonic
1121759904 14:96436068-96436090 CAGAGGCAGGGCAAGATGGCGGG - Intronic
1121810797 14:96887832-96887854 TTGGGGCAGGGGAAGGAGTAGGG - Intronic
1121958007 14:98231558-98231580 CTCTGGCAGGGTAGGGTGGAAGG - Intergenic
1122082515 14:99275113-99275135 CTGAGGCAGGGGTGGGTACATGG - Intergenic
1122119511 14:99544565-99544587 CTGAGGCAGGGGATGGGGCTTGG + Intronic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1122378463 14:101285260-101285282 CTGAGGCAACTGAAGGTGGTTGG - Intergenic
1122442564 14:101742289-101742311 CTTTGGGAGGGCAAGGTGGATGG - Intergenic
1122847087 14:104505988-104506010 GTGAGGCTGGGGAAGGAGGCAGG + Intronic
1122920020 14:104876165-104876187 CTGGGGCAGGGGATGGAGCAGGG + Intronic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122948007 14:105022002-105022024 CCGAGGCAGGGGCAGGAGGCAGG + Intergenic
1123025450 14:105421648-105421670 CCGAGGCATGGGAAGGTTGGAGG - Intronic
1124104977 15:26729348-26729370 CCAAGGAGGGGGAAGGTGGAGGG - Intronic
1124343950 15:28908944-28908966 CGGGGGCTGGGGGAGGTGGAAGG - Intronic
1124717099 15:32073616-32073638 TGGAGGCAGGGGCTGGTGGAAGG + Intronic
1124824233 15:33077505-33077527 TGGAGTCAGGGGAAGGGGGAGGG - Intronic
1124899801 15:33811404-33811426 CTGAGGCAGAGGCAGGAGAATGG + Intronic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125537980 15:40453704-40453726 CTGTGGGAGGCCAAGGTGGAAGG + Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126271360 15:46821380-46821402 CAGAGGCTGGGGTAGGGGGATGG + Intergenic
1126492328 15:49251660-49251682 CTGGTGCAGGGTGAGGTGGATGG - Intronic
1127096674 15:55517980-55518002 CAGAGGCAGTGAAAAGTGGATGG - Intergenic
1127488690 15:59441856-59441878 GTGAGGCTGGGGCAGGGGGAAGG - Intronic
1127706327 15:61550566-61550588 ATGAGGGAGGGGAAGGAGCAGGG - Intergenic
1127827244 15:62715529-62715551 CTGAAGCAGGGGAAGGCTAATGG - Intronic
1127856174 15:62955473-62955495 CTGAGGAGGAGGAAGGGGGATGG + Intergenic
1127857332 15:62963245-62963267 CTCAGGAAAGGGAAGGTAGAGGG - Intergenic
1127957479 15:63865520-63865542 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1128017577 15:64360790-64360812 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128257211 15:66205787-66205809 CTCTGGCAGGGGAAGGAGGTGGG - Intronic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1128349854 15:66881510-66881532 GTGGGGCAGGGGAAGGCGGGTGG + Intergenic
1128502546 15:68237377-68237399 CTGAGGAAGCTGAAGCTGGAGGG + Intronic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129218887 15:74119543-74119565 GTGAGGAAGGGTAAGGGGGAGGG - Intronic
1129741640 15:77992384-77992406 CTGGAGCAGGGGGAGGTGGCGGG + Intronic
1129844008 15:78759996-78760018 CTGGGGCAGGGGGCGGTGGCGGG - Intronic
1129880846 15:79005190-79005212 CTGAGGTGGGGGCAGGAGGAGGG + Intronic
1130044512 15:80433530-80433552 CCGAGGCGGGGGGAGGTGGTGGG - Intronic
1130051502 15:80487425-80487447 CTGATGCAGGAGAGGGTGCAGGG + Intronic
1130068989 15:80630583-80630605 CTTTGGCAGGCCAAGGTGGAAGG - Intergenic
1130114486 15:80994809-80994831 CTCTGGCAGGGCGAGGTGGATGG - Intergenic
1130257798 15:82333804-82333826 CTGGGGCAGGGGGCGGTGGCGGG + Intergenic
1130332693 15:82934232-82934254 TGGAGGCAGGCGAAGGTGGGTGG - Intronic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1130522241 15:84672239-84672261 CAGAGGCAGGGGCAGGGGCATGG - Intronic
1130597138 15:85256159-85256181 CTGGGGCAGGGGGCGGTGGCGGG - Intergenic
1130601766 15:85280254-85280276 CAGAGCCAGAGGAAGGTGGGGGG - Intergenic
1130648513 15:85748875-85748897 CTCAGGCCGGGGAAGGTGTGGGG - Intronic
1130843396 15:87722855-87722877 CTGAGACAGGGTGAGGAGGATGG + Intergenic
1131116872 15:89801395-89801417 CTGAGGCATGGTCAGGTGGGTGG - Intronic
1131284853 15:91048376-91048398 CAGAGGCTGAGGAAGGAGGATGG - Intergenic
1131360168 15:91783734-91783756 CTTAGGCATGGGAAAGAGGAAGG - Intergenic
1131385241 15:92000904-92000926 CTGAGTCTGGGGTAGTTGGAGGG + Intronic
1131406141 15:92166542-92166564 GTGAGTGAGGGGAAGCTGGAGGG - Intronic
1131537526 15:93249986-93250008 CAGAGGCAGGGGGAGGGGAAAGG + Intergenic
1131701280 15:94938757-94938779 AGCAGGCAGAGGAAGGTGGAAGG - Intergenic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132203108 15:99968675-99968697 CTGGGGCCGGAGAAGATGGATGG - Intergenic
1132240391 15:100253349-100253371 GTGAGGGAGGGGAAGGTAGAGGG + Intronic
1132452847 15:101977804-101977826 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1132454050 16:12822-12844 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1132478865 16:155926-155948 GGGATGGAGGGGAAGGTGGAAGG + Intronic
1132590085 16:722751-722773 CTGAGGCTGAGGAAGCTGGCAGG - Exonic
1132691050 16:1182113-1182135 CTGTGGCAGGGGCAGGAGCAGGG + Intronic
1132752752 16:1466313-1466335 CCGAGCCTGAGGAAGGTGGAGGG - Intronic
1132777710 16:1604927-1604949 ATGAGGCAGGGGAAGGGTGGGGG + Intronic
1132981623 16:2741189-2741211 CTGAGGCAGGGGTTGGTGCAGGG - Intergenic
1133142768 16:3760194-3760216 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1133206468 16:4237173-4237195 CGGAGGCAGAGGCAGGAGGATGG - Intronic
1133219126 16:4311264-4311286 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1133220449 16:4317170-4317192 CTGGGGCCTGGGAAGCTGGAAGG + Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133359055 16:5159194-5159216 GGGAGGCAGAGGCAGGTGGATGG - Intergenic
1133431957 16:5745084-5745106 ATGAGGTGGGGGAAGGGGGAGGG - Intergenic
1133692790 16:8232738-8232760 CAGAGGCAGAGGAAGGTGGGTGG - Intergenic
1134008636 16:10835036-10835058 CTGAGTCAGGAGATGGTTGAAGG - Intergenic
1134021352 16:10923563-10923585 CTGAGGCTGTGGGATGTGGATGG - Intronic
1134291752 16:12907172-12907194 CGGAGGGAGGGAAGGGTGGAAGG - Intronic
1134327407 16:13219647-13219669 CTGGGGCATGGGGAAGTGGAGGG + Intronic
1134661042 16:15984857-15984879 CTTTGGCAGGTGAAGGTGGGAGG + Intronic
1134765694 16:16755727-16755749 CTCAGGGAGGGGAAGGGGAAGGG - Intergenic
1135064673 16:19299486-19299508 CGGAGACAGAGGAATGTGGAAGG - Intronic
1135136528 16:19889020-19889042 ATGAGGCTTGGGAAGGTTGAGGG + Intergenic
1135236695 16:20763468-20763490 GTGAGGCAGAGGAAGGAGAATGG + Intronic
1135291766 16:21245561-21245583 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135638808 16:24102059-24102081 CTGATACAGGGTTAGGTGGAAGG + Intronic
1136116064 16:28095562-28095584 CTGAGGAAGGGGATGGGGAAAGG - Intergenic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136228565 16:28874098-28874120 CCGAGGCAGGGTGAGGGGGAAGG + Exonic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136367220 16:29814345-29814367 CTGCAGCAGGGGGACGTGGACGG + Exonic
1136463998 16:30429679-30429701 CTGAGGCAAGGGAAATTGGGTGG - Intronic
1136478665 16:30527740-30527762 CAGGCGCTGGGGAAGGTGGAGGG - Intronic
1136502617 16:30680429-30680451 TTGGGGCAGGTGAAGGTGAAAGG - Intergenic
1136544404 16:30947587-30947609 CAGGGGCTGGGGGAGGTGGAAGG + Exonic
1136702233 16:32154768-32154790 CTGAGGGCGGGGGAGGTGGGCGG - Intergenic
1136736605 16:32473162-32473184 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
1136765434 16:32772717-32772739 CTGAGGGCGGGGGAGGTGGGCGG + Intergenic
1136802665 16:33097662-33097684 CTGAGGGCGGGGGAGGTGGGCGG - Intergenic
1137556140 16:49471603-49471625 ACGAGGCAGGGTAAGCTGGAAGG - Intergenic
1137744339 16:50809862-50809884 CTGAGGCTGGGAAAGGGTGACGG - Intergenic
1137774383 16:51043235-51043257 TTGAGACAGGGGAAGGTGGGTGG - Intergenic
1138752511 16:59440788-59440810 GGGAGGGAGGGGAAGGGGGAGGG - Intergenic
1139130164 16:64133348-64133370 TTGAGGGAGGGCAAGGAGGATGG + Intergenic
1139511978 16:67432718-67432740 CTGAGGCAGAGTAGGGGGGAAGG + Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139643920 16:68313535-68313557 CTGAGGCAGGAGGAGAAGGAGGG - Intronic
1139651350 16:68363749-68363771 CTGGGGCTGGGGGAGGAGGATGG - Intronic
1140284859 16:73592594-73592616 CTGAGGCAGGGGAGAGTAGGAGG + Intergenic
1140338124 16:74130854-74130876 CTGAGGCTGGGAAGGGTAGAGGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140552624 16:75883387-75883409 CTTGGGCAGGGGCAGGTGAAGGG + Intergenic
1140655157 16:77132406-77132428 GAGAGGGAGGGGAAGGGGGAGGG - Intergenic
1140739130 16:77925837-77925859 CAGAAGCAGGGGGAGGTGGGGGG - Intronic
1141079648 16:81038767-81038789 TTGAGGCAGGGCATGGTGGCAGG - Intronic
1141094963 16:81156687-81156709 CTTTGGCAGGCCAAGGTGGACGG - Intergenic
1141131673 16:81441692-81441714 CTGGGATAGTGGAAGGTGGAGGG + Intergenic
1141179169 16:81740633-81740655 CTGAGGCAGGAGAACTTGGGAGG + Intronic
1141490963 16:84372521-84372543 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1141551306 16:84808490-84808512 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1141802359 16:86319478-86319500 CTAGGGCAGGAGGAGGTGGAAGG - Intergenic
1141804871 16:86335948-86335970 CAGAGGCCGGGGAGGGTGGGTGG - Intergenic
1141909680 16:87050196-87050218 CTTAGGAAGGGGTCGGTGGACGG - Intergenic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1142204740 16:88777568-88777590 CTGAGGCAGGGGCAGTGGGATGG + Intronic
1142263369 16:89052645-89052667 CGGAGGCACGGGGAGGAGGAAGG - Intergenic
1142416058 16:89943206-89943228 CCGAGGCTGGGAAAGGTGGAGGG - Intergenic
1203016463 16_KI270728v1_random:356415-356437 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1203034798 16_KI270728v1_random:629573-629595 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1203067822 16_KI270728v1_random:1034939-1034961 CTGAGGGCGGGGGAGGTGGGCGG + Intergenic
1142577588 17:919926-919948 CTGAGGCAGAGAGAGATGGAAGG - Intronic
1142688866 17:1592928-1592950 CTGGGGCAGGGGAAGGGCGGTGG - Intronic
1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG + Intronic
1142764216 17:2056575-2056597 CTGAGGGAAGGGGAAGTGGAGGG + Intronic
1142864499 17:2782416-2782438 CTGAGGGCGGGTCAGGTGGAGGG - Intronic
1143028370 17:3953895-3953917 CTGAGTCGGGGGAGGGTAGAGGG - Intronic
1143116139 17:4582795-4582817 CTGAGGCTGGAGAGTGTGGATGG + Intergenic
1143544406 17:7588018-7588040 CTGGGGTGGGGGAAGGGGGACGG + Exonic
1143571498 17:7761726-7761748 CTGAGGGAGGCTAAGGTGGGTGG - Intronic
1143579746 17:7818583-7818605 ATGAGGAAGGTGAAGGTCGAAGG + Intronic
1143583866 17:7841888-7841910 CTGGGGGAGGGGGAGGCGGAGGG - Intronic
1143690261 17:8556601-8556623 CAGGGGCAGGGGCAGGAGGAGGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144125842 17:12202333-12202355 CTGTGGCATGTGATGGTGGAGGG + Intergenic
1144649614 17:16999037-16999059 CAGGGGCTGGGGAAGGGGGAAGG - Intergenic
1144650541 17:17004357-17004379 CAGGGGCAGGGGCAGGAGGACGG - Intergenic
1144758860 17:17695763-17695785 CTTAGGGAGGCGAAGGTGGGAGG - Intronic
1144775883 17:17784322-17784344 CCTAGGCTGGGGAAGGCGGAAGG + Intronic
1144789200 17:17848080-17848102 GTGGGGCAGGGTAAGCTGGAGGG + Intronic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145032562 17:19516058-19516080 CTTAGGAAGGCCAAGGTGGAGGG + Intronic
1145040986 17:19578437-19578459 CTTTGGGAGGGCAAGGTGGAAGG - Exonic
1145173977 17:20684500-20684522 CTGAGGCAGGAGAATCTGGCAGG - Intergenic
1145254944 17:21317276-21317298 CTGAGGTGGGGGAATGGGGATGG + Intergenic
1145321658 17:21770689-21770711 CTGAGGTGGGGGAATGGGGATGG - Intergenic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146188638 17:30745756-30745778 CTGAGGCAGGAGAATGCGGGAGG - Intergenic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146688486 17:34857138-34857160 CTCACCCAGGAGAAGGTGGATGG + Intergenic
1146775367 17:35609716-35609738 CTGAGGAAGGCCAAGGTGGGAGG - Intronic
1146884013 17:36459013-36459035 CTGAGGCTGAGGAAGGTGAAGGG + Intergenic
1146913946 17:36666100-36666122 CTGAGGCTGGTGAAGGTTGTGGG + Intergenic
1147335233 17:39723610-39723632 CTGAGGAAGGTGAAGGTGCTTGG + Exonic
1147373149 17:40007703-40007725 CTTAGGGAGGCTAAGGTGGAAGG + Intergenic
1147403697 17:40195697-40195719 CTGAGGGAGGGGAGAGGGGATGG + Intergenic
1147429019 17:40360274-40360296 CTGAGCCAGAGGAAGGTGACCGG + Intergenic
1147566273 17:41538141-41538163 CTGAGGGAGGGGAAGGACAAGGG + Intergenic
1147743659 17:42682553-42682575 CAGAGGCTGGGGAAGGGGGGAGG + Intronic
1147752508 17:42744923-42744945 CTGAGGGAGGGAGAGGCGGAGGG - Intronic
1147899551 17:43775056-43775078 ATGAGGCAGGAGAAGCTGGCAGG - Intronic
1147985236 17:44302765-44302787 CTGAGGCAAGAGAATCTGGAAGG + Intergenic
1147992487 17:44343681-44343703 ATGAGGCAGGGGCAGGGGGATGG - Intergenic
1148020490 17:44549969-44549991 CTGTGACGGGGGAAGGTGAAAGG + Intergenic
1148114554 17:45167980-45168002 CTGAGGCTGGAGAATGTGGGCGG - Intronic
1148193642 17:45697925-45697947 GAGATGCAGGGGAAGGTGGATGG - Intergenic
1148242076 17:46006421-46006443 CAGAGGCTGAGGAGGGTGGAGGG + Intronic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148360865 17:47010862-47010884 CTGAGCCTCGGGAAGGAGGAAGG - Intronic
1148382391 17:47209488-47209510 CTGGGGCAGGGGCTGGTGCAGGG - Exonic
1148700128 17:49582121-49582143 CTTAGCCAGAGGAAGTTGGATGG - Intronic
1148805132 17:50260066-50260088 CTGAGACTGGAGAAGCTGGAGGG - Intergenic
1148806103 17:50264725-50264747 CACAGGGAGGGGAGGGTGGAGGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1148860561 17:50602322-50602344 CTGGGGCAGGGCAGGGAGGAAGG - Intronic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149040411 17:52181832-52181854 CAGAGGAAGGGAAAGGTGGTGGG - Intergenic
1149582901 17:57763531-57763553 CTGAGGCAGGGAAATGGGGCAGG + Intergenic
1149697676 17:58629215-58629237 CTGTGGGAGGCCAAGGTGGATGG + Intronic
1149891260 17:60392146-60392168 AGGAGGCAGGGGAAGGGGGCGGG - Intronic
1150979812 17:70128403-70128425 CTGAGAGAGGGGAAGTTAGAAGG - Intronic
1151114831 17:71724075-71724097 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1151183864 17:72349496-72349518 AGGAGGCGTGGGAAGGTGGAGGG + Intergenic
1151323995 17:73367872-73367894 GTGAGGCAGGAGTGGGTGGATGG - Intronic
1151452583 17:74207614-74207636 CTGAGGCAGGAGAACATGGGAGG - Intronic
1151475629 17:74343001-74343023 CTGGGGCAGAACAAGGTGGAGGG - Intronic
1151620299 17:75240914-75240936 CTGAGGCCTGGGGTGGTGGAGGG + Exonic
1151645851 17:75431138-75431160 CTGAGGCAGGAGAATGCGGGAGG - Intergenic
1151738458 17:75961668-75961690 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1151747394 17:76018777-76018799 CTGAGTCAAGGGAAGGAGTAGGG + Intronic
1152015342 17:77746979-77747001 ATGAGGCATGGGGAGGCGGAGGG - Intergenic
1152677156 17:81647527-81647549 TTGGAGCAGGGGAGGGTGGATGG - Intronic
1152778547 17:82216418-82216440 CTGTGGCAGAGCAAGGTGGGTGG + Intergenic
1152814110 17:82397438-82397460 GTGAGGCAGTGGGGGGTGGATGG + Intronic
1152905082 17:82965548-82965570 CGGAGGCATGGCAAGGCGGAGGG + Intronic
1153362593 18:4214220-4214242 CTGAGGAACAGGAAGGTGGCAGG + Intronic
1153544383 18:6191185-6191207 CTGGGGCAGAGGGAGGTGGCTGG + Intronic
1154357571 18:13633498-13633520 CTGAGGCAGGGGTGGGCTGAGGG - Intronic
1155075729 18:22352593-22352615 CAGAGGCTGGGGAAGGTAGAGGG - Intergenic
1155293634 18:24365654-24365676 CTGGGGCATGGGAAAGGGGAAGG + Intronic
1155407305 18:25503054-25503076 CTGAGGCTGGGAAGGGTGGGAGG + Intergenic
1155557368 18:27034642-27034664 CTGAGGCAGGGCAAGCTTGGTGG - Intronic
1155913999 18:31537902-31537924 CTGAGGCAGGTGAACCTGGGAGG + Intronic
1155964606 18:32024290-32024312 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1155988604 18:32256445-32256467 GAGAGGCAGGAGAAGGTGGCTGG - Intronic
1156057058 18:33019258-33019280 CTGAGACAAAGAAAGGTGGAGGG + Intronic
1156084579 18:33382981-33383003 AGGAGGCAGGGGCAGGGGGAGGG + Intronic
1156139710 18:34091735-34091757 CTGATGCAGGAGAAAGAGGACGG + Intronic
1156292401 18:35759450-35759472 CAGAGGCTGGGGAGGGGGGAGGG + Intergenic
1156389283 18:36635526-36635548 CTGAAGCAGGGGAAGAGAGAAGG + Intronic
1156449401 18:37258574-37258596 CTGAGGCAGGTGAGTGGGGAGGG + Intronic
1156507588 18:37608133-37608155 CAGAGCCAGAGGACGGTGGAGGG + Intergenic
1156641362 18:39104167-39104189 CTGAGGCTGTTGAAAGTGGAGGG + Intergenic
1156736140 18:40262218-40262240 CTGAGGCAGGGGAACCCGGGAGG + Intergenic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1157436543 18:47674897-47674919 TTGATGGAGGGGAAAGTGGAAGG + Intergenic
1157725155 18:49958580-49958602 AGGAGGCAGGGGTGGGTGGATGG - Intronic
1158346363 18:56520681-56520703 CTGAGGGAGAGGGATGTGGAAGG + Intergenic
1158406599 18:57165471-57165493 CAGAGTCAGGGGCAGCTGGATGG - Intergenic
1158962777 18:62600506-62600528 CTGAGGCAGAGGTAGGGGGAGGG + Intergenic
1159046519 18:63373986-63374008 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1159775882 18:72602266-72602288 ATAAGGGAGGGGATGGTGGACGG + Intronic
1160321451 18:77900076-77900098 CTGAGGCTGGGGAGGGTCTAAGG - Intergenic
1160701256 19:508498-508520 CTGAGCCCAGGGAAGGTGGTTGG + Intronic
1160861036 19:1237354-1237376 CGGAGGCCGGGGAAGATGGCAGG + Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161160295 19:2757877-2757899 CTCCTGCAGGGGAAGGTGAAGGG - Intronic
1161328718 19:3676087-3676109 CCGAGGCTGGGAGAGGTGGAAGG + Intronic
1161480578 19:4508363-4508385 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161657652 19:5525793-5525815 GTGAGGGAGGGGAGGATGGATGG - Intergenic
1161684807 19:5697490-5697512 CTGAGGCAGAGGGAGGAGGGGGG + Intronic
1161821575 19:6533632-6533654 GAGAGGGAGGGGAAGGAGGAAGG - Intronic
1161845452 19:6709613-6709635 CTGGGGCTGGGGGAGGTGGGTGG - Intronic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1161847704 19:6721081-6721103 CTGAGGGAGGGGAAGTAGAATGG + Intronic
1162017062 19:7851646-7851668 CAAAGGCAGTGGGAGGTGGAGGG - Intronic
1162021404 19:7870030-7870052 GTGAGGCAGGGGGAGAGGGAGGG + Exonic
1162021600 19:7870660-7870682 GTGAGGCAGGGGGAGAGGGAGGG + Exonic
1162262563 19:9544687-9544709 GAGAGGCAGTGGAAGGGGGAAGG - Intergenic
1162314326 19:9928559-9928581 CTGAGGGAGGCCAAGGTGGGTGG + Intronic
1162345320 19:10115130-10115152 CTGGGGTAGGGGAGGGTGGCAGG + Exonic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1162947492 19:14052620-14052642 CTTTGGCAGGCCAAGGTGGAAGG + Exonic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163124951 19:15239654-15239676 CTCACGCTGGGGCAGGTGGACGG + Exonic
1163431594 19:17271231-17271253 CTTAGGGAGGGCAAGGTGGGTGG - Intronic
1163468752 19:17484923-17484945 CTGAAACAGGGGCAGGTGGGTGG + Intronic
1163518077 19:17776732-17776754 CGGAGACATGGGGAGGTGGAGGG - Intronic
1163617260 19:18336701-18336723 CTGAGGGAGGGGAATAGGGAGGG + Intergenic
1163696980 19:18768990-18769012 CTGAGGCACGAGCAGGTGGCTGG + Intronic
1163905253 19:20146720-20146742 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1164301009 19:23963500-23963522 CTGAGGCAGGAGAACGAGGCAGG - Intergenic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164645841 19:29858347-29858369 CCCAGGCAGGGGCAGCTGGATGG - Intergenic
1165137638 19:33679940-33679962 CTGAGTAAGGGGGAGGTGTAAGG + Intronic
1165457154 19:35919309-35919331 CTTTGGCAGGCGGAGGTGGAAGG + Intergenic
1165735697 19:38174078-38174100 CTGAGGCTGGGGAAGGATGCAGG + Intronic
1165793564 19:38506188-38506210 TTGAGCCAGGGGAGGGTGGAGGG + Intronic
1165847404 19:38827084-38827106 GGGAGGGAGGGGAAGGAGGAAGG + Intronic
1165848950 19:38837977-38837999 CTGAGGCAGCGGAAGGGAGGAGG - Intronic
1165906579 19:39197995-39198017 GTGAGGCGGTGGAAGATGGAGGG + Intronic
1166194733 19:41198352-41198374 GGGAGGCAGGGAAAGATGGATGG - Intronic
1166198076 19:41219522-41219544 CTGGGGCAGGGGTAGGAGGTGGG + Intronic
1166288211 19:41845285-41845307 CTGGGGCACGGGAAGGGGGGAGG + Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1166343767 19:42152927-42152949 ATGAGGCAGGGGAAGGTCTGGGG + Intronic
1166374741 19:42321312-42321334 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1166760462 19:45221025-45221047 CTGAGACAGGGGCGGGGGGAGGG + Intronic
1166853522 19:45771321-45771343 CTGAGGCAGGGGAAAGAGAGGGG + Intronic
1166872485 19:45879277-45879299 CTCAGGCAGAGGAAGCTGGCAGG - Intergenic
1167042731 19:47032261-47032283 CTGGGGCTGGGGCAGATGGAAGG - Exonic
1167254536 19:48419369-48419391 CCGAGGCGGGGGATGGAGGAAGG - Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167294149 19:48639668-48639690 CTGGGGGAGGAGAAGGTTGAGGG - Intronic
1167297472 19:48660118-48660140 CTTTGGCAGGCCAAGGTGGAAGG + Intergenic
1167602899 19:50464946-50464968 GAGAGGCAGGGGCAGGTGGGTGG - Intronic
1167660773 19:50794821-50794843 GAGAGGCAGGGGCAGGTGGGCGG - Exonic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168025976 19:53643837-53643859 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1168095049 19:54109795-54109817 CTGAGGGAGGGCCGGGTGGAGGG - Intronic
1168095157 19:54110245-54110267 CGGAGGGATGGGAAGGTGGAAGG - Intronic
1168411272 19:56141617-56141639 CTGAGGGAGAGGACGGGGGAGGG + Intronic
1168509788 19:56965378-56965400 CAGGGGCTGGGGAAGGGGGACGG - Intergenic
1168522145 19:57060902-57060924 CTGGAGCAGGGGAGGGTGGTGGG - Intergenic
925178412 2:1800663-1800685 TTGAGGCTGGGGAAGGTTGAGGG - Intronic
925377760 2:3400461-3400483 CTGAGGCAGGGGCAGCTGGGGGG - Intronic
925774319 2:7319190-7319212 CTGAGGGAGAGGGAGGTAGAAGG - Intergenic
925874264 2:8298584-8298606 CTGGGGCAGGGGCCTGTGGATGG - Intergenic
925927599 2:8681696-8681718 ATGGGGGAGGGGAAGGGGGAGGG - Intronic
925948909 2:8893051-8893073 CAGAGGCAGGGGGAGGGGGTGGG + Intronic
926515057 2:13832974-13832996 CTGGGGCAGGGGTGGGGGGAGGG + Intergenic
926744702 2:16141408-16141430 CTGAGGCTCAGGGAGGTGGAGGG - Intergenic
926946726 2:18196061-18196083 GGGAGGCAGAGGCAGGTGGATGG - Intronic
927072085 2:19541234-19541256 CTGAGGCAGGGTAATGTATAAGG + Intergenic
927177672 2:20421963-20421985 CTGGGCCTGGGGATGGTGGAGGG - Intergenic
927191861 2:20522497-20522519 CTAAGGCAGGAGGAGGTGCAGGG - Intergenic
927292631 2:21419911-21419933 CTGCGGCAGGGGAAGGGACAAGG + Intergenic
927482379 2:23464531-23464553 CTTAGGCAGGGGAGTGGGGACGG - Intronic
927673715 2:25089711-25089733 CTCAGGCAGGGGCAGGGAGAGGG + Intronic
927692743 2:25219683-25219705 CTAAGGCAGGGGAAGGCTGAGGG + Intergenic
927893981 2:26769680-26769702 CTGAGGCAGAGGTGGCTGGAGGG - Intronic
927963486 2:27255164-27255186 CTGAGGCTGGGGAAACTGGCAGG + Exonic
928275682 2:29898149-29898171 CTGGGGCTGGGGAAGGTGGCAGG - Intronic
928385675 2:30865867-30865889 GTGAGGCAGGGGATGGAGCAAGG + Intergenic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
929097258 2:38275352-38275374 CTGAGGCAAGGGATGGGAGATGG - Intergenic
929464299 2:42130902-42130924 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
929831700 2:45352113-45352135 ATGAGGCAAGGGAAGGCGGGAGG + Intergenic
929892228 2:45927920-45927942 CGGAGGCAGGAGAGGGTGGGGGG + Intronic
930025641 2:47027710-47027732 CTCAGGCAGGGCATGGTGCAGGG + Intronic
930116121 2:47719822-47719844 CTGAGGCAGGATAGGGAGGAGGG + Intronic
931255673 2:60569964-60569986 TTGGGGCAGGGTTAGGTGGAGGG - Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
932343646 2:70982130-70982152 CTGGGGGAGGGGAAGGGGGTGGG - Intronic
932425530 2:71631973-71631995 TTGGGGCAGGGGGTGGTGGAGGG - Intronic
932501941 2:72190137-72190159 CTCAGGGAGGTGAAGGTGGGAGG - Intronic
932544064 2:72688528-72688550 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
932930308 2:76028760-76028782 CAGAGGCTGGGGATGGTGGTGGG - Intergenic
933207809 2:79529197-79529219 ATGAGGCATGAGAAGGTGGTAGG + Intronic
934179784 2:89610605-89610627 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
934187759 2:89762279-89762301 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
934290076 2:91684866-91684888 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
934308858 2:91845669-91845691 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
934542403 2:95186823-95186845 GTGGGGCAGGGGGAGGCGGAAGG - Intergenic
934557563 2:95295512-95295534 CTCAGGCAGTGAAAGGAGGATGG + Intergenic
934618881 2:95792137-95792159 CTGAGCCGGGGAAAGGTGCAAGG - Intergenic
934642012 2:96032420-96032442 CTGAGCCGGGGAAAGGTGCAAGG + Intronic
934856408 2:97732884-97732906 CTGAGGCCGCGGAAGGAGCAGGG + Exonic
934945085 2:98534958-98534980 CTTAGCCAAGGGCAGGTGGAGGG + Intronic
935147859 2:100408469-100408491 CTGAGGTAGTGGTAGGAGGAGGG - Intronic
935402350 2:102673884-102673906 CTGAGGCAGGAGAATGGGCATGG - Intronic
935418137 2:102840215-102840237 ATGAGGGAGTGGGAGGTGGAGGG + Intronic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
935831460 2:107004999-107005021 CTGAGGGAGGGGATGAGGGAGGG + Intergenic
935914168 2:107931332-107931354 CTGAGGCAGGAGAAAATGGCAGG - Intergenic
936083120 2:109448761-109448783 CTGAGGCAGGGGATGGTTTCGGG - Intronic
936260734 2:110957958-110957980 CTGAGGCAGGAGAACCTGGGAGG + Intronic
936523250 2:113225786-113225808 AGGCGGCAGGGGAAGGTGGAGGG + Intronic
936600529 2:113890355-113890377 CTGAGGCGGAGGAAGGAAGATGG + Intronic
936653329 2:114455299-114455321 CTTAGGGAGGCCAAGGTGGACGG + Intronic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
937060395 2:118976522-118976544 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
937296922 2:120815017-120815039 CTGAGACAGGGAGAGGTCGATGG + Intronic
937305448 2:120867788-120867810 CTCAGGCGGGGGGAGCTGGAGGG + Intronic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937680725 2:124641273-124641295 CTGAGGCTGGGGGAGGTGATAGG + Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
938242418 2:129753581-129753603 CTGAGGCATGGGGAGGTTAAAGG - Intergenic
938255725 2:129858518-129858540 CTGAGCTTGGGAAAGGTGGACGG - Intergenic
938966351 2:136392074-136392096 CTGGGGCAGGGGAAGCAGGGAGG - Intergenic
939498574 2:142952155-142952177 TTGAGCCTGGGGAAGGTGGCGGG - Intronic
939678677 2:145104123-145104145 CTGGGGGTGGGGAAGCTGGATGG - Intergenic
939931538 2:148240266-148240288 GTGAGGCAGGGGGAGGGGGAAGG + Intronic
939989111 2:148860739-148860761 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
939998062 2:148938660-148938682 CTGTGGCTGGGGAGGGTGAAGGG + Intronic
940062196 2:149584803-149584825 CTTAGGGAGGCGAAGGTGGGTGG + Intronic
940160581 2:150708331-150708353 GTGAGGCAGGAGAAAGGGGAGGG + Intergenic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941218825 2:162748865-162748887 GGGAGGGAGGGGAAGGGGGAGGG - Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942075404 2:172352690-172352712 CTGAGCCAGGGGAAGAAGAAAGG + Intergenic
942117591 2:172743362-172743384 CTGGGGCAGGGGAAGCAAGAGGG - Intronic
942515533 2:176748525-176748547 CAAAGGCATGGGAAGGAGGATGG + Intergenic
942724944 2:178996174-178996196 CTGAGGCAGGAGAATCTGGGAGG - Intronic
942848159 2:180451056-180451078 CTGAGGCTGGGAAGGGTAGAAGG - Intergenic
943648477 2:190431604-190431626 CTGAGGCAGGGGAATCAGGCAGG + Intronic
943863066 2:192893577-192893599 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
943971813 2:194419370-194419392 CTCACACAGTGGAAGGTGGAAGG - Intergenic
944155613 2:196604270-196604292 CTGGGGCAGTGGAAGGGGCATGG - Intergenic
944215797 2:197254292-197254314 CTGAGGCAGGAGAACCTGGGAGG + Intronic
944414097 2:199466529-199466551 CAGTGGCAGGGAAAGATGGAAGG + Intronic
944766783 2:202872009-202872031 CTGAGGCGTGGGGAAGTGGAAGG + Intergenic
944769785 2:202902517-202902539 AGGAGGCAGAGGAATGTGGAAGG + Intronic
945041354 2:205746014-205746036 CTGAGGCAGGAGAACATGGCAGG - Intronic
945047648 2:205796031-205796053 CAGAGGCAGGGGAAAATAGAGGG + Exonic
945236375 2:207635536-207635558 CTGAGACAGAAGAAGTTGGAGGG + Intergenic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946406756 2:219496023-219496045 CTGAGTCAGAGGGAGGCGGATGG + Intronic
946522286 2:220479434-220479456 CTGAGGGAGGCTGAGGTGGAAGG + Intergenic
946758761 2:222972628-222972650 CTGGGGCAGGTGAAGGGGCAGGG + Intergenic
946881901 2:224185012-224185034 GTGAGGCAGAGGAGGGTGGATGG - Intergenic
947155017 2:227153726-227153748 CTGAGGCAGGCCAAAGTGAAGGG + Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947567071 2:231201080-231201102 ATCAGGTAGGGGGAGGTGGATGG + Intronic
947743686 2:232496882-232496904 CTGAGGCTGGGGGCGGTGGGTGG - Intergenic
947952184 2:234158014-234158036 CTTAGGGAGGGGATGGGGGAGGG - Intergenic
948063221 2:235057121-235057143 GTGAGGCAGGGGCAGATAGAAGG + Intergenic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948178489 2:235961992-235962014 CTGGGGCAGGGCGGGGTGGAGGG + Intronic
948229954 2:236342284-236342306 CAGAGGCCGGGGCAGGTGGGAGG + Intronic
948358672 2:237401926-237401948 CTTAGGAAGGCTAAGGTGGAAGG - Intronic
948619952 2:239228032-239228054 CAAAGGGATGGGAAGGTGGAAGG + Intronic
948628379 2:239284581-239284603 CAGAGGCAGAGGCAGGTGAAAGG + Intronic
948667486 2:239545664-239545686 CTGAGGGAGGGGAAAGTGTGAGG - Intergenic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
949034428 2:241810095-241810117 CTGGGGCAGGGGCAGGTGGGTGG - Intronic
949062989 2:241972155-241972177 CTGTGGCCTGGGAAGGTGGGTGG + Intergenic
1168731414 20:84989-85011 CAGAGGCTGGGAAAGGTGGTGGG - Intergenic
1168773860 20:432741-432763 CAGGGGCAGGGGAAGGTGAGTGG + Intergenic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1169189182 20:3646517-3646539 CAGATGGAGGGGAAGGCGGAGGG + Intronic
1169201606 20:3712866-3712888 GGGAGGCTGGGGGAGGTGGAAGG + Intergenic
1169243107 20:4001690-4001712 CTTTGGCAGGCCAAGGTGGAAGG + Intronic
1169365173 20:4986220-4986242 CAGAGGCGGGGGCAGGAGGATGG + Intronic
1169417678 20:5431873-5431895 CTGAGGCATGGGACAGTGGAGGG - Intergenic
1169541966 20:6609420-6609442 CGGAGGCTGGGAAAGGTAGAAGG + Intergenic
1170116160 20:12862413-12862435 CTGTAGCAGGCAAAGGTGGAAGG - Intergenic
1170185688 20:13587880-13587902 CTTAGGGAGGCCAAGGTGGAAGG + Intronic
1170594143 20:17792845-17792867 CTGAGGGAGGGGAGGTTGGGTGG - Intergenic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1170917573 20:20642213-20642235 TTGAGGCAGGGGTCGGGGGATGG + Intronic
1170994685 20:21341253-21341275 CTGAGGCAAGAGGAGGAGGATGG + Intronic
1171190403 20:23155159-23155181 CCGGGGCAGGGGGAGGTGGCGGG - Intergenic
1171470436 20:25366363-25366385 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1171498562 20:25575507-25575529 CTTTGGGAGGGCAAGGTGGATGG + Intronic
1171819726 20:29823708-29823730 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1171898091 20:30829471-30829493 CAGAGACAGTGGAATGTGGAGGG + Intergenic
1172134800 20:32679731-32679753 CTGAGGGAGAGGAAACTGGAGGG + Intergenic
1172248691 20:33463728-33463750 CTTTGGCAGGCGAAGGTGGGAGG + Intergenic
1172379431 20:34475691-34475713 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
1172535284 20:35667984-35668006 CTTTGGGAGGCGAAGGTGGATGG - Intronic
1172647143 20:36477652-36477674 CTGAGGCTGAGGCAGGTGGAGGG - Intronic
1172800494 20:37573036-37573058 CAGAGGCAGGGGAAGCTGTCAGG + Intergenic
1172812871 20:37662472-37662494 CTAAGGCTGGGGGAGGTGGGAGG - Intergenic
1172859260 20:38034259-38034281 CTGAGGCCCGGGAAGGTTTAAGG + Intronic
1172963225 20:38813454-38813476 CTGATGGAAGGGAAGGTGGGAGG + Intronic
1173088205 20:39945131-39945153 GTGAGGCAAAGAAAGGTGGAAGG + Intergenic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1173370382 20:42429590-42429612 CACAGGCAGAGAAAGGTGGAGGG + Intronic
1173400825 20:42724472-42724494 TTGGGGTAGGGGATGGTGGAGGG - Intronic
1173515436 20:43662419-43662441 CTTTGGGAGGGCAAGGTGGAAGG - Intergenic
1174008328 20:47428266-47428288 CAGAGGGAAGGGAAGGTGGACGG - Intergenic
1174123587 20:48286498-48286520 CTGAGTCCTGGCAAGGTGGAAGG + Intergenic
1174145044 20:48447531-48447553 AGGAGGCAGGGGAGGGAGGAGGG + Intergenic
1174360045 20:50023300-50023322 CTGGGGCAGGGGAAAGTGTCAGG - Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1175074040 20:56358936-56358958 CGGAGGCCGGGGAGGGTGGGCGG - Exonic
1175219357 20:57408127-57408149 GAGAGGCAGGAGAAGGTGCAAGG - Exonic
1175573874 20:60045730-60045752 CAGAGGCAGGGGAGGGTAGGAGG + Intergenic
1175736801 20:61392850-61392872 GTGACACAGGGGATGGTGGAGGG - Intronic
1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG + Intronic
1175895442 20:62333806-62333828 ATGAGCCAGAGGAAGGTGGCGGG + Intronic
1175919671 20:62444791-62444813 CTGGGGCAGGAGAAGGAGGGTGG + Intergenic
1176027529 20:62993557-62993579 GGGAGGCAGGGGAGGGTGGGAGG + Intergenic
1176073741 20:63239263-63239285 CTGGGGCAGGGGAGGGCTGAGGG + Intronic
1176198892 20:63850991-63851013 CTGAAGTAGGGGGAAGTGGAGGG - Intergenic
1177044674 21:16154751-16154773 CAGATGCAGGGAAAGATGGAGGG + Intergenic
1177169163 21:17637206-17637228 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1177663646 21:24122845-24122867 AGCAGGCAGGGGAAAGTGGAAGG + Intergenic
1177884436 21:26731871-26731893 AGCAGGCAGGAGAAGGTGGAAGG - Intergenic
1178013369 21:28313453-28313475 CTGGGGCTAGGGAAAGTGGAAGG - Intergenic
1178570880 21:33735904-33735926 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1178600632 21:33991491-33991513 GTCAGGCAGGGGAAGGCTGATGG + Intergenic
1178628218 21:34236367-34236389 CACAGGGTGGGGAAGGTGGAGGG - Intergenic
1178804010 21:35823693-35823715 CTGAGGCTGGAGACGGTGGCGGG - Intronic
1179085031 21:38208268-38208290 CTGAGGCAGAGGCTGGTGCAGGG - Intronic
1179174883 21:39001080-39001102 CTGAGGCAGTAGAGGGTGGGTGG - Intergenic
1179251939 21:39677934-39677956 CTGAAGCAGGGGGCGGGGGAAGG + Intergenic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179579768 21:42334308-42334330 CTTAGGGAGGCTAAGGTGGATGG - Intergenic
1179624630 21:42641883-42641905 CTGAGGCACGGGAAGGCTAAGGG + Intergenic
1179791636 21:43759320-43759342 CTGGAGCCAGGGAAGGTGGACGG - Exonic
1179881887 21:44296477-44296499 CTGAGGCAGGGGAGGGGGAGTGG - Intronic
1179979762 21:44889791-44889813 CTGAGGCAGGGCGGGGTGCAGGG + Intronic
1180001104 21:44995947-44995969 CTGAGGCTGGGAAAGGAGGCAGG - Intergenic
1180041676 21:45283325-45283347 ATGCGGCAGGGGGAGGTGGGGGG + Intronic
1180138475 21:45876430-45876452 CTGGAGCAGGGGAAGGTGAGCGG + Intronic
1180186122 21:46140212-46140234 GTGAGGCACGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186154 21:46140363-46140385 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186164 21:46140413-46140435 GTGAGCCACGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186194 21:46140563-46140585 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186205 21:46140614-46140636 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186217 21:46140664-46140686 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186236 21:46140764-46140786 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186262 21:46140914-46140936 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180237769 21:46474521-46474543 CTGAGGCAGGGAAATGTGTGTGG + Intronic
1180323728 22:11348399-11348421 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1180535941 22:16392757-16392779 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1180661691 22:17473058-17473080 TTGAGGGTGGAGAAGGTGGAAGG + Intronic
1180956688 22:19744430-19744452 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1181031445 22:20150351-20150373 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1181048901 22:20229504-20229526 CTGAGGCATGGGGAGGTGATGGG + Intergenic
1181311194 22:21945882-21945904 CTCAGCCAGGAGGAGGTGGAGGG - Exonic
1181439257 22:22927384-22927406 CTGGGGCCGGGGAAGGAGCAAGG - Intergenic
1181719623 22:24763813-24763835 CCGAGGCAGGAGATGGTGGGCGG - Intronic
1182023752 22:27101469-27101491 GAGAGGCAGGGGAAGGAAGATGG - Intergenic
1182074204 22:27483889-27483911 AGGAGACAGGGGAAGATGGAAGG - Intergenic
1182102982 22:27670728-27670750 CTCAGGAGGGGGAAGGGGGAAGG - Intergenic
1182199218 22:28552883-28552905 CTGAGGCAGGGGAATCAGGCAGG - Intronic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182302129 22:29342860-29342882 ATGTGGCAGGGGCCGGTGGAGGG - Intronic
1182310972 22:29406217-29406239 CCCGGGCAGGGGAGGGTGGAAGG - Intronic
1182447376 22:30397498-30397520 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1182548405 22:31088619-31088641 CTGGGGCAGGGGATGGGGGCAGG + Intronic
1182686278 22:32123251-32123273 CCGAGGCAGGGGCAGGTTGGGGG + Intergenic
1182690138 22:32154885-32154907 CCCGGGCAGGGGAGGGTGGAAGG + Intronic
1182774223 22:32819038-32819060 GTGAGCCAGAGGAAAGTGGAGGG + Intronic
1182886391 22:33777630-33777652 GGGAGGGAGGGGAAGGGGGAGGG + Intronic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183107140 22:35622721-35622743 CCAAGGCTGGGGAGGGTGGAGGG - Intronic
1183357079 22:37365274-37365296 TTGAGGCAGGGGGAGCTTGAGGG + Intergenic
1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG + Intronic
1183536717 22:38406057-38406079 CTTAGGAAGGCCAAGGTGGACGG - Intergenic
1183664810 22:39241222-39241244 GTGAGGCAGGGCTGGGTGGAGGG - Intronic
1183688349 22:39374760-39374782 CACAGGCAGGGGAGCGTGGATGG + Intronic
1183900582 22:41002997-41003019 CTGAGCCAGGGTTAGGAGGAAGG - Intergenic
1184170896 22:42759187-42759209 CTAAGGCAGAGGGAGCTGGAAGG + Intergenic
1184307657 22:43617521-43617543 ATGAGGAAGGGGAAAATGGATGG - Intronic
1184417186 22:44359206-44359228 CAGAGCCAGGGGGAGGTGGCGGG + Intergenic
1184457337 22:44618597-44618619 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1184570833 22:45323938-45323960 CTGGTGCAGGGGAAGGTGCGTGG + Intronic
1184765313 22:46569204-46569226 CAGAGGCTGGGGAGGGAGGATGG + Intergenic
1184769360 22:46588679-46588701 ATCAGGCCGGGGAAGGAGGACGG - Intronic
1185195433 22:49466511-49466533 CTGCGGCAGTGAGAGGTGGAAGG + Intronic
1185276407 22:49951825-49951847 CTGGGGCAGGGCCAGTTGGAAGG + Intergenic
1185402089 22:50624474-50624496 CAGAGGCCTGGGAGGGTGGAGGG + Intronic
949767769 3:7546298-7546320 CTGAGGGAGGGATAGATGGATGG - Intronic
950043952 3:9937992-9938014 CTGAGGCAGGGGCAGGGTGGAGG - Intronic
950158826 3:10743753-10743775 CAGTGGCGGGGGAGGGTGGAGGG - Intergenic
950194824 3:11001595-11001617 CAGGGGCAGGGGATGGTTGATGG + Intronic
950366400 3:12488149-12488171 CTGAGGGAGGGGAAGGTGAGTGG - Intronic
950442935 3:13020249-13020271 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
950456992 3:13098635-13098657 CTGAGCTAGGGGAAAATGGATGG + Intergenic
950864622 3:16179264-16179286 CTGAGGCACAGAAAGATGGAGGG + Intronic
950958640 3:17081248-17081270 GTGAGGGAGGAGAAGGAGGAGGG - Intronic
951219568 3:20055029-20055051 GTGAGCCAGGGGGAGGTGAAAGG + Intronic
951877357 3:27441983-27442005 CTGAGGCAGGAGAATCTGGGAGG - Intronic
952192967 3:31043197-31043219 GTCAGGGAGGGGAGGGTGGAGGG - Intergenic
952439559 3:33312159-33312181 AGGAGGCTGGGGCAGGTGGATGG - Intronic
952681629 3:36100073-36100095 CAGAGGCAGGGCAATGTGGTAGG - Intergenic
952711335 3:36435173-36435195 CAGAGACAGGGGAGGGTGAATGG - Intronic
952711347 3:36435241-36435263 CAGAGACAGTGGGAGGTGGAGGG - Intronic
952735908 3:36691369-36691391 GGGAGGCAGGAGAAGGAGGAAGG + Intergenic
952755699 3:36864631-36864653 CAGAATCAGGGGAGGGTGGAGGG - Intronic
952902741 3:38120781-38120803 ATGAGGCAGGTGAGGTTGGATGG - Intronic
952935962 3:38398519-38398541 ATGAGGCAGGGTGAGGTAGATGG - Intronic
953390777 3:42532484-42532506 CTGGAGCAGGGGATGGTGGTGGG - Intronic
953969246 3:47334257-47334279 CTGAGGCAGGGAAATGTGTCAGG + Intronic
954036878 3:47855592-47855614 CTGTGGCATGGGGTGGTGGAAGG - Intronic
954140713 3:48603776-48603798 CAGAGACAGGGGAAGGGGGTTGG - Intronic
954284930 3:49612238-49612260 GGGAGGCTGGGGAAGGAGGACGG - Intronic
954326790 3:49868424-49868446 CTGAGGCATGGGGAGGTGAAGGG - Intronic
954461363 3:50628845-50628867 CTGGGGCTTGGGAAGGTGAAAGG + Intronic
954567248 3:51608864-51608886 CAGAGGGAGGGGCAGGGGGAGGG + Intronic
954614197 3:51961152-51961174 CTGATGCACGGGAAGGTGAGCGG - Exonic
954715289 3:52523807-52523829 GTGAGCCCGGGGAAGGTGGTGGG + Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
954802324 3:53194369-53194391 CAGAGGCAGTGGAGGGTGGTGGG + Intergenic
954802766 3:53196661-53196683 CCGAGGAAGGGGCAGGTGCATGG - Intergenic
954902544 3:54032129-54032151 CTGGGGCAAGGGATGATGGATGG + Intergenic
955225053 3:57053399-57053421 CAGAGGCAGGGCAGGCTGGAGGG - Intronic
955857033 3:63283905-63283927 CTGAGGCAGGAGAACCCGGAAGG - Intronic
955972327 3:64447673-64447695 ATTAGGCAGGGGGAGGGGGAGGG + Intergenic
955985557 3:64570572-64570594 CTTAGGTAGGGGAAGTTGGGAGG + Intronic
956212217 3:66813834-66813856 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
956816130 3:72910054-72910076 CTGAATCAGGGGAAGGGTGAAGG + Intronic
957087209 3:75692247-75692269 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
957279203 3:78128035-78128057 TTGGGGCATGGGAAGTTGGAGGG - Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957544960 3:81625087-81625109 ATGAGGGAGGGGGAGGGGGAGGG + Intronic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957785564 3:84877800-84877822 CTGAGGCTGAGGCAGGAGGATGG + Intergenic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
958893884 3:99809045-99809067 CTGAGGAAGAGGCATGTGGAGGG - Intergenic
959189079 3:103086562-103086584 CTGAGGGATGGGAAGGTTGGAGG - Intergenic
959498588 3:107079168-107079190 CTGGGGCAGAGGAAGGAGGCAGG + Intergenic
960577353 3:119242062-119242084 CTGAGGCAGGGGAATCAGGCAGG - Intergenic
960798530 3:121514083-121514105 CTGTGGGAGGCCAAGGTGGACGG + Intronic
961071772 3:123936686-123936708 AGGAGGGAGGGGAAGGTGGTAGG + Intronic
961509431 3:127391951-127391973 CTGATGCAGGAGGAGCTGGAGGG + Intergenic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961810845 3:129520928-129520950 GTGGGGCTGGGGAAGGTGGATGG - Intergenic
961816991 3:129556174-129556196 CTGGGGCGGGGGCAGGAGGAGGG - Exonic
961906668 3:130269883-130269905 CTGGGGCAGGGGCAGGGGCAGGG - Intergenic
962159392 3:132982868-132982890 CTGAGGCATGGGAAAATGGAAGG + Intergenic
962340052 3:134575154-134575176 GGGAGGGAGGGGAAGGGGGACGG - Intergenic
962467473 3:135673833-135673855 CTGACATAGCGGAAGGTGGAAGG + Intergenic
962655916 3:137543743-137543765 CTGAAGCAGGGCAAGGTGTCGGG + Intergenic
962779228 3:138695852-138695874 CTGAGGCAGGAGAATCTGGGAGG - Intronic
962906100 3:139804415-139804437 GTGGGGCAGGGGAAGAGGGAAGG + Intergenic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
962978846 3:140469806-140469828 GTGAGGCAGGGGAAGAGGGAGGG + Intronic
963189731 3:142456074-142456096 GGGAGGCTGAGGAAGGTGGATGG + Intronic
963219194 3:142788223-142788245 CTGTGGCAGGAGTAGATGGAGGG + Intronic
963229173 3:142892444-142892466 GTGGGGCAGGGGAAAGAGGAAGG - Intergenic
963248287 3:143082907-143082929 CTGAGGTGGGGGAAGGGGGGTGG - Intergenic
963267082 3:143250289-143250311 CTGAGGCAGAAGAAGGTTGCAGG + Intergenic
963459142 3:145585394-145585416 CAGAGGCAGGGAAAAGTGTAAGG + Intergenic
963891877 3:150644877-150644899 CTGTGGCAGGCCAAGGTGGGTGG + Intergenic
964200281 3:154111456-154111478 CTGAGCCAGGTGAAGCTGAAAGG + Intergenic
964277926 3:155027476-155027498 CTGAGGGCAGGGAAGGTGGTTGG - Intronic
964293607 3:155209438-155209460 CTCAGGGAGGCCAAGGTGGAAGG - Intergenic
964435196 3:156643919-156643941 CAGAGGCAGGGGAATGAGGAAGG - Intergenic
964668663 3:159201744-159201766 CTGAGGCAGGTGAATGAGGCAGG - Intronic
964689803 3:159437587-159437609 CGGAGGAAGGAGACGGTGGAGGG + Intronic
964693188 3:159476948-159476970 CAGAGGCTGGGGAAGGGGAAAGG - Intronic
964780778 3:160335318-160335340 CTGAGGCAGGAGAACCTGGGAGG - Intronic
965530930 3:169769274-169769296 CTGGGGCTGGGGAGGGTGGGTGG - Intronic
965593598 3:170385889-170385911 CTGAGGCAGGAGAATCTGGGAGG - Intronic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966393205 3:179474858-179474880 CTTTGGGAGGGCAAGGTGGAAGG - Intergenic
966742210 3:183244216-183244238 AACAGGCAGAGGAAGGTGGAAGG + Intronic
967178848 3:186885575-186885597 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
967185759 3:186943243-186943265 TTGAGGCAGGGGAAGGCTGCAGG + Intronic
967315466 3:188148607-188148629 ATGAGGAAGGGGAAGCTGCAGGG + Intergenic
967442788 3:189528285-189528307 CTGAGGCAGGAGAACCTGGAAGG - Intergenic
968339315 3:197941473-197941495 GGGAGGGAGGGGAAGGGGGAGGG - Intronic
968435954 4:589363-589385 AGCAGGCAGGGGAACGTGGAAGG - Intergenic
968470379 4:779174-779196 CTGAGGCCGAGGCTGGTGGATGG - Intergenic
968517265 4:1020628-1020650 CTGAGGCAGGGGATGGGGTGGGG + Intronic
968517397 4:1020893-1020915 CCCAGGCAGGGGAAGGGGCAGGG + Intronic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968531455 4:1094134-1094156 CTGAGGCAGGAGACTGAGGATGG - Intronic
968555431 4:1244417-1244439 CTGAGGCTGGGGAAGGAACAGGG - Intronic
968940087 4:3633281-3633303 GGGAGGGAGGGGAAGGGGGAGGG - Intergenic
969259999 4:6027409-6027431 CTGAGGCCTGGGAAGAGGGAAGG + Intronic
969263267 4:6046895-6046917 CTGGGGCAGGGGGTGTTGGAGGG - Intronic
969275235 4:6130192-6130214 GGGAGGCAGGGGAAGAAGGAGGG + Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
969829494 4:9783017-9783039 CTGACGCAGGGGAAGCCGGCCGG - Exonic
970203184 4:13629810-13629832 GTGAGGCTGGGGCAGGTGGGTGG + Intergenic
970228639 4:13885858-13885880 CTGAGGCAATAGAATGTGGAAGG - Intergenic
970420052 4:15897665-15897687 CTGAGGCAGGGGGAGGGTGATGG - Intergenic
970573442 4:17404901-17404923 CTGGGGCAGGGGCAGCTGCATGG - Intergenic
970791477 4:19862944-19862966 CTGGGGCAGGGGGAGGGGGGAGG - Intergenic
970914994 4:21322027-21322049 CAGAGGCAGGGGAGGAAGGAAGG + Intronic
971222926 4:24725613-24725635 CTGAGATGGGGGGAGGTGGACGG - Intergenic
971504009 4:27347083-27347105 CTGACACAGGGGAAAATGGAAGG - Intergenic
972117180 4:35650915-35650937 GTGGGGCAGGGGAAGGGGGGAGG + Intergenic
972142817 4:35982533-35982555 GAGAGGCAGGTGTAGGTGGATGG - Intronic
972458731 4:39279514-39279536 CTGAGGCAGGAGGAGGAGGCTGG - Intronic
972960321 4:44446861-44446883 TTGGGACAGGGGAGGGTGGAAGG - Intronic
972995321 4:44871713-44871735 ATGAGGCAGGACTAGGTGGATGG - Intergenic
973263221 4:48185954-48185976 CTGAGGCAGGAGAATCTGGCAGG - Intronic
973274117 4:48291052-48291074 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
973328974 4:48893180-48893202 CGGGGGCAGGGGAAGGTGGCTGG + Intronic
973616391 4:52682640-52682662 AGGAGGCAGAGGAAAGTGGAAGG - Intergenic
974126353 4:57701159-57701181 ATGAGGGAGGGGAATATGGAGGG - Intergenic
974771139 4:66415151-66415173 CAGAGGCAGGGGGTGGTAGAAGG + Intergenic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975165066 4:71169106-71169128 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
976324009 4:83750425-83750447 CTGAGGGAGGCCAAGGTGGGTGG + Intergenic
976401832 4:84615578-84615600 CTGTGGCAGGGGGAGGGGGTGGG - Intronic
976690275 4:87861536-87861558 CCAAGGCAGGGGAAGATGGATGG - Intergenic
977600540 4:98929679-98929701 CTGAGCCAGGGGACGTGGGAGGG - Intronic
977609874 4:99020613-99020635 CTGAAGCAAGGGATGGAGGAGGG - Intronic
977694455 4:99950468-99950490 GAGAGGCGGGGGAAGGCGGAGGG + Intergenic
978643265 4:110896632-110896654 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
978913683 4:114097074-114097096 CTCAGAATGGGGAAGGTGGAAGG - Intergenic
978959798 4:114662913-114662935 CTGAGGCAGGAGAACCTGGGAGG - Intronic
978968253 4:114769372-114769394 AGCAGGCAGGGGAACGTGGAAGG + Intergenic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979831858 4:125314824-125314846 CGGAGGCCGGGCAAGGCGGAGGG + Intergenic
980208699 4:129756406-129756428 TAGTGGCAGGGGAAGGAGGAGGG - Intergenic
981213560 4:142136615-142136637 ATGAGGCAGGGTGAGGTGGAAGG + Intronic
981782588 4:148444550-148444572 CTGGGGCGGGGGAAGGGGAACGG + Intronic
981835089 4:149044569-149044591 TTGAGGAAGGGGTATGTGGATGG + Intergenic
981936476 4:150245509-150245531 ATGGGGTAGGGGAAGGGGGAGGG - Intronic
981990060 4:150907338-150907360 GGGAGGAAGGGGAAGGGGGAGGG + Intronic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982134401 4:152259497-152259519 CTGTGGCAGGGGGAGGGGCATGG - Intergenic
982373821 4:154664800-154664822 CTGAGGCAGGAGAACCAGGAAGG - Intronic
982753553 4:159191495-159191517 CTGTGGGAGGCCAAGGTGGACGG + Intronic
983119963 4:163870822-163870844 CAGAGGCAGGGAAGTGTGGAGGG + Intronic
983228319 4:165105953-165105975 CTCACGCAGTGGAAGGTGGAAGG - Intronic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
983828211 4:172291722-172291744 CTGGGGCAGGGGGAGGGGGGTGG - Intronic
983946259 4:173589082-173589104 CAGAGGCAGGGGCAGAAGGAAGG - Intergenic
984781939 4:183533934-183533956 CCGAGGCCGGGGCAGGGGGAGGG + Intergenic
985103674 4:186482066-186482088 CTGAGGCAGCGGCAGCTGGCAGG - Intronic
985128724 4:186720995-186721017 TTGAGGCAGCGTAAGGTGGGTGG - Intronic
985390505 4:189487677-189487699 CTGAGCCAGGGGAGGCTGAACGG - Intergenic
985552725 5:541619-541641 GAGGAGCAGGGGAAGGTGGAGGG - Intergenic
985658538 5:1144198-1144220 CTCAGGGAGGGGAAGTTGGCCGG + Intergenic
985665684 5:1180605-1180627 CTGAGGCGGGGGATGGGGGTGGG + Intergenic
985744155 5:1637110-1637132 CTGACGCAGGGGCAGGAGGTGGG - Intergenic
985790874 5:1926351-1926373 CTGGGGCAGGGGCAGGTGCAGGG - Intergenic
985790972 5:1926623-1926645 CAGGGGCAGGGGCAGGTGCAGGG - Intergenic
985887921 5:2694556-2694578 CAGAGGCAGGGGTAGGAGCAAGG + Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986310025 5:6544785-6544807 CTGAGGGTGGGGACGGTGGGGGG - Intergenic
986773496 5:10994333-10994355 CGGGGGCCGGGGAAGGAGGAGGG + Intronic
988273021 5:29041647-29041669 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
988693678 5:33597552-33597574 CTGAGGCAGTGCGAGGTGGTGGG - Intronic
988969419 5:36451292-36451314 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
989024935 5:37056323-37056345 CCATGGCAGGGGAAGGTAGATGG + Intronic
990042432 5:51390122-51390144 CTGAGGGCGGGGAAGCTGGGAGG + Intronic
990320316 5:54623474-54623496 CTGAAACAGGGCAAGGTGGATGG + Intergenic
990410475 5:55535719-55535741 GTGAGGGAGGTGACGGTGGATGG - Intergenic
990443151 5:55866527-55866549 CTGAGGCAGGGGTAGGGGTGGGG + Intronic
990513870 5:56514508-56514530 CAGAGACAGGGGAAGGTGCCAGG - Intronic
990756726 5:59079930-59079952 CAGAGGCAAGGGAAGGGGAAAGG + Intronic
991050388 5:62266649-62266671 CCTTGGCAGAGGAAGGTGGACGG + Intergenic
991375274 5:65958656-65958678 GTGAGGGAGGGGGAGGGGGAGGG + Intronic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
991588982 5:68229448-68229470 CTAAGTCAGGTGGAGGTGGAGGG - Intronic
991642647 5:68770178-68770200 ATGTGGCAGGGGAAGGAGGGAGG - Intergenic
991723872 5:69516811-69516833 CTTAGGGAGGCCAAGGTGGAAGG + Intronic
992212747 5:74496750-74496772 CTGAGGCAGGGCATGGGGGTGGG - Intergenic
992319713 5:75601565-75601587 AGCAGGCAGAGGAAGGTGGAAGG + Intergenic
992397197 5:76378917-76378939 CTGAGGCAGGAGAAACCGGAAGG + Intergenic
992772318 5:80060046-80060068 CTGAGACAAGGGATGGCGGAAGG + Intronic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
994709972 5:103255331-103255353 CTGAGGAGGAGAAAGGTGGAAGG - Intergenic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
995124101 5:108563149-108563171 CTGATGCAGGGGTGGGTGGTAGG - Intergenic
995294419 5:110502672-110502694 GTGAGTGAGGGGAAAGTGGAAGG - Intronic
995647502 5:114329402-114329424 AGTAGGCAGGAGAAGGTGGAAGG + Intergenic
995751072 5:115453799-115453821 CTGAGGCTGGGCAGGGTGGAAGG - Intergenic
995895122 5:117002793-117002815 CTGAGGCAGGGGAATCAGGCAGG + Intergenic
996338284 5:122408470-122408492 GTGAGCCAGTGGAAGGTGCAAGG - Intronic
996937728 5:128967230-128967252 CCAAGGCAGGGGGAGGAGGAAGG - Intronic
997428196 5:133818748-133818770 GTGAGGCAGGGGAAGGTGTAGGG - Intergenic
997438525 5:133892374-133892396 CAGGGGCAGGGGTGGGTGGATGG - Intergenic
997535331 5:134616039-134616061 CTGAGACAGGAGAATGTGGCAGG + Intronic
997610924 5:135215252-135215274 CTGAGACAGGGTAAGATAGATGG - Intronic
997865126 5:137455278-137455300 CTGAGGCCAGAAAAGGTGGAGGG + Intronic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
997903927 5:137795184-137795206 GTGAGGCAGGCTAAGTTGGATGG + Intergenic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998025481 5:138811942-138811964 GAGAGGGAGGGGAAGGGGGAGGG + Intronic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
998188487 5:140001616-140001638 CTTTGGCAGGGCAAGGTGGGAGG + Intronic
998481871 5:142469677-142469699 AGGAGGCTGGGGGAGGTGGATGG + Intergenic
998501506 5:142636835-142636857 CTGTGGCTGGGGAAGCTGGCAGG + Intronic
998826501 5:146106942-146106964 CTGAGGCAGGGGCATGTAGCTGG - Intergenic
999317639 5:150594500-150594522 CAGATCCAGGGGCAGGTGGAGGG - Intergenic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1000163159 5:158620615-158620637 GTAAGGTAGAGGAAGGTGGATGG + Intergenic
1000486392 5:161849056-161849078 CTGGGGGAGGGGGAGGTTGAAGG + Intronic
1000900608 5:166907523-166907545 CTATGTCAGGGTAAGGTGGAGGG + Intergenic
1001084697 5:168692115-168692137 CTGTTGCAGGGGAAGGGGGCAGG - Intronic
1001193884 5:169654322-169654344 TTGAGGCAGGGAAAGCAGGAAGG + Intronic
1001526751 5:172434498-172434520 CGGAGGCAGGGGAAGCAGGGCGG - Intronic
1001548590 5:172586329-172586351 GTGAGGCAGGGCGAGGTGGGAGG + Intergenic
1001586527 5:172836604-172836626 CTGAAGCGGAGGAAGGTGCATGG - Intronic
1001650701 5:173314017-173314039 CTGAAGTAGGGGAAGGTGTGTGG + Intergenic
1001681253 5:173558542-173558564 CTGAGTCAGGGGTGGGAGGAAGG + Intergenic
1001933392 5:175688392-175688414 CTGGGGCAGAGGATGGTGGCTGG - Intergenic
1002077823 5:176719638-176719660 CTGAGGGAAGGGATGGTGGTGGG - Intergenic
1002145901 5:177181126-177181148 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1002198543 5:177514059-177514081 CTGACCCAGGAGAAGGGGGAAGG - Intronic
1002211974 5:177604617-177604639 CTGGGGCAGGGGCAGGAGGGCGG + Intronic
1002330024 5:178434748-178434770 CTGAGGCCTGGGATGGTGGAGGG + Intronic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1003353151 6:5339676-5339698 CTGTGGCAGGTCAAGGTGGGTGG - Intronic
1003507481 6:6751700-6751722 CTGGGGGAGGGGGAGGGGGAGGG - Intergenic
1004205604 6:13589225-13589247 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1004222277 6:13757057-13757079 CTTTGGGAGGCGAAGGTGGATGG + Intergenic
1004263472 6:14129071-14129093 CTGAGGGAGGGGTTGCTGGATGG + Intronic
1004271883 6:14202951-14202973 ATGAGGCAGGCGCTGGTGGACGG + Intergenic
1004316625 6:14593737-14593759 CTGAGGCTGGAGAAGGTCCAGGG - Intergenic
1004474148 6:15955614-15955636 CGGAGGCAGGCCCAGGTGGATGG - Intergenic
1004682502 6:17909793-17909815 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1005173456 6:23015061-23015083 AGGAGGAAGTGGAAGGTGGAAGG + Intergenic
1005558701 6:27014408-27014430 ATGAGGCTGGGGGAGGGGGAGGG + Intergenic
1005777110 6:29146238-29146260 CTGGGGCAGGGGAAGGAAGGGGG - Intergenic
1005997873 6:30942508-30942530 TGGAGGCAGGGGCAGGTGGGTGG + Intronic
1006102310 6:31693150-31693172 CTGAGGAAGGGAAAGATGCAGGG + Intronic
1006171791 6:32097306-32097328 CTGAGGGTGGGGAAGAGGGAGGG + Intronic
1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG + Exonic
1006302336 6:33200267-33200289 CGGAGCCAGGGGAGGCTGGACGG - Exonic
1006317255 6:33298172-33298194 CTCAGGCAGGCAGAGGTGGAGGG + Intronic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1006745763 6:36340967-36340989 ACGAGGCAGGGGAATCTGGAGGG - Intergenic
1006775868 6:36592120-36592142 GGGAGGCAGAGGAGGGTGGATGG + Intergenic
1006977533 6:38117291-38117313 GTGAGGCAGAGGCAGGAGGATGG - Intronic
1006984156 6:38166548-38166570 GTGCGGAGGGGGAAGGTGGAGGG - Intergenic
1007041200 6:38724074-38724096 CTGAGGCAGGAGAATCCGGAAGG - Intronic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1007827758 6:44613908-44613930 CTGAGGAAGGGGAAGGTTTTGGG + Intergenic
1007948798 6:45850929-45850951 CTGAGGCAGGGGGATGGGAAAGG + Intergenic
1008010076 6:46457090-46457112 CAGAGGCAGGGGATATTGGAAGG + Intronic
1008646567 6:53520474-53520496 CTGCCGCAGGCGAGGGTGGAGGG - Intronic
1008877806 6:56348550-56348572 CTGTAGCATGGGAAGGTGGCTGG + Intronic
1010232669 6:73549059-73549081 CTTTGGCAGGCCAAGGTGGATGG + Intergenic
1010463284 6:76138041-76138063 GTGAGGTAGGGGAAGGGGGGAGG - Intergenic
1010929663 6:81785920-81785942 CTGGGGCAGGGGCAGATGTATGG + Intergenic
1010932833 6:81823148-81823170 CAGAGGCCAGGAAAGGTGGAGGG - Intergenic
1012489599 6:99766520-99766542 CTTGGGCAGGGAAAGGTGAAGGG - Intergenic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1013067122 6:106694683-106694705 CTGAGGTAGGTGAAGGGGTAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013428516 6:110035758-110035780 CTGTGGGAGGTCAAGGTGGAAGG + Intergenic
1013536422 6:111066901-111066923 TTTAGGCAGGGAAAGGGGGAAGG + Intergenic
1013589172 6:111605842-111605864 CTGGGCCCGGAGAAGGTGGAGGG - Exonic
1013799982 6:113931584-113931606 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1013887499 6:114987994-114988016 AGCAGGCAGAGGAAGGTGGAAGG + Intergenic
1015037208 6:128670132-128670154 CTGAGGGTGGTGATGGTGGATGG + Intergenic
1015292987 6:131559664-131559686 CTGAGGCAGGAGAATGAGAATGG - Intergenic
1015389705 6:132667827-132667849 CTGAAGAAAGGGGAGGTGGAAGG - Intergenic
1015632203 6:135243066-135243088 ATGAGGCTGGGGCAGGAGGACGG + Intergenic
1016802972 6:148185137-148185159 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1016843038 6:148543802-148543824 CTGAAGCAGGGACAGGAGGAGGG + Exonic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017096757 6:150811720-150811742 CTGAGGCAGGGGCTGGGGCAGGG + Intronic
1017352629 6:153459643-153459665 CTGAGGAAGGGGTAAGTGAAGGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017618396 6:156269724-156269746 CAGAGGTAGGGCAAGGTGGAAGG - Intergenic
1017778757 6:157700039-157700061 CTGAGATAAGGGCAGGTGGATGG + Intergenic
1017841170 6:158224188-158224210 CTGAGGCAGGGGAGGGCTGGAGG - Intergenic
1017988214 6:159463201-159463223 CTGTGGCTGGCGAAGGTAGACGG - Intergenic
1018042825 6:159940296-159940318 CTCAGCTAGAGGAAGGTGGAGGG - Intergenic
1018144870 6:160876801-160876823 CTGAGGAAGGGGTAAGTGAAAGG + Intergenic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1018315564 6:162553364-162553386 AAGAGGCAGGGGAGGGTGGGAGG + Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018525924 6:164710032-164710054 CAAAGGCAGGAGAATGTGGAAGG - Intergenic
1019158240 6:170052874-170052896 CAGAGGGAGGGGGAGGGGGAGGG - Intergenic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1019419856 7:945894-945916 CTGGGGCACGGGCAGGGGGAAGG + Intronic
1019440174 7:1041952-1041974 ATGCGGCAGGGGAAGGGGAAGGG + Intronic
1020447071 7:8280343-8280365 CTTAGGGAGGCCAAGGTGGATGG - Intergenic
1020772482 7:12412123-12412145 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1020955143 7:14731102-14731124 GTGACGCAGCGGAAGGTGGGAGG + Intronic
1021440054 7:20667715-20667737 CAGAGGCAGGGGCAGGGGCAGGG - Intronic
1021506317 7:21389404-21389426 CTGAGGCCGGGCATGGTGGCGGG + Intergenic
1021610591 7:22454237-22454259 CTGAGGCAGGGGTTGGAGGTGGG - Intronic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1021706001 7:23368512-23368534 CTGAGGAAAGTGAAAGTGGAGGG + Intronic
1022530007 7:31061157-31061179 CTGAGGTCGCGGAAGGTGCAGGG + Intronic
1022553324 7:31263306-31263328 CAGAGGCTGGGAAAGGTGGATGG - Intergenic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1022845921 7:34209667-34209689 GTGAGGCAGAGGAAGGTAGCAGG + Intergenic
1023074473 7:36469413-36469435 AGGAGGCATGGGAAGGAGGAGGG - Intergenic
1023077468 7:36498366-36498388 TTGAGCCAGGGGATGGGGGATGG + Intergenic
1023270253 7:38455167-38455189 CTGAGGCAGGAGGAGGTGGGAGG - Intronic
1023745633 7:43320044-43320066 CAGATGCTGGGGAAGGTGCAGGG - Intronic
1023842182 7:44104084-44104106 CTGAGGGAAGGAAAGGTGGTGGG - Intergenic
1023980639 7:45068073-45068095 CTGAGGCATGGGAAAGTGAAAGG - Intronic
1023989274 7:45118513-45118535 CTGAGGCAGAGGAATGGGGCAGG + Intergenic
1024229910 7:47355870-47355892 ATGAGGGAGGGGAAGGAAGATGG + Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024471717 7:49773610-49773632 CTGCGGCAGGGGGAGGCGGGAGG + Intergenic
1024486446 7:49925680-49925702 CTGAGGCAGAGGCCTGTGGATGG - Intronic
1024613235 7:51084934-51084956 AGGAGGCGGGGGACGGTGGAAGG - Intronic
1024672874 7:51612552-51612574 CTGAGGTGGGGGTAGGTGGGAGG + Intergenic
1025107026 7:56179830-56179852 CTGAGGCAGGAGAAAGTGGCAGG + Intergenic
1025573152 7:62600548-62600570 CTGAGGCAGGGGAATCAGGCAGG + Intergenic
1025800676 7:64784207-64784229 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026136088 7:67662324-67662346 CTGAGGATGAGGGAGGTGGAGGG - Intergenic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1026633997 7:72065373-72065395 CTGGGGCAGGGGCAGGGGGGCGG - Intronic
1026806156 7:73430508-73430530 GGGAGGCAGGGGGAGGGGGAGGG - Intergenic
1026843698 7:73685061-73685083 CTGTGGGAGGCGGAGGTGGACGG + Intronic
1026848508 7:73710812-73710834 CGGAGGCAGGTGGAGGTTGAGGG + Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027154395 7:75756306-75756328 CTGAGACAGGGCAAGCTGGGAGG - Intergenic
1027680882 7:81220261-81220283 CAGAGGCTTGGGAAGGTTGAGGG - Intergenic
1027929258 7:84510096-84510118 ATCAGGCAGAGGAAAGTGGATGG + Intergenic
1027935005 7:84590590-84590612 GTGGGGTAGGGGAAGGGGGAGGG - Intergenic
1027996374 7:85430390-85430412 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1028610394 7:92703946-92703968 CTGAGGCAGAGTAAGTAGGAAGG - Intronic
1029098367 7:98107080-98107102 CTGAGGCAGCGGAGGGAGGCAGG + Exonic
1029272445 7:99385285-99385307 ATGGGGCAGGGGAAGTTGGGTGG + Intronic
1029286374 7:99468691-99468713 CTGGGGCAGGGGAAGCTGAGGGG + Intergenic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029549742 7:101231457-101231479 CTGAGGCGGGGGAGGGGGGGTGG - Intergenic
1029569532 7:101360460-101360482 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1029821511 7:103151543-103151565 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1031198510 7:118647379-118647401 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031884574 7:127232491-127232513 CTGTGGGAGGCCAAGGTGGATGG - Intronic
1031940627 7:127785150-127785172 CTGTGGGAGGCCAAGGTGGAAGG - Intronic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032175954 7:129626061-129626083 CTGTGGCAGGCCAAGGTGGGAGG - Intronic
1032182460 7:129692080-129692102 GGGTGGCAGGGGAATGTGGAGGG - Intronic
1032290779 7:130588645-130588667 GTGGGGCAGGGGGAGGGGGAAGG + Intronic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032441587 7:131946379-131946401 GGGAGGCAGGGGTCGGTGGAGGG + Intergenic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1032581195 7:133105138-133105160 CTGGGGCGGGGGTGGGTGGAGGG - Intergenic
1033150509 7:138910794-138910816 CTGAGGCAGAGGAGGTTGGGAGG - Intronic
1033282823 7:140017850-140017872 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
1033467901 7:141613160-141613182 GTGAGGCAGGAGAAGATGAAGGG + Intronic
1033565522 7:142574899-142574921 CAGAGGCAGGGGGAGGGGGAGGG - Intergenic
1033565526 7:142574905-142574927 CAGAGGCAGAGGCAGGGGGAGGG - Intergenic
1033582582 7:142750790-142750812 CTGAGGTTGGGTAAGATGGATGG + Intronic
1033584139 7:142761710-142761732 CTGAGGTTGGGTAAGATGGATGG + Intronic
1034065874 7:148136070-148136092 GAGAGGGAGGGGGAGGTGGAAGG + Intronic
1034254641 7:149717895-149717917 CTGAGGCAGGAGAACCTGGAAGG - Intronic
1034823675 7:154240485-154240507 CTGAGGCATGGGATGGAAGATGG - Intronic
1034899208 7:154897142-154897164 CTGAGGCCAGGGAAGGAGGGAGG + Intergenic
1035160063 7:156943723-156943745 CTGGGGCGGGGACAGGTGGATGG + Intergenic
1035421211 7:158730145-158730167 CTGAGGCAGTGGGAGGTGGCTGG + Intergenic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035479208 7:159168658-159168680 CAGGGGCTGGGGAAGGAGGAAGG + Intergenic
1035673272 8:1436385-1436407 AGCAGGCAGAGGAAGGTGGAAGG - Intergenic
1035777151 8:2196786-2196808 AGCAGGCAGAGGAAGGTGGAAGG - Intergenic
1035835662 8:2749169-2749191 CTGAGGCTGGGTTTGGTGGAAGG + Intergenic
1035937059 8:3852651-3852673 CTGAGGCAGGCCAAGATGAATGG + Intronic
1036025212 8:4900099-4900121 GCCAGGCATGGGAAGGTGGAAGG - Intronic
1036047516 8:5160384-5160406 CTGTGGGAGGCCAAGGTGGATGG - Intergenic
1036191962 8:6678689-6678711 CTGTGGGAGGCCAAGGTGGATGG + Intergenic
1036495038 8:9262635-9262657 CTGAGGCAGGAGCAGGAGAATGG - Intergenic
1036653775 8:10662583-10662605 CCGAGTCAGGGGAAGCGGGAGGG - Intronic
1036760108 8:11502858-11502880 CGGTGGCAGGGGAAGGGGGGTGG + Intronic
1037296117 8:17402408-17402430 CAGAGGCTGGGGAAGGTAGTGGG - Intronic
1037523562 8:19703060-19703082 CTGAGGCAGGGGAAGAAGGGAGG + Intronic
1037587168 8:20285301-20285323 CTGAGGCAGGTCAGGGTGGCAGG - Intronic
1037876885 8:22552792-22552814 TTGAGGCAGGGTGGGGTGGAAGG - Intronic
1037901515 8:22692026-22692048 CTGGGGCCGGGGTAGGTGAAGGG - Intronic
1037926908 8:22850814-22850836 CTCAGGGAGGGGTAGGAGGAAGG + Intronic
1037965835 8:23133463-23133485 CTGTGGGAGGCCAAGGTGGATGG + Intergenic
1038158279 8:25011889-25011911 CTGAGGGACGGGAAGGTAGTTGG - Intergenic
1038460165 8:27709526-27709548 CTGAGGCAGGGGGAGGCGCTTGG + Intergenic
1038838093 8:31151044-31151066 GTGAGGCAGTGGGAGGTAGAGGG + Intronic
1039022549 8:33223639-33223661 CTGAGGCAGGCGGAGGGGGTGGG + Intergenic
1039117963 8:34113342-34113364 CAGGGGCACGGGAAGGGGGAAGG + Intergenic
1039474294 8:37831357-37831379 CTGAGGGAGGGCAACGTGGCTGG + Intronic
1040056926 8:43066935-43066957 GTTAGGCAGGGGAAGATGGTAGG + Intronic
1040561625 8:48527884-48527906 TGGAGGCTGGGAAAGGTGGAAGG - Intergenic
1040926544 8:52689796-52689818 ATGAGGCTAGGGCAGGTGGAAGG - Intronic
1040983556 8:53269523-53269545 CTCAGGGAGGAGAGGGTGGAAGG + Intergenic
1041134991 8:54748707-54748729 CTGATACTGGGGATGGTGGATGG - Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1041729311 8:61048818-61048840 GTGAGGGAGGGGAAGAGGGAAGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042281295 8:67059329-67059351 CTGATGCTAGGAAAGGTGGATGG - Exonic
1042298950 8:67254584-67254606 AGGAGGCTGGGGAAGGAGGATGG + Intronic
1042342135 8:67691503-67691525 CTGAGGCCTGAGAAGGTGGTGGG + Intronic
1042405403 8:68399315-68399337 CGGAGGCATGGAAAGGTGGGAGG - Intronic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1042922566 8:73934152-73934174 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1043756429 8:84009530-84009552 CAGAAGCAGGGGAAGGGGTAGGG + Intergenic
1043775676 8:84265431-84265453 CTGAGGCAAGGAATGGTGGGTGG + Intronic
1044472777 8:92590032-92590054 CAGAGGGAGGGGAGGGTGTATGG - Intergenic
1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG + Intergenic
1045447583 8:102283325-102283347 CTTAGGAAGGGGAAGGCGGGGGG + Intronic
1045811490 8:106225148-106225170 CAGAGGCTGGGAAGGGTGGAGGG + Intergenic
1046553467 8:115746393-115746415 CAGAGGCTGGGGCAGTTGGAAGG + Intronic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1046929863 8:119831196-119831218 GGGAGGCAGGGGGAGGTAGAGGG + Intronic
1047026667 8:120831934-120831956 CGGATGCAAGGGATGGTGGATGG - Intergenic
1047254838 8:123207149-123207171 CAGAGCCAGGTGAAGCTGGAGGG - Exonic
1047311160 8:123693281-123693303 TTGAGGCAGGGGAAGGCCGCTGG - Exonic
1047764920 8:127982568-127982590 GGGAGGCAGGGGAGGGAGGATGG + Intergenic
1048012227 8:130467035-130467057 CTGACCCAGGGGAAAGAGGAGGG + Intergenic
1048517816 8:135126396-135126418 CTCAGGGAGGGGGAGGTGGGAGG - Intergenic
1048577907 8:135707307-135707329 CTCAGGCTGGGGGAGGTGGGAGG + Intergenic
1049157625 8:141076466-141076488 CTGGGACAGGGGAAGGTAAATGG + Intergenic
1049301441 8:141872706-141872728 CAGAGGCAGGTGAGGGTGGTGGG + Intergenic
1049301508 8:141872931-141872953 CAGGGGCAGGGGAGGGTGGTGGG + Intergenic
1049313778 8:141948009-141948031 CTCAGGCATGGTAGGGTGGAGGG + Intergenic
1049353577 8:142177061-142177083 CAGAGGCTGGGCAGGGTGGAAGG - Intergenic
1049509829 8:143021922-143021944 CTGGGGCAGGTGGAGGTGCAGGG - Exonic
1049512255 8:143034507-143034529 CTTAGGGAGGCCAAGGTGGATGG + Intergenic
1049514831 8:143048711-143048733 CTTAGGGAGGCCAAGGTGGATGG - Intronic
1049539090 8:143198923-143198945 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1049684481 8:143933876-143933898 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
1049698298 8:143994344-143994366 GTGAGGCAGGGGAGGTTGGGAGG - Intronic
1049883470 9:13254-13276 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1050498688 9:6271284-6271306 CTTGGGCAGGGGAGTGTGGAGGG - Intergenic
1050910502 9:11063447-11063469 CTCTGGCAGGAGAAGGTGGTGGG + Intergenic
1051286951 9:15507404-15507426 CTCTGGGAGGGCAAGGTGGATGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051585930 9:18726889-18726911 CTGGGGCTGGGGCAGGGGGAGGG - Intronic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1051697216 9:19781368-19781390 ATGAAGTAGGGGAAGGTGGAAGG + Intronic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1052352661 9:27473314-27473336 CTGAGGGAGGCAAAGGGGGAGGG + Intronic
1052475722 9:28956706-28956728 AGGAGGCAGGGGAGGGAGGAGGG - Intergenic
1052615083 9:30828852-30828874 CAGAGGAAGGGTAATGTGGATGG + Intergenic
1052716140 9:32119825-32119847 ATGAGGCTGGGGAAGTTGGCAGG + Intergenic
1052801537 9:32972680-32972702 CTGATGCATGGAAAGGTGGTTGG - Exonic
1052899052 9:33774511-33774533 ATGAGGCAGGGCAGGGAGGAGGG + Intronic
1053409668 9:37907392-37907414 CTGGGGCAGGGGAATGGGGCCGG - Intronic
1053750661 9:41251267-41251289 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1054163231 9:61694432-61694454 CTTTGGGAGGGCAAGGTGGATGG + Intergenic
1054256172 9:62815610-62815632 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1054335132 9:63800004-63800026 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1054450663 9:65401992-65402014 GGGAGGGAGGGGAAGGGGGAGGG + Intergenic
1054777043 9:69132472-69132494 GTGCTGCAGGAGAAGGTGGAAGG + Intronic
1054946886 9:70805180-70805202 GAGAGGCAGAGGAAGGAGGAGGG + Intronic
1055130559 9:72769561-72769583 GTGAGGCAGTGGAGGGTGGCTGG + Intronic
1055152583 9:73020465-73020487 CTGAGTTAGGGGATGGTTGAAGG + Intronic
1055303457 9:74905375-74905397 CTGAGGCTGGGCGAGGTGGCTGG + Intergenic
1055505818 9:76948051-76948073 CAGAGGCTGGGGAAGGAGGGTGG - Intergenic
1055953336 9:81751152-81751174 CTGTGGGAGGCGGAGGTGGACGG - Intergenic
1056387248 9:86107257-86107279 CCGAGGCTGGGAAGGGTGGAGGG + Intergenic
1056550187 9:87646362-87646384 TTGAGACAGGGGAAGGTGTGTGG + Intronic
1056780002 9:89542112-89542134 CTGAGCCAGGGAGAGGTGAATGG - Intergenic
1056879828 9:90380517-90380539 CTGGGGGTGGGGAAGTTGGAAGG - Intergenic
1057007445 9:91573122-91573144 GTGAGACAGGAGAAGGAGGAAGG + Intronic
1057164757 9:92916766-92916788 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1057311081 9:93943697-93943719 CTGAGGCAGGGGCAGGGGCAGGG - Intergenic
1057453077 9:95182879-95182901 CTGGGACAGGGGAAGGTGACTGG + Intronic
1057624538 9:96665995-96666017 CTGAGGCAGGGAAATGTGTTCGG + Intergenic
1057641780 9:96830583-96830605 CTGTGGCAGGGGAGGTTGGGGGG - Intronic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058994614 9:110287571-110287593 CTGTGGGAGGCCAAGGTGGATGG - Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059329715 9:113527176-113527198 CTATGGCAGGGAATGGTGGATGG - Intronic
1059423282 9:114205875-114205897 CCGAGGCAGAGGGAGGTGGTGGG + Intronic
1059428408 9:114235672-114235694 CAGGGGCAGGGGCAGGGGGAGGG - Intronic
1059438955 9:114292034-114292056 CTAAGGCAGGAGGAGGCGGAGGG - Intronic
1059733061 9:117075482-117075504 CAGATGGAGGGGAAGGGGGAGGG + Intronic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060405030 9:123368832-123368854 CTGAGGCTGGGGAAGTGGGGAGG - Intronic
1060414483 9:123420851-123420873 CAGAGGCGGGGGAGGGAGGAGGG + Intronic
1060479351 9:124008934-124008956 CTGGGGGAGGGGGAGGTCGAGGG + Intronic
1060543328 9:124446493-124446515 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1060551822 9:124489238-124489260 CTTAAGGAGGGGTAGGTGGAGGG - Intronic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060813148 9:126621221-126621243 CTCAGCCAGGGGAGGGAGGAAGG + Intronic
1060967669 9:127720871-127720893 GGGAGGAAGGGGAAGGGGGAGGG - Intronic
1061012831 9:127965563-127965585 CTGAGGGAGGGGCAGACGGATGG - Intronic
1061277918 9:129580060-129580082 CCGAGGTTGGGAAAGGTGGAGGG + Intergenic
1061379114 9:130243693-130243715 CTGAGGCAGGGGCAGGGGTCTGG + Intergenic
1061768025 9:132894855-132894877 CTGAGGCAGGGGGATTTGGTAGG - Exonic
1062002861 9:134225571-134225593 CTGAGGCTGGGGGAGGTGACAGG - Intergenic
1062179240 9:135181893-135181915 ATCAGGCAGAGGAAGGTGGAAGG + Intergenic
1062235607 9:135506288-135506310 CTGAGGCTGGGGAAGGGCAAGGG + Intergenic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062361451 9:136190214-136190236 ATGAGGCAGGGGGAGGGGGAGGG - Intergenic
1062448365 9:136605096-136605118 CTGGGGCAGGGGAGGGCGGCAGG + Intergenic
1062594120 9:137290052-137290074 CTGAGGGAGGCCAAGGTGGGTGG - Intergenic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1203371400 Un_KI270442v1:308973-308995 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1185504415 X:620518-620540 CTGGGGCACGGGCAGGAGGAAGG + Intergenic
1185595824 X:1306130-1306152 CAGAGGCAGAGAAAGATGGAGGG + Intronic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1186372012 X:8956384-8956406 CTTAGGCAGACAAAGGTGGAAGG - Intergenic
1186481906 X:9902348-9902370 TGGAGGCATGGGAAGGTGGATGG + Intronic
1186670630 X:11764231-11764253 CACAGGCCGGGGAGGGTGGAAGG + Intronic
1186741029 X:12518037-12518059 CTGAGGCTGGGGAGACTGGATGG - Intronic
1186782677 X:12929083-12929105 CTGAGGCAGTAGAGGGTTGAGGG + Intergenic
1187409650 X:19039126-19039148 CTGAGGCATGGAAAGGTTAAAGG + Intronic
1188016513 X:25112853-25112875 CTGTGGGAGGCCAAGGTGGAAGG - Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188191285 X:27174353-27174375 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1188306751 X:28568587-28568609 ATGAATCAGGGAAAGGTGGAAGG - Intergenic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1189286268 X:39854456-39854478 CTGGGGCCGGGGAAGGAGGCTGG - Intergenic
1189437567 X:41006478-41006500 GTGAGGCAGAGGCAGGAGGATGG - Intergenic
1190101080 X:47523675-47523697 GGGAGGCAGGGGAAGGGGGGCGG - Intergenic
1190261264 X:48798948-48798970 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1191750377 X:64535881-64535903 CTGGGGGAGAGGAAGCTGGAAGG + Intergenic
1191767347 X:64712674-64712696 GTGGGGCAGGGGGAGGGGGAAGG - Intergenic
1191872301 X:65758460-65758482 CAGAGGATGGGGAATGTGGATGG + Intergenic
1192135786 X:68599105-68599127 CTGAGCCAGGGGAAGGAACAGGG - Intergenic
1192221235 X:69198703-69198725 CTGAGGTTGGGAATGGTGGAGGG - Intergenic
1192265120 X:69532369-69532391 CAGAGGCAGGGTAAGAGGGAGGG - Exonic
1192773489 X:74217521-74217543 ATGATGCAGGTGAAGCTGGAAGG - Intergenic
1194208044 X:91035205-91035227 CTTAGGGAGGCCAAGGTGGATGG - Intergenic
1194256021 X:91635062-91635084 GTGGGGTAGGGGGAGGTGGAAGG + Intergenic
1194445873 X:93986702-93986724 CTGGAGCAGGGGATGCTGGATGG + Intergenic
1195310055 X:103624143-103624165 CTGAGGCCTGGGAAGGAGGCTGG - Intronic
1195421968 X:104685619-104685641 CTGGGGTGGGGGAAGGGGGAAGG + Intronic
1195751193 X:108163072-108163094 CTGAGGCAGAGGGAGGTGACGGG + Intronic
1195923547 X:110003955-110003977 CTGAGGCAGACGAAGGAGGACGG + Exonic
1197617110 X:128705517-128705539 CTGAGGCTGGGGAGGGTTGGGGG - Intergenic
1197792636 X:130270786-130270808 CAGAGGCAGAGGAAGTTGGATGG - Intergenic
1197983572 X:132244177-132244199 GTGAGGTAGGGGGAGGGGGAGGG - Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198191860 X:134315399-134315421 CTGAGGCTGGGCAGGGTGGCTGG - Intergenic
1198441640 X:136668949-136668971 CTGAGGCAGGGTAATGAGGCTGG - Intronic
1199451343 X:147981712-147981734 CTGGGGGAGGGGGAGGGGGAGGG + Intronic
1199550250 X:149053648-149053670 CTAGGACAGGGGGAGGTGGAAGG - Intergenic
1199800746 X:151248371-151248393 CAGAGGGAGGGGGAGGGGGAGGG + Intergenic
1200031618 X:153301517-153301539 TAGAGGCTGGGAAAGGTGGAGGG + Intergenic
1200062381 X:153489313-153489335 CTGAAGGAGGGGCAGGTGCAGGG - Intronic
1200137738 X:153883175-153883197 GTGAGGCAGGGGCAGCTGGGGGG + Intronic
1200203051 X:154295706-154295728 CGGAGGGAGCGGCAGGTGGAGGG + Exonic
1200207078 X:154324234-154324256 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200402346 X:156026895-156026917 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1200431505 Y:3088330-3088352 CTGAGACGGTGGAAGGGGGAGGG - Intergenic
1200689979 Y:6297424-6297446 GTGGGGTAGGGGGAGGTGGAGGG + Intergenic
1200766888 Y:7087765-7087787 AAGAGGAAGAGGAAGGTGGAAGG - Intronic
1200958670 Y:8975590-8975612 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1201045294 Y:9877296-9877318 GTGGGGTAGGGGGAGGTGGAGGG - Intergenic
1201066944 Y:10106110-10106132 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1201219269 Y:11750965-11750987 ATTAGGGAGTGGAAGGTGGAAGG - Intergenic
1201305911 Y:12550401-12550423 TGGAGGCATGGGAAGGTGGATGG + Intergenic
1201328985 Y:12798069-12798091 GAGAGGGAGGGGAAGGGGGAGGG - Intronic
1202302745 Y:23434977-23434999 CTGAGGCAGGGGACACTGGAAGG + Intergenic
1202568066 Y:26235617-26235639 CTGAGGCAGGGGACACTGGAAGG - Intergenic