ID: 903938013

View in Genome Browser
Species Human (GRCh38)
Location 1:26910037-26910059
Sequence GACACAGGTCTGCCTACTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903938007_903938013 17 Left 903938007 1:26909997-26910019 CCTGGGCTCACAGACTCCAAGAG 0: 1
1: 1
2: 6
3: 33
4: 293
Right 903938013 1:26910037-26910059 GACACAGGTCTGCCTACTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 86
903938011_903938013 -9 Left 903938011 1:26910023-26910045 CCTGAAGATGCACAGACACAGGT 0: 1
1: 0
2: 0
3: 16
4: 230
Right 903938013 1:26910037-26910059 GACACAGGTCTGCCTACTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 86
903938009_903938013 1 Left 903938009 1:26910013-26910035 CCAAGAGGATCCTGAAGATGCAC 0: 1
1: 0
2: 0
3: 15
4: 169
Right 903938013 1:26910037-26910059 GACACAGGTCTGCCTACTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903938013 Original CRISPR GACACAGGTCTGCCTACTTA GGG Intronic
901022463 1:6262086-6262108 GACACAGGGGTGCCTAGTCATGG - Intergenic
902342607 1:15793960-15793982 GACACAGGTCTCCCTCCAAAAGG - Intergenic
903938013 1:26910037-26910059 GACACAGGTCTGCCTACTTAGGG + Intronic
905299362 1:36976050-36976072 ATCACAGGTCTTCCTACTTTGGG - Intronic
907387605 1:54136192-54136214 CACACAGCTCTGCATACTAAAGG + Intronic
909344526 1:74570826-74570848 GACACAGATCTCACTACTTCAGG + Intronic
912769430 1:112449876-112449898 AGCACAGGTTTGCCTTCTTAGGG - Intronic
916996553 1:170307739-170307761 GACACAGTTCTGCTTATTCAAGG - Intergenic
920206783 1:204298067-204298089 GACACATGTCTGACTACTTGTGG - Intronic
921036463 1:211383486-211383508 TTCTCATGTCTGCCTACTTAAGG - Intergenic
922760348 1:228125655-228125677 GTCACAGGTCAGACAACTTAGGG + Intergenic
924161262 1:241234636-241234658 CACCCTGGTCTGCCTACTTCTGG + Intronic
924647434 1:245891670-245891692 GACAAAGGTCAGCTTACTTCTGG + Intronic
1067819645 10:49517444-49517466 CACACATGTCTGCCTCCTGAGGG - Intronic
1069922421 10:71824309-71824331 GACACAGGGCTGCCCAAGTAAGG + Intronic
1070295901 10:75161261-75161283 GAAATAAGTCTGGCTACTTAAGG - Intronic
1070660282 10:78300732-78300754 GAGCCAGGTCTGCCGACTCAGGG - Intergenic
1079092294 11:17489479-17489501 GACCCAGGTCTGGCTAATCAGGG + Intergenic
1080206988 11:29741065-29741087 AACATAGGCCTGCCTACTTTGGG - Intergenic
1081535527 11:43993413-43993435 GACACAGCTCAGCCCACTTCTGG - Intergenic
1083584596 11:63847564-63847586 TACAAAGGTCTGCCTCCTTTGGG + Intronic
1092009394 12:5097050-5097072 GACAAAGGCCTGCTTTCTTATGG - Intergenic
1096098341 12:48952729-48952751 AACAGAGAACTGCCTACTTAGGG + Intronic
1099193369 12:79583938-79583960 GATACAGGTCTGCCTGGTGAAGG - Intronic
1100499784 12:95162659-95162681 GACACACCTCTGCCTGATTATGG - Intronic
1101266516 12:103093953-103093975 GACTCTGGTCTGTATACTTAAGG + Intergenic
1101852896 12:108418399-108418421 GACACAAGTCATCCTATTTAGGG + Intergenic
1103907098 12:124333307-124333329 GTCAGAGGTCTCCCTACTGAGGG + Intronic
1104040227 12:125125070-125125092 GGCAGAGGTGTGCATACTTATGG - Intronic
1107959517 13:45545745-45545767 GACACAGGTGTCCCTACACAGGG - Intronic
1110196076 13:72790010-72790032 GACAGAGGTCCCCCTTCTTATGG + Intronic
1112469801 13:99677042-99677064 GACACAGGTCTACGAACCTAAGG - Intronic
1112632605 13:101178999-101179021 GACAGAGGGCAGGCTACTTAAGG + Intronic
1113931969 13:113973483-113973505 GACACAGGGCTGCATTCTTTGGG - Intergenic
1115454580 14:33587340-33587362 GACACTGGACTGCCATCTTAAGG - Intronic
1120780325 14:88480540-88480562 GGCATGGCTCTGCCTACTTAAGG + Intronic
1120903821 14:89601690-89601712 GAGACAGGTCAGCCTTCTTATGG + Intronic
1121571869 14:94952256-94952278 GACACAGGCCTGCATTCATATGG + Intergenic
1125675414 15:41499766-41499788 GACACAGGGCTGCCGAGTTGCGG + Intronic
1126333066 15:47554987-47555009 GAAAAAGCACTGCCTACTTACGG - Intronic
1127124833 15:55801778-55801800 GACCCAGCACTGCCTACTTCTGG + Intergenic
1131327230 15:91459592-91459614 ATCAAAGGTCAGCCTACTTAGGG - Intergenic
1147952160 17:44113262-44113284 GAAACAGGACTTCCTGCTTAGGG + Intronic
1151669453 17:75564059-75564081 GAAACAGGGCTGCCAACTAAAGG - Intronic
1152002913 17:77657932-77657954 CACACACTTCTGCCTTCTTACGG + Intergenic
1152295919 17:79466836-79466858 GCCACAGGTCTCCCCACCTAGGG + Intronic
1153574598 18:6507943-6507965 GGCACAGCCCTGCCTACATAGGG - Intergenic
1156144052 18:34154016-34154038 GACACATGTCTGACTCCTTTTGG - Intronic
1166561317 19:43734126-43734148 GCCCCAGGTCTGCCTATTTCTGG - Intronic
925364010 2:3298809-3298831 GACACTGGAATGCCTTCTTATGG - Intronic
937982519 2:127623851-127623873 GACTCATGTCTGCCTCCTTAGGG + Intronic
939995795 2:148918322-148918344 GAAACAGGTTTGCCTACATGGGG + Intronic
941279468 2:163532292-163532314 AACATAGGTTTTCCTACTTATGG - Intergenic
942501346 2:176593878-176593900 GATACAGGTTTGCCTTTTTAGGG + Intergenic
943191287 2:184681978-184682000 GACACATGTGTGCATGCTTAGGG + Intronic
943922071 2:193721451-193721473 GACACAGGTCTGCATATTGAAGG - Intergenic
944094020 2:195946438-195946460 AACACAGGTCTGGCTGCTGAGGG - Intronic
946637960 2:221751324-221751346 GACACTGCTCTGTCTACCTAAGG - Intergenic
947909546 2:233792109-233792131 GACACAGGCCAGCCTCCTTCAGG - Intronic
948297087 2:236868713-236868735 CACACTGGTCTCCCCACTTATGG + Intergenic
1169586666 20:7093343-7093365 GACAAAGGTCTATGTACTTAAGG - Intergenic
1170957193 20:20991952-20991974 GACACAGGGCTGCATCCTGAGGG - Intergenic
1174945751 20:54983546-54983568 GAGACAGCTCTGCCCTCTTAGGG - Intergenic
1185136692 22:49077484-49077506 GACACAAGTCTGTCTACATGTGG - Intergenic
954616437 3:51970999-51971021 GACTCAGGTCTCACTCCTTAGGG + Intronic
958162147 3:89831402-89831424 GACAAAGGTCTTTATACTTATGG - Intergenic
958990255 3:100835089-100835111 GACCCAGGCCTGCCTGCTTTTGG + Intronic
961569188 3:127786004-127786026 CACACAGGTGTGCCTACTCCAGG + Intronic
964955450 3:162350208-162350230 GACAGGGTTATGCCTACTTAAGG - Intergenic
966094859 3:176187801-176187823 GACAGAGCTCTTCCCACTTAAGG - Intergenic
968641249 4:1716246-1716268 GACACAGGTGTGGCTACTGGAGG - Exonic
974587448 4:63897261-63897283 GACACAGTTCTGCATAGATAGGG + Intergenic
975745777 4:77472869-77472891 GCCAGAGGTGTGCCTAGTTATGG - Intergenic
983698755 4:170565880-170565902 GAGACAAGTCTGAATACTTATGG + Intergenic
992024654 5:72658343-72658365 TAAACAGGTCTGCCTACATCTGG + Intergenic
992269415 5:75050861-75050883 GACCCAGCCCTGTCTACTTAGGG + Intergenic
993101587 5:83547096-83547118 GATCCAGGTATGCCTACTTAGGG + Intronic
1001380068 5:171299659-171299681 GAAGCAGCTCTGCCTTCTTAGGG + Exonic
1011333327 6:86234152-86234174 GACACAGGTTTGTCTACTCTTGG + Intergenic
1032515870 7:132505845-132505867 GAGACAGGTCTGTGAACTTACGG - Intronic
1033627944 7:143129247-143129269 GCCTCAGGGCTTCCTACTTATGG + Intergenic
1034401482 7:150864409-150864431 GACCAAGCTCTGCCTACTTGAGG - Intergenic
1037100492 8:15038290-15038312 GAAATAAATCTGCCTACTTACGG + Intronic
1040836473 8:51736706-51736728 CACAAAGGTCTGTCTACCTAAGG - Intronic
1045048892 8:98305032-98305054 GACTCAGGCCTGCCCACTTTTGG - Intergenic
1046618399 8:116501874-116501896 GATACAGATCTTCCTATTTAAGG - Intergenic
1050636344 9:7616937-7616959 GACAAAGGTCTGCATACCAAAGG + Intergenic
1052977219 9:34420228-34420250 CACACAGATCAGCCTATTTAAGG + Intronic
1053267106 9:36723507-36723529 GACCCAGGTCTGCCTGCTCCTGG + Intergenic
1062665598 9:137669667-137669689 GACACAAGTCTGTGTACTAAAGG - Intronic
1186365503 X:8888650-8888672 AACAGAAGTCTGCCTACTGATGG - Intergenic
1189999632 X:46673492-46673514 GACACAGTTCTGCCTCCTCAAGG + Intronic
1200277997 X:154751992-154752014 GACACAGCTCTGGCTGCCTATGG - Intergenic