ID: 903935155

View in Genome Browser
Species Human (GRCh38)
Location 1:26890326-26890348
Sequence AGGAAGTCCCGCCCTCACGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903935151_903935155 9 Left 903935151 1:26890294-26890316 CCGGACAGCGTCGGAAACGGCGA 0: 1
1: 0
2: 0
3: 1
4: 14
Right 903935155 1:26890326-26890348 AGGAAGTCCCGCCCTCACGGCGG 0: 1
1: 0
2: 2
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903935155 Original CRISPR AGGAAGTCCCGCCCTCACGG CGG Intergenic
900597752 1:3490236-3490258 AGGAAGTCCCGCTCTCCCCGCGG - Exonic
902179642 1:14678181-14678203 AGGAAGACCCACCCACAGGGTGG + Intronic
903042679 1:20543021-20543043 AGGGTCTCCTGCCCTCACGGAGG - Intergenic
903850264 1:26301525-26301547 GGGAAGCCCAGCCCTCAGGGAGG + Intronic
903935155 1:26890326-26890348 AGGAAGTCCCGCCCTCACGGCGG + Intergenic
904323851 1:29714389-29714411 GGGAAGGCCCGCCCTCAATGTGG + Intergenic
904590077 1:31608627-31608649 AGGAAGACCCACCCTCAATGTGG - Intergenic
904815758 1:33196963-33196985 AGGAAGACCCACCCTCAATGTGG + Intergenic
909899048 1:81109780-81109802 AGGAAGTGCTGCTCTCACTGAGG - Intergenic
910800004 1:91135989-91136011 AGGAAGACCCACCCTCAATGTGG + Intergenic
912566091 1:110588352-110588374 AGGAAGACCCGACCTCAGTGTGG - Intergenic
913050760 1:115114943-115114965 AGGAAGTCCCCCTCTGATGGGGG - Intergenic
913227296 1:116711419-116711441 AGGAAGACCCGCCCTCACTGTGG + Intergenic
922636889 1:227182779-227182801 AGGAAGACCCACCCTCAATGTGG + Intronic
1062767059 10:74074-74096 AGGAAGCTCCGTCCTCACGGTGG + Intergenic
1062767497 10:76572-76594 AGGAAGCTCCGTCCTCACAGTGG + Intergenic
1065366458 10:24942015-24942037 AAGAAGTCCCACCCTCACAGAGG - Intronic
1065864609 10:29903138-29903160 AGGAAGACCCACCCTCACCATGG - Intergenic
1069163495 10:65119296-65119318 AGGAAGACCCACCTTCAGGGTGG + Intergenic
1070593195 10:77815009-77815031 AGTGACTCCTGCCCTCACGGTGG - Intronic
1071251914 10:83827371-83827393 AGGAAGACCCACCCTCAATGTGG + Intergenic
1071501006 10:86204377-86204399 AGGCAGTCCAGCACTCATGGAGG + Intronic
1071673624 10:87634938-87634960 AGGAAGACCCACCCTCAATGTGG - Intergenic
1073147869 10:101292253-101292275 CCGAAGTCTCGCCCTCACGAAGG + Intergenic
1073951184 10:108811632-108811654 AGGAAGACCCACCCTCAGTGTGG - Intergenic
1073957455 10:108889707-108889729 AGGAAGACCCACCCTCAGTGTGG - Intergenic
1074184940 10:111092991-111093013 AGGAAGACCCACCCTCAATGTGG - Intergenic
1074464419 10:113668742-113668764 AGGAAGACCCACCCTCAATGTGG - Intergenic
1075854970 10:125621948-125621970 AGGAAGACCCGCCCTCAATGTGG - Intronic
1080876906 11:36283117-36283139 AGGAAGACCTGCCCTCAATGTGG - Intronic
1080963793 11:37190685-37190707 AGAAAGACCCACCCTCACTGTGG - Intergenic
1084267825 11:68013999-68014021 AGCAGGTCCCGCCCTCAAGGTGG + Intronic
1085247587 11:75116188-75116210 AGGAAGACCCACCCTCAATGTGG + Intronic
1086851494 11:91814865-91814887 AGGAAGACCCACCCTCAGTGTGG + Intergenic
1088151475 11:106750326-106750348 AGGAAGACCCACCCTCAGTGTGG - Intronic
1088687686 11:112298525-112298547 AGGAAGACCCACCCTCAACGGGG - Intergenic
1093037457 12:14346341-14346363 AGGAAGACCCACCCTCAATGTGG + Intergenic
1094057729 12:26283820-26283842 AGGAAGACCCACCCTCAATGTGG + Intronic
1094169868 12:27480267-27480289 AGGAAGACCCACCCTCAGTGTGG - Intronic
1094429808 12:30355631-30355653 AGGAAGACCTGCCCTCAGTGTGG - Intergenic
1096457142 12:51796952-51796974 AGGAAGGCCCACCCTCAATGTGG - Intronic
1098039690 12:66341376-66341398 AGGAAGACCCACCCTCAGTGTGG - Exonic
1104133436 12:125916322-125916344 AGGAAGACCCTCCCTCAATGTGG + Intergenic
1107972082 13:45653139-45653161 AGGAAGACCCACCTTCAAGGTGG - Intergenic
1108805930 13:54156566-54156588 AGGAAGACCCACCCTCAATGTGG + Intergenic
1110613402 13:77514169-77514191 AGGAAGACCCACCCTCAATGTGG - Intergenic
1113218807 13:108074356-108074378 AGGAAGACCCACCCTCTCTGTGG - Intergenic
1114204088 14:20551804-20551826 AGGAAGACCTGCCCTCAATGTGG + Intergenic
1114764096 14:25350752-25350774 AGGAAGACCCACCCTCATTGTGG + Intergenic
1118150005 14:63179252-63179274 AGGAAGACCTGCCCTCAACGCGG + Intergenic
1120687421 14:87554363-87554385 AGGAAGACCCACCCTCAACGTGG + Intergenic
1122206957 14:100152451-100152473 AGGAAGGCCCGCCCACAATGTGG + Intronic
1126692126 15:51295818-51295840 AGGAAGTCCTGGCAGCACGGAGG + Intronic
1127099005 15:55544924-55544946 AGGAATTCCCGCTCTGACTGGGG - Exonic
1128368233 15:67020074-67020096 AGGAAGTCCCCATCTCACTGTGG + Intergenic
1132348317 15:101121756-101121778 AGGGAGTCCTCCCCTCACGAGGG + Intergenic
1132793367 16:1706153-1706175 CGGAAGTCCCGCCCTCCAGCCGG - Intergenic
1133127491 16:3656205-3656227 AGGAAGCCCCTCCCTCACCTGGG + Intronic
1134397292 16:13876920-13876942 AGGAAGACCCACCCTCAATGTGG + Intergenic
1135788451 16:25371799-25371821 AGGCAGTCCAGTCCTCAGGGAGG - Intergenic
1135977849 16:27122604-27122626 AGGAAGACCCACCCTCAATGTGG - Intergenic
1138971145 16:62145218-62145240 AGGAAGACCCACCCTCAATGAGG + Intergenic
1139267777 16:65656232-65656254 AGGAAGTCATGCCCTCTGGGAGG - Intergenic
1141706130 16:85665711-85665733 AGGAAGTCCCCCAGCCACGGAGG - Intronic
1142864429 17:2782095-2782117 AGGATTTCCTGCCCCCACGGAGG + Intronic
1143353469 17:6306968-6306990 AGGAAGGCCCACCCTCAATGTGG + Intergenic
1143364885 17:6400585-6400607 AGGAAGACCCACCCTCAATGTGG + Intronic
1143582119 17:7833784-7833806 AGGAAGCCCAGGCCTCACGGAGG + Intergenic
1144306649 17:13974565-13974587 AGGAAGACCCGCCCCCACTGTGG - Intergenic
1147218279 17:38913332-38913354 ACAATGTCCCGCCCTCAGGGAGG + Intronic
1147469799 17:40648401-40648423 AGGGCTTCCTGCCCTCACGGCGG + Exonic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1152959919 18:73437-73459 AGGAAGCTCCGTCCTCACAGTGG + Intronic
1152960333 18:75921-75943 AGGAAGCTCCGTCCTCACAGTGG + Intergenic
1155741646 18:29296884-29296906 AGGAAGACCCACCCTCAGTGTGG - Intergenic
1157064470 18:44331597-44331619 AGGAAGACCCACCCTCAATGTGG + Intergenic
1157327394 18:46678953-46678975 GAGAAGTCCCGCCTTCACAGCGG + Intronic
1157798107 18:50594229-50594251 AGGAAGACCCACCCTCAGTGTGG - Intronic
1157845452 18:51000079-51000101 AGGAAGACCCACCCTCAGTGTGG + Intronic
1159269550 18:66130925-66130947 AGAAAGACCCACCCTCAAGGTGG + Intergenic
1159720836 18:71888330-71888352 AGGAAGGCCAGCCCTCAATGTGG - Intergenic
1159893881 18:73978706-73978728 AGGAAGTCCAGACCCCACAGAGG + Intergenic
1160541595 18:79626997-79627019 TGGACGTCCCACCCTCACGAGGG + Intergenic
1167507005 19:49876243-49876265 AGGAAATCCCGCCCAGACGGAGG + Intronic
1167882347 19:52470581-52470603 AGGAAGGCCCACCCTCAGTGTGG + Intronic
1168332363 19:55578095-55578117 AGGAAGAGCCGCCCTCTCCGGGG - Exonic
1168430876 19:56278939-56278961 GGGAAGATCCACCCTCACGGTGG - Intronic
1168571925 19:57477557-57477579 AGGAAGTCCCGCCCTGACGTTGG + Exonic
925152400 2:1624204-1624226 AGCAAGTCCCACCCTCTCAGGGG - Intergenic
925572508 2:5326574-5326596 AGGAAGCCCCACCCTCATTGTGG - Intergenic
926577743 2:14601030-14601052 AGGAAGACCCACCCTCAGTGTGG + Intergenic
926953775 2:18271936-18271958 AGGCAGTCCCGCACTCTTGGGGG - Intronic
930786093 2:55272913-55272935 AGTAAGTCCCGCCCACACTAAGG - Intergenic
936429973 2:112454181-112454203 AGGAAGACCCACCCTCAGTGTGG - Intergenic
937786587 2:125906367-125906389 AGGAAGTCCTACCCTCAGTGTGG + Intergenic
937993360 2:127675798-127675820 ACGCAGTCCCGCCCCCAGGGAGG + Intronic
940112451 2:150169675-150169697 AGGAAGACCTGCCCTCAATGTGG - Intergenic
941802248 2:169672740-169672762 AAGAAGACCCACCCTCAAGGTGG - Intronic
945225568 2:207529358-207529380 AGGAAAACCCGTCCCCACGGGGG + Intergenic
947015380 2:225613404-225613426 AGGAAGACCCACCCTCAATGTGG - Intronic
948344696 2:237285935-237285957 AGGAAGACCCACCCTCAATGTGG + Intergenic
948581449 2:238989671-238989693 AGGAAGGCCCACCCTCAGTGTGG - Intergenic
948908630 2:240991926-240991948 AGGAACTGCGGCCGTCACGGTGG + Intronic
1170177896 20:13493341-13493363 AGGAAGACCCACCCTCAATGTGG + Intronic
1170868031 20:20177657-20177679 AGAAATTCTTGCCCTCACGGGGG + Intronic
1171992136 20:31704621-31704643 AGGAAGTGACTCCCTCAGGGAGG + Intronic
1176419975 21:6506305-6506327 AGGAAGACCCACCCTCAGTGTGG + Intergenic
1176693093 21:9942110-9942132 AGGAAGACCCATCCTCAAGGTGG + Intergenic
1178767247 21:35466096-35466118 AGGAAGACCCACCCTCAATGTGG + Intronic
1179695466 21:43114625-43114647 AGGAAGACCCACCCTCAGTGTGG + Intergenic
1179886412 21:44316036-44316058 AGGACGCCCCGCCCTCCTGGAGG - Intronic
1180242281 21:46517817-46517839 AGGGATTCCAGCCCCCACGGGGG - Intronic
1183523723 22:38311395-38311417 AGGAAGTCCTGTCCCCAGGGAGG + Intronic
1183860269 22:40664873-40664895 AGGAAGACCCGCCCTCAGTGTGG + Intergenic
951494290 3:23309122-23309144 AGGAAGACCTGCCCTCAAAGTGG - Intronic
951999576 3:28770688-28770710 AGGAAGACCCGCCCTTAATGTGG + Intergenic
953444207 3:42948781-42948803 AGGAAGACCCACCCTCAATGTGG - Intronic
954744294 3:52778278-52778300 AGGAAGTCCCTCGCTGACAGAGG + Intronic
954819233 3:53310816-53310838 AGGAAGTCCCACCTCCAGGGTGG - Intronic
955032200 3:55232403-55232425 AGGAAGACCCACCCTCAGTGTGG + Intergenic
956080294 3:65549642-65549664 AGGCAGTCGCGCACTCCCGGGGG - Intronic
957712270 3:83877033-83877055 AGGAAGACCCACCCTCAATGTGG + Intergenic
961323711 3:126097134-126097156 AGGAAAACCCACCCTCAGGGAGG - Intronic
969602260 4:8183256-8183278 AGGAAGGCCGGCGCTCAAGGTGG + Intronic
970082085 4:12298985-12299007 AGGCAGACCCACCCTCACTGTGG - Intergenic
970088498 4:12374943-12374965 AGGCAGACCCACCCTCAAGGTGG - Intergenic
970787906 4:19821969-19821991 AGGAAGACCCACCCTCAATGTGG + Intergenic
971563898 4:28115385-28115407 AGGAAGACCCACCCTCACTGTGG + Intergenic
971981982 4:33763511-33763533 AGGAAGACCCACCCTCAATGTGG + Intergenic
979889071 4:126066427-126066449 AGGAAGACCCACCCTCAATGTGG - Intergenic
981135556 4:141207082-141207104 AGGAAGACCCACCCTCAATGTGG - Intronic
984726671 4:183028445-183028467 AGGAAGACCCACCCTCAATGTGG - Intergenic
986760752 5:10877480-10877502 AGGAAGACCCTCCCTCAATGTGG - Intergenic
987182060 5:15378316-15378338 AGGCAGACCCGCCCTCAATGTGG - Intergenic
988005224 5:25402057-25402079 AGGAAGACCAGCCCTCAGTGTGG + Intergenic
988489293 5:31692906-31692928 AGGAACGCCGGCCCTCATGGTGG - Intronic
993317494 5:86429149-86429171 AGGAAGCCCTGCCCTCAGTGTGG - Intergenic
994373681 5:98994710-98994732 AGGAAGACCCTCCCTCAACGTGG + Intergenic
994549510 5:101213123-101213145 AGGAAGACCCACCCTCAATGTGG + Intergenic
995584699 5:113636269-113636291 AGGAAGACCTGCCCTCAATGTGG + Intergenic
996976503 5:129440701-129440723 AGGAAGATCCGCCCTCAATGTGG - Intergenic
999576087 5:152978964-152978986 AGGAAGACCCACCCTCAATGTGG + Intergenic
1002660834 5:180790343-180790365 AGGAAGTCCAGGCCACAAGGTGG - Intergenic
1003236458 6:4299703-4299725 AGGAAGACCTGCCCTCAGTGTGG + Intergenic
1012096841 6:94972808-94972830 AGGAAGACCCACCCTCAATGTGG - Intergenic
1013935686 6:115590091-115590113 AGGAAGACCCACCCTCAAGCTGG - Intergenic
1014706609 6:124755351-124755373 AGGAAGACCCACCCTCAACGTGG - Intronic
1016181410 6:141152408-141152430 AGGAAGACCCACCCTCAATGTGG - Intergenic
1016778364 6:147930897-147930919 AGGAAGACCTGCCCTCAGCGTGG - Intergenic
1018090064 6:160338515-160338537 AGGAAGCCCTGTCCTCGCGGTGG - Intergenic
1020329456 7:7002848-7002870 AGGAAGACCCACCCTCAAGGTGG - Intergenic
1020978140 7:15033350-15033372 AGGCAGACCCACCCTCAAGGTGG + Intergenic
1021147404 7:17106173-17106195 AGGAAGTCCCACTCTCAGTGTGG - Intergenic
1022951542 7:35343175-35343197 AGGAAGACCCACCCTCAATGTGG - Intergenic
1022979239 7:35588657-35588679 AGGAAGCCCCACCCTCAATGTGG + Intergenic
1023868361 7:44249590-44249612 GGAAAGTCCAGCCCTCAGGGAGG - Intronic
1029424935 7:100489246-100489268 GGGAAGACCAGCCCCCACGGTGG + Exonic
1032513342 7:132489381-132489403 TGGAATTCCCGTCTTCACGGAGG - Exonic
1035744481 8:1951919-1951941 GGGAAGACCCCGCCTCACGGTGG - Intronic
1035956504 8:4086260-4086282 AGTAAGTCCCTCCCTCTTGGAGG - Intronic
1036128059 8:6082050-6082072 AGGAAGACCTGCCCTCAGTGTGG + Intergenic
1036644893 8:10606942-10606964 CGGAAGTCTCGCCCCCACTGAGG - Exonic
1037873360 8:22521228-22521250 AGGAAGTCCTGCCTTAACAGGGG - Intronic
1040356207 8:46620869-46620891 AGGAAGACCCACCCTCAAGGTGG - Intergenic
1048016550 8:130502149-130502171 AGGAAGACCTGCACTCACTGGGG - Intergenic
1049147585 8:141012836-141012858 TGGATACCCCGCCCTCACGGTGG - Intergenic
1050053189 9:1624382-1624404 AGGAAGACCCACCCTCAATGTGG + Intergenic
1050888473 9:10794270-10794292 AGGAAGACCCACCCTCAGTGTGG - Intergenic
1053095841 9:35327608-35327630 AGGAAGACCCACCCTCAATGTGG - Intronic
1057192471 9:93095586-93095608 TCCAAGTCCCGCCCTCAAGGCGG - Intergenic
1060527119 9:124326934-124326956 TGGAGGCCCCGCCCTCACTGGGG + Intronic
1061467263 9:130791496-130791518 AGGAAGACCCACCCTCAACGTGG + Intronic
1062184125 9:135207604-135207626 AGGAAGACCCACCCTCATTGTGG + Intergenic
1062737764 9:138147783-138147805 AGGAAGCTCCGTCCTCACAGTGG - Intergenic
1062738163 9:138150161-138150183 AGGGAGCTCCGTCCTCACGGTGG - Intergenic
1185823955 X:3231057-3231079 AGGAAGACCCACCCTCAGTGTGG - Intergenic
1185961340 X:4548807-4548829 AGGAAGACCCACCCTCAGTGTGG + Intergenic
1186288220 X:8068710-8068732 AGGAAGACCCACCCTCAATGTGG + Intergenic
1187801637 X:23069930-23069952 AGGAAAACCCACCCTCACTGTGG - Intergenic
1188647606 X:32590492-32590514 AGGAAGGCCCACCCTCAATGTGG + Intronic
1189596706 X:42574136-42574158 AGGAAGACCCACCCTCAGTGTGG + Intergenic
1191178512 X:57534013-57534035 AGGAAGACCCACCCTCAATGTGG + Intergenic
1192827963 X:74718380-74718402 AGGAAGACCCACTCTCACTGTGG + Intergenic
1193456120 X:81733734-81733756 AGGAAGACCCACCCTCAATGTGG + Intergenic
1193738352 X:85186627-85186649 AGGAAGTCCCACAGTCACTGTGG + Intergenic
1194521397 X:94922585-94922607 AGGAAGACCCACCCTCAATGTGG + Intergenic
1194591048 X:95800253-95800275 AGGAAGACCCACCCTCAATGTGG + Intergenic
1198030241 X:132747609-132747631 AGCAAGTCCCTCCCTCTCTGTGG + Intronic
1201751003 Y:17432129-17432151 AGGAAGACCCACCCTCAATGTGG + Intergenic