ID: 903933996

View in Genome Browser
Species Human (GRCh38)
Location 1:26882185-26882207
Sequence GTCAATCTTGTTGCCCCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1444
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 1383}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903933996_903934000 8 Left 903933996 1:26882185-26882207 CCAACTGGGGCAACAAGATTGAC 0: 1
1: 0
2: 2
3: 58
4: 1383
Right 903934000 1:26882216-26882238 TCAAAAAAAAAAAAAAAAAAGGG 0: 2396
1: 4208
2: 33959
3: 37958
4: 76294
903933996_903934001 13 Left 903933996 1:26882185-26882207 CCAACTGGGGCAACAAGATTGAC 0: 1
1: 0
2: 2
3: 58
4: 1383
Right 903934001 1:26882221-26882243 AAAAAAAAAAAAAAAGGGCCAGG 0: 302
1: 3035
2: 11178
3: 38200
4: 94407
903933996_903934003 21 Left 903933996 1:26882185-26882207 CCAACTGGGGCAACAAGATTGAC 0: 1
1: 0
2: 2
3: 58
4: 1383
Right 903934003 1:26882229-26882251 AAAAAAAGGGCCAGGTGTGGTGG 0: 15
1: 267
2: 2428
3: 19650
4: 80428
903933996_903934002 18 Left 903933996 1:26882185-26882207 CCAACTGGGGCAACAAGATTGAC 0: 1
1: 0
2: 2
3: 58
4: 1383
Right 903934002 1:26882226-26882248 AAAAAAAAAAGGGCCAGGTGTGG 0: 30
1: 337
2: 2018
3: 8126
4: 25319
903933996_903933999 7 Left 903933996 1:26882185-26882207 CCAACTGGGGCAACAAGATTGAC 0: 1
1: 0
2: 2
3: 58
4: 1383
Right 903933999 1:26882215-26882237 CTCAAAAAAAAAAAAAAAAAAGG 0: 2112
1: 2502
2: 8770
3: 40542
4: 52119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903933996 Original CRISPR GTCAATCTTGTTGCCCCAGT TGG (reversed) Intronic