ID: 903936926

View in Genome Browser
Species Human (GRCh38)
Location 1:26902109-26902131
Sequence CATCCTTCCCCAAGTGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903936924_903936926 19 Left 903936924 1:26902067-26902089 CCCACTGTTTTGTGTTCTGGAAC 0: 1
1: 0
2: 0
3: 20
4: 199
Right 903936926 1:26902109-26902131 CATCCTTCCCCAAGTGAGTTAGG 0: 1
1: 0
2: 1
3: 13
4: 197
903936925_903936926 18 Left 903936925 1:26902068-26902090 CCACTGTTTTGTGTTCTGGAACA 0: 1
1: 0
2: 4
3: 32
4: 339
Right 903936926 1:26902109-26902131 CATCCTTCCCCAAGTGAGTTAGG 0: 1
1: 0
2: 1
3: 13
4: 197
903936922_903936926 23 Left 903936922 1:26902063-26902085 CCTTCCCACTGTTTTGTGTTCTG 0: 1
1: 0
2: 3
3: 36
4: 329
Right 903936926 1:26902109-26902131 CATCCTTCCCCAAGTGAGTTAGG 0: 1
1: 0
2: 1
3: 13
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903936926 Original CRISPR CATCCTTCCCCAAGTGAGTT AGG Intronic
900561982 1:3311755-3311777 CCTCCTTCCCCAAGGAAGCTTGG + Intronic
901291001 1:8124304-8124326 ATTCCTTCCCAAAGTTAGTTTGG + Intergenic
903523129 1:23970281-23970303 CATCATTCCCCAAGACAGTGGGG + Intronic
903681151 1:25098114-25098136 GATCCCTCCCCATTTGAGTTGGG - Intergenic
903936926 1:26902109-26902131 CATCCTTCCCCAAGTGAGTTAGG + Intronic
905293125 1:36936732-36936754 CATCCTCTGCCAAGTGAGTCTGG + Intronic
907510130 1:54951733-54951755 ATTCCTTCCCAAAGTTAGTTCGG + Intergenic
907755271 1:57304792-57304814 CATACTTCTCAAAATGAGTTAGG + Intronic
908772555 1:67609897-67609919 GATCCGTCCCCAAGTGCCTTGGG + Intergenic
911331061 1:96526280-96526302 ATTCCTTCCCAAAGTTAGTTTGG - Intergenic
911592909 1:99768155-99768177 ATTCCTTCCCAAAGTTAGTTTGG + Intergenic
912392320 1:109312169-109312191 CCTCCTGCCCAAAGTGAATTTGG - Exonic
913289926 1:117262564-117262586 ATTCCTTCCCAAAGTTAGTTTGG + Intergenic
917855696 1:179097594-179097616 AATCCTTCCCAAAGCTAGTTTGG - Intronic
924000402 1:239544287-239544309 CATCCTTCCCCCTGTGATCTAGG + Intronic
924183540 1:241463748-241463770 CACCCTTCCCCATGTGACTTGGG + Intergenic
1063221218 10:3970216-3970238 ATTCCTTCCCAAAGTTAGTTCGG - Intergenic
1065489098 10:26264863-26264885 CAGCCTTTCCTAAGTGAGTAGGG - Intronic
1067414709 10:46094520-46094542 TAATCTGCCCCAAGTGAGTTGGG - Intergenic
1067438965 10:46297564-46297586 TAAGCTGCCCCAAGTGAGTTGGG + Intronic
1067581215 10:47447293-47447315 TAACCTGCCACAAGTGAGTTGGG + Intergenic
1067723071 10:48744175-48744197 CCTCCCACCCCAAGTGGGTTGGG - Intronic
1068201600 10:53790422-53790444 CAGACTATCCCAAGTGAGTTGGG + Intergenic
1069102143 10:64335314-64335336 CATCCTTCCCTGAGATAGTTTGG + Intergenic
1070053492 10:72911908-72911930 CTTCCTCCCCCAAGTGTGTCAGG + Intronic
1070630008 10:78077683-78077705 CATCCATGCCCAAGTGAGACCGG - Intergenic
1072170330 10:92853435-92853457 CATCTTTTACCAAGTTAGTTTGG - Intronic
1072973349 10:100036766-100036788 ATTCCTTCCCAAAGTTAGTTCGG - Intergenic
1072991005 10:100193722-100193744 CATCTATCCCCAAGTTAGGTTGG + Intronic
1073478106 10:103767560-103767582 CATCCTGGCCCAAGAGGGTTCGG - Intronic
1074756709 10:116629154-116629176 CATCCTTCACCCAGTGCCTTGGG - Intronic
1075235158 10:120721310-120721332 CATCCTTCCCCATATGACTTAGG + Intergenic
1076230523 10:128816787-128816809 CATCCTTCCTCAGCTGAGTCAGG - Intergenic
1076910947 10:133389193-133389215 CATCCTTCCTCATGTTAGTGGGG + Intronic
1078253691 11:9639298-9639320 CATCTTTCCAGAAGTGAGTTGGG - Intergenic
1078381446 11:10845577-10845599 CATCCTGCCCAAAGTGTGTAAGG - Intronic
1081275233 11:41140294-41140316 CACCCTTCTCCATATGAGTTAGG + Intronic
1081553944 11:44140135-44140157 CACGCTTCAGCAAGTGAGTTGGG + Intronic
1084405908 11:68973148-68973170 ATTCCTTCCCAAAGTTAGTTGGG + Intergenic
1084944133 11:72629777-72629799 GATCATTCAGCAAGTGAGTTGGG - Intronic
1087306088 11:96490585-96490607 CATCCTTCATAAAATGAGTTAGG - Intronic
1087431816 11:98065305-98065327 GTTCCTTCCCAAAGTTAGTTTGG - Intergenic
1087887002 11:103493320-103493342 ATTCCTTCCCAAAGTTAGTTCGG + Intergenic
1088007996 11:104965607-104965629 ATTCCTTCCCAAAGTCAGTTCGG - Intronic
1088336755 11:108713926-108713948 CATCCTTTCCCACTTAAGTTGGG - Intronic
1088685721 11:112283032-112283054 CCTCCTTCACCATGTGACTTGGG - Intergenic
1089586097 11:119510737-119510759 CAACCTTCCCCACTTGAGCTGGG - Intergenic
1089879760 11:121762532-121762554 CATCCTTCCCCATCAGTGTTTGG + Intergenic
1089901414 11:121989838-121989860 CAACCTACCCCAAGTGGGTGGGG + Intergenic
1090657719 11:128858891-128858913 CATCCTTTCCCATGTGACTTTGG + Intronic
1091075890 11:132616335-132616357 AATTCTTCCCAAAGTTAGTTTGG + Intronic
1091563769 12:1633127-1633149 CAACCTGCCCCAAGTGAGGCTGG - Intronic
1093101866 12:15037818-15037840 ATTCCTTCCCAAAGTTAGTTTGG + Intergenic
1094366720 12:29690973-29690995 ATTCCTTCCCAAAGTTAGTTGGG - Intronic
1095152754 12:38814591-38814613 CTTCCTTCCCCTATTGATTTAGG + Intronic
1095795988 12:46219180-46219202 ATTCCTTCCCAAAGTTAGTTCGG + Intronic
1096237148 12:49937245-49937267 CATAATTCCTCAAGTGATTTGGG - Intergenic
1097244111 12:57596841-57596863 TTTCCTTCCCCAGGTGAGTTCGG - Intronic
1099048669 12:77756111-77756133 CATCCTTCTAGAAGTGAGTGAGG + Intergenic
1099537940 12:83867972-83867994 CTTCCTTCCCCTCTTGAGTTAGG - Intergenic
1103215793 12:119200399-119200421 ATTCCTTCCCAAAGTTAGTTCGG + Intronic
1106115124 13:26811284-26811306 CATCCTTCCCCCAGTCTGGTGGG + Intergenic
1107698279 13:43022056-43022078 CATTCCTCCCAAAGTTAGTTTGG + Intergenic
1108134352 13:47339248-47339270 ATTCCTTCCCAAAGTTAGTTTGG - Intergenic
1111619844 13:90710417-90710439 TATCCTTCCCCCAGTGAGTTAGG - Intergenic
1114537687 14:23433272-23433294 CCTCCTTCCTCAAGAGGGTTAGG + Intronic
1115534302 14:34358170-34358192 ATTCCTTCCCAAAGTTAGTTTGG + Intronic
1117305902 14:54472826-54472848 AATTCTTCCCAAAGTTAGTTCGG - Intergenic
1118089090 14:62452337-62452359 ATTCCTTCCCAAAGTTAGTTCGG + Intergenic
1118337948 14:64870455-64870477 CACCCTTCCCCACCTGAGCTTGG + Intronic
1124025157 15:25959090-25959112 ATTCCTTCCCAAAGTTAGTTTGG + Intergenic
1128308142 15:66613573-66613595 CATCCTTTTCCAAGTGGGGTTGG + Intronic
1129441086 15:75581165-75581187 ATTCCTTCCCAAAGTTAGTTCGG - Intergenic
1131008200 15:88995770-88995792 CAGCTTTCCCTAAGTGACTTTGG + Intergenic
1132163185 15:99562308-99562330 CATCCCTCCACAAGAGACTTGGG + Intergenic
1133669139 16:8000359-8000381 CATCCCTCCCTGAGTGATTTTGG + Intergenic
1133841188 16:9411165-9411187 ATTCCTTCCCAAAGTTAGTTCGG - Intergenic
1137492556 16:48945045-48945067 CTTCCTTCCCCAGGTCAGTTGGG + Intergenic
1138744973 16:59352852-59352874 ATTCCTTCCCAAAGTTAGTTTGG + Intergenic
1139738498 16:69014470-69014492 CATCCCTCCCCATGTGATTCAGG - Intronic
1145254500 17:21315275-21315297 CAACCTTCCCCAAGTAAGAGGGG - Intergenic
1146488022 17:33259936-33259958 CATTCTGCTCCAAGTGACTTTGG + Intronic
1147179741 17:38676829-38676851 CCCCCTTCCCCATGTGAGTTTGG + Intergenic
1149215537 17:54349625-54349647 CATTCCTCCCAAAGTTAGTTTGG - Intergenic
1149800355 17:59561754-59561776 CAGCCATCCCCAAGTGTATTAGG + Intergenic
1150647942 17:66991582-66991604 TATCCTTACCCATGTGAGTAGGG - Intronic
1151330410 17:73403194-73403216 CATCTTGCCCCATGTGAGCTGGG + Intronic
1152114076 17:78374105-78374127 ATTCCTTCCCAAAGTTAGTTCGG - Intergenic
1154232246 18:12567645-12567667 AATCCTTCCCCAAAGGACTTAGG - Intronic
1156933601 18:42675641-42675663 GATCCTTCCCCTAGTGTGTGTGG + Intergenic
1161840201 19:6675458-6675480 ATTCCTTCCCAAAGTTAGTTCGG - Intergenic
1162194181 19:8971628-8971650 GCTCCTTCCCCAAGTGTGCTGGG - Intronic
1162208147 19:9071237-9071259 ATTCCTTCCCAAAGTTAGTTTGG - Intergenic
1162377603 19:10314379-10314401 CATCTGTCCCCCAGTGAGATTGG - Intronic
1164749634 19:30643112-30643134 CATCCTTTCCCAAGTTATTGGGG + Intronic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
928243498 2:29606869-29606891 CATACTTCCCCAAATGTGGTGGG + Intronic
928441129 2:31293051-31293073 ATTCCTTCCCAAAGTTAGTTCGG + Intergenic
929576865 2:43057481-43057503 CATCCTGCCCCAAGGGGGCTGGG + Intergenic
930065887 2:47327282-47327304 ATTCCTTCCCAAAGTTAGTTCGG + Intergenic
930291712 2:49502249-49502271 CAACCTTAACCAAGTGATTTAGG - Intergenic
932471228 2:71960734-71960756 TTTCCTTCCCCAGGTCAGTTAGG + Intergenic
933511858 2:83249803-83249825 ATTCCTTCCCAAAGTTAGTTTGG + Intergenic
934085588 2:88506450-88506472 CATCCTTCCACCATTGAATTTGG - Intergenic
937153510 2:119702172-119702194 ATTCCTTCCCAAAGTTAGTTTGG + Intergenic
937184783 2:120030120-120030142 ATTCCTTCCCGAAGTTAGTTAGG - Intronic
937819297 2:126289870-126289892 CTTCTTTCCCCAGGTCAGTTAGG - Intergenic
940008701 2:149033397-149033419 TAACCTCCCCAAAGTGAGTTGGG - Intergenic
940255268 2:151721893-151721915 TATCCTTCCACAGGTAAGTTAGG - Intronic
941847193 2:170144882-170144904 CCTCCTTCCACAAGTAGGTTTGG - Intergenic
944646955 2:201789540-201789562 TTTCCTTCCCAAAGTTAGTTTGG + Intergenic
946765642 2:223037529-223037551 ATTCCTTCCCAAAGTTAGTTTGG + Intergenic
947120025 2:226804264-226804286 CATCCTTCCCTAAGAGATTTTGG - Intergenic
947160349 2:227208151-227208173 ATTCCTTCCCAAAGTCAGTTCGG - Intronic
947837372 2:233185278-233185300 CCTCCTTCTCCAACTGAGGTGGG + Intronic
947853536 2:233307650-233307672 CAACCTTCCCCAAGTCAGCTGGG + Intergenic
948302437 2:236917849-236917871 ATTCCTTCCCAAAGTTAGTTCGG + Intergenic
1169302439 20:4455895-4455917 ATTCCTTCCCAAAGTTAGTTTGG - Intergenic
1170290340 20:14762155-14762177 CAGCCTTCCCCAAGAGAGATTGG + Intronic
1170416558 20:16148821-16148843 TCTCTTTCCCCAAGTCAGTTAGG - Intergenic
1171142258 20:22753555-22753577 CAACTTTCCCCAAGAGAATTAGG - Intergenic
1172690385 20:36785740-36785762 CTTCCTTGCCAAAGTGACTTGGG - Exonic
1173644797 20:44626627-44626649 CAACCTTCCCCAAGTCCCTTGGG + Intronic
1174300107 20:49575673-49575695 CATCCTTCCCCAGGAGAGCCAGG + Intergenic
1175787672 20:61722397-61722419 CATCCTTCCAGAAGTGAGGAAGG + Intronic
1176875615 21:14124016-14124038 CATCCTCCAAAAAGTGAGTTTGG - Intronic
1178115024 21:29408058-29408080 ATTCCTTCCCAAAGTTAGTTTGG + Intronic
1178430721 21:32516591-32516613 CAGCCCTCCCCAAGTGGGGTAGG - Intergenic
1179113723 21:38470328-38470350 CACCTTCCCCCAAATGAGTTAGG - Intronic
1182559655 22:31149781-31149803 ATTCCTTCCCAAAGTTAGTTTGG - Intergenic
1184490073 22:44803363-44803385 GTTCCTTGCCCAAGTTAGTTTGG - Intronic
949613475 3:5728177-5728199 ATTCCTTCCCAAAGTTAGTTCGG + Intergenic
949789999 3:7782347-7782369 TTTCCTTCCCAAAGTTAGTTCGG + Intergenic
949900409 3:8810146-8810168 CATCCATAAACAAGTGAGTTGGG - Intronic
949993530 3:9599121-9599143 ATTCCTTCCCAAAGTTAGTTTGG + Intergenic
950921050 3:16695289-16695311 GTTCCTTCCCAAAGTTAGTTCGG - Intergenic
952976177 3:38698317-38698339 CAGCTTTCCCCATGTGAGGTGGG - Exonic
953010572 3:39021649-39021671 CATCCTTTCCCACATGACTTAGG - Intergenic
953093459 3:39752323-39752345 CATTATTCCCCAAGGGACTTTGG + Intergenic
955416096 3:58692804-58692826 AATCCATCCCAAAGTTAGTTTGG - Intergenic
960573013 3:119203989-119204011 CCTCCTTCCCCGAGTGACTCTGG + Exonic
962094211 3:132276867-132276889 ATTCCTTCCCAAAGTCAGTTCGG + Intronic
964403642 3:156325904-156325926 CATATTTCCTCAAGTAAGTTGGG + Intronic
964807864 3:160631284-160631306 ATTCCTTCCCAAAGTTAGTTTGG + Intergenic
968928537 4:3562909-3562931 ATTCCTTCCCAAAGTTAGTTCGG - Intergenic
970235065 4:13950401-13950423 ATTCCTTCCCAAAGTTAGTTCGG - Intergenic
970529005 4:16963097-16963119 ATTCCTTCCCAAAGTTAGTTCGG + Intergenic
973955045 4:56055207-56055229 AATCCCTCCCCAGGTGAGTGGGG - Intergenic
977345070 4:95807350-95807372 CATCCTGCTCCAAGGGAGATAGG + Intergenic
983090970 4:163501873-163501895 CTTACTTCCCAAAGTGAGTCAGG + Intronic
984257349 4:177404465-177404487 ATTCCTTCCCGAAGTTAGTTTGG + Intergenic
986558587 5:9038086-9038108 CATGCTTCCCCAAGTGCATCAGG + Exonic
988493426 5:31724657-31724679 CATCATTCCCCAAGACAGTGGGG + Intronic
989783274 5:45296145-45296167 CTTTCTTACTCAAGTGAGTTGGG + Intronic
990268819 5:54112412-54112434 CATGCTTCCTCAAGTGATTTTGG - Intronic
990517504 5:56544074-56544096 CATCATTTCCCAAGTGAGGCTGG - Intronic
990826948 5:59911046-59911068 AATTCTTCCCAAAGTTAGTTTGG - Intronic
992286675 5:75242540-75242562 ACTCCTTCCCAAAGTTAGTTTGG + Intergenic
992771287 5:80050755-80050777 ATTCCTTCCCAAAGTTAGTTCGG + Intronic
993039010 5:82790871-82790893 AATTCCTCCCAAAGTGAGTTTGG - Intergenic
994648342 5:102497705-102497727 ATTCCTTCCCAAAGTTAGTTCGG - Intronic
994672097 5:102774488-102774510 CATCCTCCCACAAGTGTTTTAGG - Intronic
996647885 5:125839331-125839353 CATCACACCCCAAGTCAGTTTGG + Intergenic
996832668 5:127756786-127756808 ATTCCTTCCCAAAGTTAGTTCGG + Intergenic
999249006 5:150170655-150170677 CCCACTTCCCCAGGTGAGTTGGG - Intronic
1000163486 5:158624290-158624312 AATCCTCCCCCAAGAAAGTTGGG - Intergenic
1001566648 5:172703839-172703861 ATTCCTTCCCAAAGCGAGTTCGG - Intergenic
1005336009 6:24796998-24797020 AATTCTTCCCAAAGTTAGTTTGG + Intergenic
1007539490 6:42627862-42627884 CATTCCTCCCAAAGTTAGTTTGG + Intronic
1009802829 6:68563653-68563675 GATCTTTCCACATGTGAGTTTGG - Intergenic
1010934606 6:81846284-81846306 CTTCCTTCCCCAAGTGAACAAGG + Intergenic
1011533419 6:88350372-88350394 CTTGCTTCCCCAAGTTACTTTGG - Intergenic
1013436217 6:110110478-110110500 CATCCTTTACCAAGGAAGTTTGG - Intronic
1016855980 6:148671193-148671215 CCTCCTTCCCCCAGGGAGATGGG + Intergenic
1017906408 6:158760028-158760050 CATCCTTCTCCCAGTGGGGTGGG - Intronic
1018188971 6:161291888-161291910 ATTCCTTCCCAAAGTTAGTTCGG - Intergenic
1022441380 7:30436188-30436210 CATCCTGCCCCGAGTGAGCCTGG - Intronic
1022649394 7:32260694-32260716 ATTCCTTCCCAAAGTTAGTTCGG - Intronic
1024315841 7:48015838-48015860 ATTCCTTCCCAAAGTTAGTTTGG - Intronic
1026533941 7:71224522-71224544 CATCCTTACCCATGTGTGCTTGG + Intronic
1027685606 7:81276517-81276539 GGTCCTTCCTCAAGTGAATTGGG - Intergenic
1027900789 7:84111987-84112009 CCTCCTTCCCCAAGAGAATAGGG + Intronic
1031308129 7:120159879-120159901 CATCATTTCCAAAGTGACTTAGG + Intergenic
1039509862 8:38082614-38082636 CATCCTCCAAAAAGTGAGTTTGG + Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1041647250 8:60265484-60265506 CCTCCCTCCCCAAGTGGCTTGGG + Intronic
1052244699 9:26320411-26320433 CATCCTTCTCCAAAGGAGATAGG - Intergenic
1052674581 9:31603935-31603957 CATTCTTCTCCATGTTAGTTAGG - Intergenic
1053803418 9:41778051-41778073 ATTCCTTCCCAAAGTTAGTTCGG - Intergenic
1054141845 9:61537073-61537095 ATTCCTTCCCAAAGTTAGTTCGG + Intergenic
1054461603 9:65468248-65468270 ATTCCTTCCCAAAGTTAGTTCGG + Intergenic
1054871969 9:70055450-70055472 CATCCAACTCCAAGTGAATTAGG - Intronic
1055318799 9:75061510-75061532 AATCCTTCCTGAAGTGAATTAGG - Exonic
1055453898 9:76455458-76455480 CACCTTTCCCCAAATGACTTAGG - Intronic
1059692238 9:116697070-116697092 AAGCCTTCCCCAAGTCTGTTAGG + Intronic
1060204611 9:121675177-121675199 CATCCTTCCTAAAGTGATCTGGG + Intronic
1060881234 9:127119653-127119675 CCTCCATCCCCCAGTGATTTAGG - Intronic
1061679865 9:132237682-132237704 CCTCCCTCCCCAAGGGAGCTGGG + Intronic
1061844928 9:133382176-133382198 CAACCTTCCCCATGTGGGTAAGG + Intronic
1185776111 X:2804274-2804296 ATTCCTTCCCAAAGTTAGTTGGG + Intronic
1186071602 X:5826892-5826914 ATTCCTTCCCAAAGTTAGTTCGG + Intergenic
1186153011 X:6695647-6695669 ATTCCTTCCCAAAGTTAGTTTGG - Intergenic
1187410590 X:19047524-19047546 CATTCTTCCCCAAGTTGGATGGG + Intronic
1188021782 X:25166732-25166754 CATCCGTCCCCAAGTTTGTTCGG + Intergenic
1193700077 X:84749258-84749280 ATTCCTTCCCAAAGTTAGTTTGG - Intergenic
1194111252 X:89837236-89837258 CGTTCCTCCCCAAGTTAGTTTGG + Intergenic
1194393783 X:93354538-93354560 ATTCCTTCCCAAAGTTAGTTCGG - Intergenic
1198213039 X:134532844-134532866 ATTCCTTCCCAAAGTTAGTTTGG - Intergenic
1198325463 X:135567141-135567163 CATCCTTAGCTCAGTGAGTTTGG - Intronic
1199993455 X:153003542-153003564 ATTCCTTCCCAAAGTTAGTTTGG - Intergenic
1200463913 Y:3491979-3492001 CGTTCCTCCCCAAGTTAGTTTGG + Intergenic
1201293887 Y:12447435-12447457 ATTCCTTCCCAAAGTTAGTTGGG - Intergenic