ID: 903939119

View in Genome Browser
Species Human (GRCh38)
Location 1:26916697-26916719
Sequence ACCTGTAATCTGGACTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903939112_903939119 6 Left 903939112 1:26916668-26916690 CCAAGAACTGGCCGGGCACGGTG 0: 3
1: 10
2: 70
3: 350
4: 1466
Right 903939119 1:26916697-26916719 ACCTGTAATCTGGACTTTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 197
903939114_903939119 -5 Left 903939114 1:26916679-26916701 CCGGGCACGGTGGCTCACACCTG 0: 5442
1: 34090
2: 96783
3: 140914
4: 159590
Right 903939119 1:26916697-26916719 ACCTGTAATCTGGACTTTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903939119 Original CRISPR ACCTGTAATCTGGACTTTGG GGG Intronic
900999699 1:6142648-6142670 GCCTGTAGTGTGGACTCTGGTGG - Intronic
902161265 1:14532240-14532262 CCCTGGACTCTGGGCTTTGGAGG - Intergenic
903939119 1:26916697-26916719 ACCTGTAATCTGGACTTTGGGGG + Intronic
904148388 1:28414635-28414657 GCCTGTAATCTCAACTTTTGGGG - Intronic
907744428 1:57198738-57198760 ACGTGTAAGCTGGACTCTGGAGG + Intronic
907943737 1:59113373-59113395 ACCTCTAATCAGGAATTTGCTGG + Intergenic
908541759 1:65128981-65129003 ACCTGTAAGCTGGACCATGAGGG + Intergenic
909730159 1:78879664-78879686 ATCTGCAAACTGGATTTTGGGGG - Intergenic
917162300 1:172071370-172071392 ACCTCTAATATGGACTTGTGTGG + Intronic
919187042 1:194164657-194164679 ACATTTTATCTGGACTGTGGGGG + Intergenic
920267928 1:204739572-204739594 ACCTGTAATCCCTACTTTGGAGG - Intergenic
920361213 1:205417719-205417741 TCCTGTAATCCCGACATTGGAGG - Intronic
922369188 1:224892423-224892445 ATCTGCAAACTGGATTTTGGGGG - Intergenic
922402914 1:225279128-225279150 ACCTGTAATCCCTACTTGGGAGG - Intronic
924557122 1:245128051-245128073 ACCTGTAGCCTGTACTTGGGAGG + Intergenic
924920435 1:248623395-248623417 CTCTGTAATCTTGGCTTTGGTGG - Intergenic
1063310770 10:4949766-4949788 AGCTGCAATCTGGATTCTGGGGG - Intronic
1063602477 10:7494860-7494882 ACCTGCCTTTTGGACTTTGGGGG - Intergenic
1063763310 10:9106989-9107011 ACCTGCAATCTGGGATTTGGGGG + Intergenic
1065564881 10:26998389-26998411 GCCTGTCTTCTGGACTTTTGGGG + Intronic
1070020800 10:72583535-72583557 ACCTGTAATCATGCCTTGGGAGG - Intronic
1070635919 10:78127280-78127302 ACCTGGAAGCAGGACTCTGGAGG + Intergenic
1077437792 11:2551206-2551228 ACCTTGGATCTTGACTTTGGGGG - Intronic
1079387115 11:19990283-19990305 ACCTGTGATCTTGACATTGCAGG - Intronic
1079554497 11:21741917-21741939 ACTTGTAGTCTTCACTTTGGAGG - Intergenic
1079569220 11:21921940-21921962 ACTTGTAACATGGAGTTTGGAGG + Intergenic
1085461962 11:76699526-76699548 CCCTCTAGTCTGGACTGTGGGGG - Intergenic
1087296070 11:96375703-96375725 ACATGAAATCTGGACTTAGATGG - Intronic
1087592135 11:100203519-100203541 ACTTGAAAACTGGATTTTGGTGG - Intronic
1088494479 11:110419465-110419487 GCCTGTCTTCTGGATTTTGGGGG - Intergenic
1089227370 11:116936949-116936971 ACCTTTAAGCTGGACTTTAAAGG - Intronic
1089322057 11:117633109-117633131 CTCTGTCATCTGGAATTTGGGGG + Intronic
1089821316 11:121229094-121229116 AGCTGGAATCTGGACTGTGAAGG + Intergenic
1092271181 12:7024644-7024666 GCCTGTAATTGGCACTTTGGGGG + Intronic
1093024792 12:14235800-14235822 ATCTGCAAACTGGATTTTGGGGG - Intergenic
1093048919 12:14484946-14484968 GCCTGTTAACTGGGCTTTGGTGG - Intronic
1094199550 12:27781594-27781616 ACCTGTAACACTGACTTTGGGGG + Intronic
1094499764 12:31011356-31011378 ACCCCTGATCTTGACTTTGGAGG - Intergenic
1096144923 12:49272085-49272107 GCCTGTAATCAACACTTTGGGGG - Intronic
1096795828 12:54077054-54077076 ACCTGGAATCTGGAAATTTGGGG - Intergenic
1096905481 12:54931707-54931729 ACCTGCAAACTGGATTTTGGGGG + Intergenic
1097430048 12:59494186-59494208 AGCTGAAATCTGGACATTAGTGG + Intergenic
1098970676 12:76852564-76852586 ACCTGTAATCTGCATTTTACAGG - Exonic
1100473025 12:94910622-94910644 ACCTGTAATCCCTACTTGGGAGG + Intronic
1102357949 12:112255716-112255738 ACCTGTCATGTGGTCTTAGGGGG - Intronic
1103853737 12:123950305-123950327 CCCTGTGCTCTGGACTCTGGAGG - Intronic
1106626213 13:31423597-31423619 ACCTGTAATCTGAACTATTAAGG - Intergenic
1106808591 13:33336492-33336514 ACCTGTAATCTCAACATTTGGGG + Intronic
1111300499 13:86342925-86342947 ATCTATAATCTTAACTTTGGAGG - Intergenic
1113815030 13:113163637-113163659 AGCAGAAATCTGGACTTCGGAGG - Intronic
1115569550 14:34653761-34653783 ATCTGCAAACTGGATTTTGGGGG - Intergenic
1116258588 14:42590104-42590126 ACCTGAAATATGAACTTCGGGGG - Intergenic
1116604520 14:46972597-46972619 ACCTGTTATCTGGAATGTGTGGG - Intronic
1118959490 14:70515868-70515890 CGCTGTAATCAGGACCTTGGTGG + Intergenic
1119099103 14:71863324-71863346 ACCTGTAATGTGTTCTTTGCTGG + Intergenic
1120034035 14:79675200-79675222 ACTTGTTATTTGGCCTTTGGGGG - Intronic
1122458493 14:101876258-101876280 AACTGTAATTTGGCCTTTGATGG + Intronic
1123099028 14:105783242-105783264 AGCTGTAATTTGGGCCTTGGTGG + Intergenic
1124795726 15:32776272-32776294 TACTGAAAACTGGACTTTGGAGG + Intronic
1126673100 15:51134371-51134393 AACTGTTATCTGGACCTTTGTGG + Intergenic
1127400484 15:58580399-58580421 GCCTGTAATCAGCACTTTGTGGG - Intergenic
1136034029 16:27525027-27525049 GCCTGTAATCTCTACTTGGGAGG + Intronic
1137835475 16:51588359-51588381 ACCTGTAATCTCGACTATTTAGG + Intergenic
1141283614 16:82651002-82651024 ACCTGTCATGTGGTTTTTGGGGG + Intronic
1141742095 16:85900237-85900259 ACCTGTAATCTGGATTAGGTGGG + Intronic
1142001613 16:87667520-87667542 ACCCTTTATCTGGTCTTTGGGGG + Intronic
1142770146 17:2090747-2090769 ACCTGTAAACTTGAGTTTGTGGG - Intronic
1151322558 17:73360559-73360581 ACCAGTAACAGGGACTTTGGAGG + Intronic
1151412000 17:73937189-73937211 ACCAGTCATCTGGACATTGCTGG - Intergenic
1151766038 17:76133601-76133623 ACCTGCAATCTCCACTTTTGGGG - Intergenic
1151806459 17:76408700-76408722 ACCTGTCATTTGCTCTTTGGAGG - Intronic
1152143692 17:78554313-78554335 ACCTGTAATCCCTACTTGGGAGG + Intronic
1152454673 17:80406954-80406976 ATCTGCAAACTGGATTTTGGAGG - Intergenic
1203167178 17_GL000205v2_random:108075-108097 GCCTGTAATCTGAACATTTGGGG - Intergenic
1157060210 18:44279197-44279219 ACGTATAAGCTGTACTTTGGGGG + Intergenic
1158153154 18:54394635-54394657 ACCTGTAATCTGAACTATTCGGG - Intergenic
1160309970 18:77779899-77779921 AACTCTAATCTGGAGTTTGGTGG - Intergenic
1160602674 18:80025863-80025885 ACCTGTCTTCTGGATTTGGGGGG - Intronic
1160867332 19:1261683-1261705 ACCCGTGGCCTGGACTTTGGGGG + Intronic
1161095972 19:2390907-2390929 ACCTGTAATCTCAACTTTTTGGG + Intronic
1161682887 19:5688885-5688907 ACCTGTAATCTGAACTATTTGGG - Intronic
1161813158 19:6482111-6482133 ACCTGTAAAGTGGACGGTGGGGG + Intronic
1163495223 19:17642669-17642691 ACCCTGAATCTGGACTTTGATGG + Intronic
1164813805 19:31178786-31178808 GGCTGTCATCTGGACCTTGGAGG + Intergenic
1167235162 19:48309902-48309924 ACTTGGCATCTGCACTTTGGGGG - Intronic
1168653809 19:58112292-58112314 ACCTGTAATCGGGACATTTTGGG - Intronic
927470716 2:23374007-23374029 ACCTGGAATGTGGCATTTGGTGG - Intergenic
929323634 2:40578194-40578216 ACCTGGAATTTATACTTTGGGGG + Intronic
930098311 2:47583980-47584002 ATCTGCAAACTGGATTTTGGGGG + Intergenic
930651334 2:53967745-53967767 ACCCGTAATCTGGACATCAGAGG - Intronic
930967492 2:57347943-57347965 ACATTTAATTTGGAATTTGGAGG - Intergenic
932157387 2:69430570-69430592 ACCACTAATCTGTATTTTGGGGG - Intronic
932675845 2:73780168-73780190 ATCTGTAAACAGGACTTTGGTGG + Intergenic
934953249 2:98593581-98593603 ATAGGTAATCTGGACCTTGGGGG - Intronic
935053135 2:99541204-99541226 ACCTAAAATCTTCACTTTGGGGG - Intergenic
937021455 2:118660582-118660604 ACATGTAATTTGTACTTTTGTGG - Intergenic
937584142 2:123525573-123525595 ATCTGTAATCTGGTTGTTGGAGG - Intergenic
938280278 2:130059209-130059231 ACCTGTGGTCTGGAGGTTGGTGG - Intergenic
940178214 2:150902912-150902934 ACCTGTTATTTGGATTTGGGGGG - Intergenic
940726827 2:157344177-157344199 ATCTGCAAACTGGATTTTGGGGG - Intergenic
943456752 2:188117964-188117986 TCCTGTAGTTTGGACTCTGGAGG - Intergenic
1169312396 20:4555373-4555395 AACTCTAAACTGGTCTTTGGAGG + Intergenic
1169530253 20:6477400-6477422 ACCTGTAATCTGACTTTTGGAGG + Intergenic
1170209399 20:13833642-13833664 AAATGTAATCTGGACTTAGGGGG + Intergenic
1170656389 20:18290867-18290889 ACCTGTAATCAGCACTTTGGGGG + Intronic
1171367522 20:24636057-24636079 CACTGTTGTCTGGACTTTGGGGG + Intronic
1171850151 20:30302158-30302180 AAATGTAAGCTGGACTGTGGAGG - Intergenic
1174172340 20:48625473-48625495 ACCTGGAATGTGGACGTTGAAGG + Exonic
1176404581 21:6351024-6351046 GCCTGTAATCTGAACATTTGGGG + Intergenic
1176432576 21:6638080-6638102 GCCTGTAATCTGAACATTTGGGG - Intergenic
1176641141 21:9304888-9304910 GCCTGTAATCTCAGCTTTGGAGG + Intergenic
1180350163 22:11794270-11794292 GCCTGTAATCTCAGCTTTGGAGG + Intergenic
1180388049 22:12197982-12198004 GCCTGTAATCTCAGCTTTGGAGG - Intergenic
1181176377 22:21039278-21039300 ACCTGTAATCTCAACCTTGTGGG + Intergenic
1181449399 22:23008551-23008573 ACCTGTAACCTAGGCTTGGGAGG - Intergenic
1181665071 22:24389370-24389392 ATCTGTAATCAGCACTTTGGGGG - Intronic
1182566680 22:31205435-31205457 ACCTGGAGTCAGGACTTTGGTGG + Exonic
1184414394 22:44343762-44343784 ACCTGGACTCTGGAGTATGGCGG + Intergenic
1185226105 22:49653766-49653788 ACCTGTAATCCCAACTTGGGAGG - Intronic
951123161 3:18952107-18952129 ACCTGTAAATTGGGCCTTGGAGG + Intergenic
951929897 3:27953290-27953312 ACCTGTAATCTGTACTCGGGAGG + Intergenic
952297603 3:32074947-32074969 ATCTGCAAACTGGATTTTGGGGG - Intronic
952424611 3:33162825-33162847 GCCTGTAATCTGAACCTGGGAGG + Intronic
952975310 3:38689141-38689163 ACCAGTAACCTTGACTTTTGTGG + Intergenic
954712385 3:52511659-52511681 ACCTGCAAGCTGGGCTTTGCCGG + Exonic
958755867 3:98248566-98248588 ATCTGCAAGCTGGATTTTGGGGG - Intergenic
960183915 3:114615579-114615601 TCCTGTACTCTGAACTTTGTTGG + Intronic
963853979 3:150235433-150235455 AGGTGTAAGCTGGACCTTGGAGG + Intergenic
964527543 3:157631218-157631240 ACCTGGAGACTGGACTCTGGGGG - Intronic
965266419 3:166549615-166549637 AGCTGTAATCTGAACTTCAGTGG + Intergenic
967690902 3:192472543-192472565 CCCTGGAATGTGGGCTTTGGGGG - Intronic
967699908 3:192579827-192579849 ACCTGTAATCTGAGCATTTGGGG - Intronic
1202745753 3_GL000221v1_random:100138-100160 GCCTGTAATCTCAGCTTTGGAGG - Intergenic
968553431 4:1235906-1235928 ACCTTGAATCTGGATTTTTGGGG - Intronic
969496028 4:7526652-7526674 ACCTGAACTCTGCACTCTGGTGG + Intronic
970446076 4:16124303-16124325 ACCTGTAATGTGGACATTAAAGG - Intergenic
970709260 4:18842879-18842901 TCCTGTTAGCTGGACTATGGGGG - Intergenic
972262280 4:37421280-37421302 GGTTGTAATCTGTACTTTGGAGG + Intronic
973211303 4:47618395-47618417 AAATGTGATCTTGACTTTGGAGG + Intronic
975945099 4:79696391-79696413 TCCTGTAATCTGGATTTTTCAGG + Intergenic
977368392 4:96102179-96102201 ACCTGTAATCCCCACTGTGGAGG + Intergenic
979558481 4:122076963-122076985 ACCTGGAGTCAGGACTTTGGTGG - Intergenic
980715122 4:136617637-136617659 ATCTGCAAGCTGGATTTTGGGGG - Intergenic
980771042 4:137373724-137373746 ACATGTAATATGGACCTTAGAGG - Intergenic
982315635 4:154028733-154028755 ACTGGTTATCTGGATTTTGGTGG - Intergenic
982556727 4:156875791-156875813 GCCTGTAATCTGAACCTGGGAGG + Intronic
983569972 4:169195936-169195958 ACCTGTAAACTGAACTGGGGAGG - Intronic
984235153 4:177147860-177147882 ATCTGCAATCTGGTCTTAGGTGG - Intergenic
984651446 4:182274947-182274969 GCCTGTAATCTGAACTATGCGGG - Intronic
984729524 4:183054636-183054658 ACCTGTAATCTCAGCTCTGGAGG - Intergenic
986705846 5:10454246-10454268 GCCTGTAATCCCGACTTGGGAGG - Intronic
989990064 5:50752849-50752871 TGATGTAATCTTGACTTTGGAGG - Intronic
991903204 5:71480686-71480708 ACCTGTAATCCCAACTTGGGAGG - Intronic
992400551 5:76407333-76407355 ACCTGGAAACTGGAGTTTTGGGG + Intronic
993592757 5:89815110-89815132 ATCTGTAATCTGAACTTTCCTGG - Intergenic
993933060 5:93966696-93966718 ACATGTGATCTGTATTTTGGAGG - Intronic
995637632 5:114212798-114212820 ACCTATAATCTGGACTCTAATGG - Intergenic
996945843 5:129066719-129066741 ATCTGTAGTCTGGAATTTGAAGG - Intergenic
997158308 5:131580884-131580906 ATCTGCAAGCTGGATTTTGGGGG - Intronic
999404422 5:151294204-151294226 ACATGCAGTCTGGATTTTGGGGG + Intronic
1000808278 5:165825901-165825923 ACTTGTCATCTGAACTTCGGAGG - Intergenic
1003882693 6:10492911-10492933 ACCTGTAATCCATACTTGGGAGG - Intronic
1004644845 6:17550641-17550663 AGTTGTAATATGGTCTTTGGGGG + Intronic
1005277610 6:24236883-24236905 ACCTGTAATCTGGCCACTTGGGG + Intronic
1005345116 6:24881717-24881739 ACAGGTACACTGGACTTTGGTGG + Intronic
1006330453 6:33386614-33386636 ACATTTAATCTCAACTTTGGTGG + Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007322583 6:41038362-41038384 ATCTGGACTCTGGTCTTTGGTGG - Intronic
1008130982 6:47720157-47720179 CCCTCCACTCTGGACTTTGGAGG - Intronic
1008466168 6:51833103-51833125 ACATTTTATCTGGACTTTGTGGG - Intronic
1012432080 6:99174532-99174554 ACCTGTAATTTGTACTTGGGAGG + Intergenic
1013037751 6:106403074-106403096 ACCTGTAATCACGCCTTGGGAGG + Intergenic
1013485409 6:110591540-110591562 ACCGGTAAACTGGCATTTGGGGG + Intergenic
1013954247 6:115821963-115821985 ATGTGTAATGTGGACTTTGTAGG + Intergenic
1014020703 6:116585427-116585449 ACCTGTAATCTGGGCTTGGCAGG + Intronic
1014276176 6:119392593-119392615 AACTTTAATCTGCATTTTGGGGG + Intergenic
1016890264 6:148999181-148999203 ACTTGTATTCTGGACTTTACTGG + Intronic
1017022895 6:150154967-150154989 ACCTATAATATTGGCTTTGGGGG + Intronic
1017161354 6:151368882-151368904 ACCTGTAATCCCAACTTGGGAGG - Intronic
1017413467 6:154194575-154194597 AAGTGTAATCTAGAGTTTGGAGG - Intronic
1017922078 6:158881615-158881637 ATCTGCAAACTGGATTTTGGGGG + Intronic
1024079877 7:45847332-45847354 ACCTGTAATCTCAACATTGTGGG + Intergenic
1025124905 7:56336664-56336686 ACCTGTAATCTCAACATTGTGGG - Intergenic
1025769303 7:64489417-64489439 ACCTGTCTTCTGGATTTTGGGGG + Intergenic
1026504182 7:70968262-70968284 ACATTTGAGCTGGACTTTGGAGG + Intergenic
1027444023 7:78251881-78251903 TCCTGTAATCCCAACTTTGGCGG + Intronic
1029039313 7:97556325-97556347 ACCTGTGAGCAGGTCTTTGGAGG - Intergenic
1029430670 7:100527461-100527483 ACCTGTAATCTCAGCTTTGGAGG - Intergenic
1031465110 7:122100028-122100050 ACCTGGAGTCTGGGGTTTGGGGG - Intronic
1034687022 7:152981077-152981099 ACCTGTAATCTCAGCTTGGGAGG + Intergenic
1034932166 7:155171364-155171386 TCCTGTAATGTGGGCTTTGTCGG + Intergenic
1035067706 7:156120438-156120460 ACGTGTAACCTGGACTCAGGTGG + Intergenic
1035910113 8:3557004-3557026 CTTTGTAATCTGCACTTTGGTGG + Intronic
1041025107 8:53676443-53676465 ACCTGTAATCCCAACTTGGGAGG + Intergenic
1042491372 8:69402320-69402342 AACTGTAATCTTGTCTTTGAGGG - Intergenic
1043934581 8:86129030-86129052 TCCTGTAAACTGGACTTTGCAGG - Intronic
1044210487 8:89544361-89544383 ACCTAAAATATGAACTTTGGGGG + Intergenic
1044213646 8:89581433-89581455 ACCTGTAATCACTACTTTGGAGG - Intergenic
1047311675 8:123697484-123697506 ACCTGTAGCCTGGACCCTGGCGG + Intronic
1047484756 8:125319300-125319322 ACCTGGAATCTAGACATTGTGGG - Intronic
1047570480 8:126093593-126093615 GGCTGAAATCTGGACTTGGGAGG + Intergenic
1049191899 8:141292976-141292998 ACCTGTAATCTGGGCCCTAGGGG - Intronic
1050158209 9:2690352-2690374 AATTGAAATCTGGGCTTTGGGGG + Intergenic
1051287004 9:15507924-15507946 ACCTGTTATCTCAACTTTGTGGG + Intronic
1055749546 9:79489542-79489564 AACTGTAAACTGCCCTTTGGGGG + Intergenic
1055875622 9:80938469-80938491 ACATGTTATTTTGACTTTGGTGG + Intergenic
1057628735 9:96701594-96701616 ACCTGTCTTCTTCACTTTGGGGG - Intergenic
1057764917 9:97908151-97908173 ACCTGTAATCTGGACACTTTGGG + Intronic
1059386657 9:113969837-113969859 ACCTGTATTTGGGGCTTTGGAGG + Intronic
1059639594 9:116203784-116203806 ACATGTAAGCTGGACTTTGCAGG + Intronic
1061073176 9:128324380-128324402 ACCTGTAATCTCAACACTGGGGG - Intronic
1203438960 Un_GL000195v1:170632-170654 GCCTGTAATCTGAACATTTGGGG + Intergenic
1203714374 Un_KI270742v1:130094-130116 GCCTGTAATCTCAGCTTTGGAGG - Intergenic
1185813240 X:3129927-3129949 ACCTGTAATCTCAGCTTTGTGGG - Intergenic
1187068798 X:15867294-15867316 AACTATAATCTGGACTTTGAAGG - Intergenic
1187962476 X:24579783-24579805 ACCTTGAAGCTGGACTTTGCAGG - Intronic
1189621747 X:42847837-42847859 GCTTGAAATCTGGACTTTGAAGG - Intergenic
1197360449 X:125495714-125495736 ACATGTCATCTGGAGTTTGATGG - Intergenic
1202014491 Y:20386206-20386228 ACCGGGAAGCTGGAATTTGGTGG - Intergenic