ID: 903941177

View in Genome Browser
Species Human (GRCh38)
Location 1:26932473-26932495
Sequence CAGAAAAATTAGCTGGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1804
Summary {0: 1, 1: 4, 2: 20, 3: 255, 4: 1524}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903941177_903941184 20 Left 903941177 1:26932473-26932495 CCGGCCCCCAGCTAATTTTTCTG 0: 1
1: 4
2: 20
3: 255
4: 1524
Right 903941184 1:26932516-26932538 TTTTACCATGTTTCCCAGGCTGG 0: 41
1: 1739
2: 26448
3: 157009
4: 248314
903941177_903941183 16 Left 903941177 1:26932473-26932495 CCGGCCCCCAGCTAATTTTTCTG 0: 1
1: 4
2: 20
3: 255
4: 1524
Right 903941183 1:26932512-26932534 GAGGTTTTACCATGTTTCCCAGG 0: 5
1: 169
2: 3024
3: 29555
4: 155490
903941177_903941182 -3 Left 903941177 1:26932473-26932495 CCGGCCCCCAGCTAATTTTTCTG 0: 1
1: 4
2: 20
3: 255
4: 1524
Right 903941182 1:26932493-26932515 CTGTTTTTTTTGTAGAGATGAGG 0: 3
1: 200
2: 8865
3: 114860
4: 219863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903941177 Original CRISPR CAGAAAAATTAGCTGGGGGC CGG (reversed) Intronic
900209374 1:1446284-1446306 TACAAAAATTAGCTGGGGCGTGG + Intergenic
900211521 1:1458573-1458595 CAAAAAAGTTAGCTGGGGCCTGG - Intronic
900251630 1:1673511-1673533 TACAAAAATTAGCTGGGTGTGGG + Intronic
900872141 1:5311761-5311783 CGGAAAGATTAGCTGGGCCCTGG - Intergenic
901015751 1:6229180-6229202 TACAAAAATTAGCCAGGGGCTGG + Intronic
901074370 1:6543827-6543849 CAAAAAAATTAGCCAGAGGCCGG + Intronic
901104909 1:6747538-6747560 TACAAAAATTAGCTGGGTGGTGG + Intergenic
901212074 1:7532448-7532470 AATAAAAATTAGCTGGGCACAGG - Intronic
901263173 1:7888770-7888792 AAGAACAATTAGCTGTGGGATGG + Intergenic
901336202 1:8451274-8451296 TACAAAAATTAGCTGGGGTGTGG + Intronic
901364077 1:8730495-8730517 TACAAAAATTAGCTGGGTGTGGG - Intronic
901495099 1:9616420-9616442 CAAGAAAATTAGCTGGGGCCGGG + Intergenic
901540755 1:9913893-9913915 AAAAAAAATTAACTGGGGGATGG - Intergenic
901676272 1:10887842-10887864 TACAAAAATTAGCCAGGGGCTGG + Intergenic
901754383 1:11432503-11432525 TACAAAAATTAGCTGGGTGCGGG - Intergenic
901925037 1:12560777-12560799 TACAAAAATTAGCTGGGTGCAGG - Intergenic
902201939 1:14840031-14840053 CAGAAAAAATAGCGGGGTGGGGG - Intronic
902293248 1:15448639-15448661 CAAAAAAATTAGCTGGGGCCGGG - Intronic
902324646 1:15691795-15691817 CAAAAAAATTAGCTGGGGGCGGG + Intronic
902357609 1:15916970-15916992 TACAAAAATTAGCTGGGCGTTGG + Intronic
902393071 1:16117311-16117333 TACAAAAATTAGCTGGGCGTGGG + Intergenic
902502444 1:16920045-16920067 AAAAAAAATTAGCTGGGGCGTGG - Intronic
902693113 1:18122774-18122796 AAAAAAAATTAGCTGGGGCGTGG - Intronic
902793175 1:18782978-18783000 AACAAAGATTAGTTGGGGGCTGG - Intergenic
902863988 1:19265781-19265803 TACAAAAATTAGCTGGGTGGTGG - Intergenic
902882684 1:19383148-19383170 CAAAAAAATTAGCTGGGGCTGGG + Intronic
902913135 1:19616069-19616091 TACAAAAATTAGCTGGGCGGTGG - Intronic
903079708 1:20799993-20800015 CAGAAGAACCAACTGGGGGCAGG - Intergenic
903507626 1:23849461-23849483 CAGAAACATGAGGTGTGGGCAGG + Intronic
903518450 1:23928689-23928711 TACAAAAATTAGCTGGGCGTGGG + Intergenic
903569926 1:24296839-24296861 TACAAAAATTAGCCGGGGCCTGG + Intergenic
903665986 1:25007918-25007940 TACAAAAATTAGCTGGGCGTGGG - Intergenic
903753446 1:25644672-25644694 CAAAACAATTAGCTGGGTGTTGG - Intronic
903861376 1:26366809-26366831 ACAAAAAATTAGCTGGGGGGTGG - Intronic
903901375 1:26648403-26648425 TACAGAAATTAGCTGGGTGCGGG + Intergenic
903941177 1:26932473-26932495 CAGAAAAATTAGCTGGGGGCCGG - Intronic
903987428 1:27238858-27238880 CAAAAAAATTAGCCGGGGCTGGG - Intronic
903997598 1:27317347-27317369 TACAAAAATTAGCTGGGGCTGGG + Intergenic
904122316 1:28207901-28207923 CAAAAAAATTAGCCAGAGGCCGG + Intronic
904146729 1:28398662-28398684 CACAAAAATTAGCCGGGCGTGGG + Intronic
904148821 1:28419134-28419156 CAAAAAAATTAGCTGGGCATGGG - Intronic
904166289 1:28557885-28557907 AAAAAAAATTAGCTGGGTGTTGG - Intronic
904175518 1:28625834-28625856 AAAAAAAATTAGCTGGGGCCAGG - Intronic
904177238 1:28638938-28638960 AAAAAAAATTAGCTGGGCACGGG - Intronic
904193931 1:28770434-28770456 TACAAAAATTAGCTGGAGGATGG + Intergenic
904204564 1:28845186-28845208 TACAAAAATTAGCTGGGGCCAGG + Intronic
904230570 1:29067200-29067222 CAAAAAAATTAGCCGGGGCCAGG + Intronic
904242058 1:29153752-29153774 CAAAAAAATTAGCTAGGCGTTGG - Intronic
904637135 1:31890815-31890837 TACAAAAATTAGCCGGGTGCTGG + Intergenic
904683583 1:32245407-32245429 AAAAAAAATTAGCTGGGTGTGGG + Intergenic
904685780 1:32259317-32259339 AAAAAAAAATAGCTGGAGGCTGG + Intronic
904737217 1:32643788-32643810 AAAAAAAATTAGCTGGGGCCAGG - Intronic
905077579 1:35286915-35286937 CAGAAAGATAAGCTAGGGCCAGG - Intronic
905189532 1:36222972-36222994 TAGAAAAATTAGCCGGGTGGTGG + Intergenic
905400089 1:37695224-37695246 AAGAAAAATAAGCAGAGGGCAGG + Intronic
905413035 1:37785163-37785185 TACAAAAATTAGCTGGGCGTGGG + Intergenic
905415602 1:37801698-37801720 TACAAAAATTAGCTGGGCGTGGG + Intergenic
905456534 1:38092022-38092044 TACAAAAATTTGCTGGGGTCGGG - Intergenic
905466214 1:38155693-38155715 CAGAAAAACTAACCGGGGTCAGG + Intergenic
905580061 1:39077445-39077467 TACAAAAATTAGCTGGGGGGTGG - Intergenic
905722523 1:40217615-40217637 ACAAAAAATTAGCTGGGCGCGGG + Intronic
906060517 1:42945434-42945456 AAAAAAAATTGGCTGGGGGTAGG + Intronic
906061334 1:42950817-42950839 ACGAAAAATTAGCTGGGCGTGGG + Intronic
906307637 1:44730136-44730158 CACAAAAATTAGCTGGGCGTGGG - Intergenic
906419153 1:45648871-45648893 TACAAAAATTAGCTGGGCGTAGG + Intronic
906446968 1:45909670-45909692 TACAAAAATTAGCTGGGCGTGGG - Intronic
906499798 1:46333410-46333432 TACAAAAATTAGCTGGGCGTGGG - Intergenic
906618005 1:47248123-47248145 TACAAAAATTAGCTGGGTGTGGG + Intergenic
906632733 1:47386010-47386032 TACAAAAATTAGCTGGGCGTGGG - Intergenic
906924204 1:50097063-50097085 AATAAAAATTAGCTGGGTGTTGG + Intronic
906978583 1:50603626-50603648 CAAAAAAAATGGCTGGGGGAAGG - Intronic
906993381 1:50763100-50763122 CAAAAAAATTAGCTGGGGCATGG + Intronic
907008586 1:50941510-50941532 TTGAAAAATTAGCTGAGGACTGG - Intronic
907040168 1:51251781-51251803 CAAAAGAATTAGCTGGAGCCGGG + Intronic
907154088 1:52316327-52316349 CACAAAAATTAGCTGGGCTTTGG + Intronic
907161788 1:52376215-52376237 CACAAAAATTAGCCAGGGTCTGG + Intronic
907458858 1:54593427-54593449 CACAAAAATTAGCTGTGTGGTGG - Intronic
907466093 1:54638147-54638169 CAGAAAAAATAGATTTGGGCTGG + Exonic
908118819 1:60966490-60966512 TATAAAAATTAGCTGGGTGTGGG - Intronic
908226522 1:62061334-62061356 TACAAAAATTAGCTGGGCGTGGG - Intronic
908239176 1:62174477-62174499 CAAAAATATGAGCTGAGGGCTGG + Intergenic
908247153 1:62236748-62236770 TACAAAAATTAGCTGGGGCGTGG - Intergenic
908416218 1:63915743-63915765 CAGAAAGATTGGCAGGGGGTGGG + Intronic
908558156 1:65278756-65278778 AGGAAAAATTACCTGGGGACTGG + Intronic
908563944 1:65335261-65335283 AAAAAAAATTAGCTGGGCGTGGG - Intronic
908780028 1:67681893-67681915 TACAAAAATTAGTTGGGGCCAGG - Intergenic
909011888 1:70343999-70344021 TTTAAAAATTAGCTGGGGGCTGG + Intronic
909015608 1:70376740-70376762 ATTAAAAATTAGATGGGGGCTGG - Intronic
909519004 1:76545809-76545831 CAAAAAAATTAGCTGGATGTGGG - Intronic
909842616 1:80347884-80347906 TACAAAAATTAGCTGGGTGTGGG - Intergenic
909919154 1:81358852-81358874 CAGAAGAATTACCTGGTGGTAGG + Intronic
910158563 1:84248725-84248747 CACAAAAATTAGCTGGGCCTGGG + Intergenic
910284296 1:85536396-85536418 TACAAAAATTAGCTGGGTGTGGG + Intronic
910418675 1:87031092-87031114 TACAAAAATTAGCTGGGTGTGGG - Intronic
910544242 1:88396074-88396096 CAAAAATATTAGCTGGGCGCGGG + Intergenic
910791873 1:91060038-91060060 CACAAAAATTAGCTGAGTGTGGG - Intergenic
910829038 1:91441567-91441589 TACAAAAAGTAGCTGGGGGTGGG + Intergenic
910850981 1:91649639-91649661 CAAAAAAATTAGCTGGGCGGTGG + Intergenic
911085512 1:93974124-93974146 TACAAAAATTAGCTGGGGGGTGG + Intergenic
911383956 1:97151361-97151383 CAGAAAGATTATCTGGGGCTGGG + Intronic
911664546 1:100538813-100538835 CAGAATAATGGGCTGGGGGAGGG - Intronic
911739776 1:101374815-101374837 CAAAAAAATTAGCCGGGCGTAGG - Intergenic
912357533 1:109067301-109067323 AACAAAAATTAGCTGGGCGTAGG + Intronic
912396988 1:109353171-109353193 CAAAAAAATTAGCTGGGCCTGGG + Intronic
912543547 1:110434693-110434715 TACAAAAATTAGCTGGGTGTGGG + Intergenic
912943549 1:114066408-114066430 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
913272933 1:117111783-117111805 CACAAAAATTAGCTGGGTGTGGG + Exonic
913296485 1:117326203-117326225 TACAAAAATTAGCTGGGCGTGGG + Intergenic
913386826 1:118267017-118267039 TACAAAAATTAGCTGGGCGTGGG - Intergenic
913467472 1:119157417-119157439 CAAAAAAATTAGCCGGGTGTGGG - Intergenic
913650334 1:120907509-120907531 TACAAAAATTAGCTGGGCGTGGG - Intergenic
914170781 1:145221561-145221583 TACAAAAATTAGCTGGGCGTGGG + Intergenic
914214806 1:145615772-145615794 TACAAAAATTAGCTGGGTGTGGG - Intronic
914466748 1:147936164-147936186 TACAAAAATTAGCTGGGTGTGGG - Intronic
914525898 1:148465523-148465545 TACAAAAATTAGCTGGGCGTGGG + Intergenic
914640504 1:149601603-149601625 TACAAAAATTAGCTGGGCGTGGG - Intergenic
914759677 1:150588373-150588395 TACAAAAATTAGCTGGGGCTGGG + Intergenic
914779934 1:150776134-150776156 TACAAAAATTAGCCGGGCGCGGG - Intergenic
914872315 1:151485276-151485298 CAGAAAATTTGGCTGGGCACGGG - Intergenic
915082222 1:153360063-153360085 TAGAAAAACTAGGTGTGGGCAGG - Intronic
915127476 1:153676019-153676041 TACAAAAATTAGCTGGGTGTAGG - Intergenic
915150233 1:153824929-153824951 CAAAACAATTAGCTGGGTACAGG + Intronic
915152582 1:153846386-153846408 CAAAAAGATTAGCTGGGCACTGG - Intronic
915258322 1:154653396-154653418 TACAAAAATTAGCAGGGTGCTGG - Intergenic
915399990 1:155615193-155615215 TAGAAAAATTGGCTGGGTGGTGG + Intergenic
915418748 1:155762879-155762901 TACAAAAATTAGCTGGGTGTGGG + Intronic
915460825 1:156069832-156069854 CTGAGAAATTAGCTGGGGTGAGG - Intronic
915464582 1:156089448-156089470 TACAAAAATTAGCTGGGCGTGGG - Intronic
915492656 1:156259825-156259847 CACAAAAATAAGTTGGGGCCAGG - Intronic
915756446 1:158265476-158265498 TACAAAAATTAGCTGGGGGTGGG + Intergenic
916039988 1:160953553-160953575 TACAAAAATTAGCTGGGGTGTGG + Intronic
916082969 1:161247657-161247679 TACAAAAATTAGCTGGGTGGTGG - Intergenic
916163060 1:161938920-161938942 CAGAAAAGTGAGCTGGTGACTGG - Intronic
916509749 1:165461608-165461630 GAGAAAAAATAGCCAGGGGCTGG - Intergenic
916705033 1:167340584-167340606 CACAAAAATTAGCTGGGCGTGGG - Intronic
916753935 1:167750354-167750376 TACAAAAATTAGCTGGGCGTTGG - Intronic
917066004 1:171093981-171094003 TACAAAAATTAGCTGGGTGTGGG - Intronic
917219835 1:172717026-172717048 TAGAAAAACAAGCTGGAGGCCGG + Intergenic
918020224 1:180680517-180680539 TACAAAAATTAGCTGGGTGTGGG - Intronic
918023226 1:180715825-180715847 TACAAAAATTAGCTGGGTGTGGG - Intronic
918057098 1:181031478-181031500 CAGAAAAAATTGCTGTTGGCCGG - Intergenic
918266261 1:182844815-182844837 CACAAAAATTAGCTGGGCGTGGG - Intronic
919088507 1:192949997-192950019 CAGAAAACATTGCTGGGAGCTGG - Intergenic
919182812 1:194106859-194106881 TACAAAAATTAGCTGGGTGTGGG + Intergenic
919245309 1:194975198-194975220 TACAAAAATTAGCTGGTTGCTGG + Intergenic
919282663 1:195511114-195511136 TACAAAAATTAGCTGGGAGCGGG - Intergenic
919635587 1:200000280-200000302 TACAAAAATTAGCTGGGTGAGGG - Intergenic
919652058 1:200159805-200159827 TACAAAAATTAGCCGGGTGCTGG - Intronic
919901877 1:202049936-202049958 TTGAAAAATTAGGTGGGAGCTGG + Intergenic
919966421 1:202531169-202531191 CAAAAATATTACTTGGGGGCAGG - Intronic
920072841 1:203315435-203315457 TACAAAAATTAGCTGGGTGGTGG + Intergenic
920339117 1:205264644-205264666 TACAAAAATTAGCTGGGTGTGGG - Intronic
920360206 1:205410070-205410092 AAAATAAATTAACTGGGGGCTGG - Intronic
920430692 1:205916944-205916966 TACAAAAATTAGCTGGGCGCAGG + Intronic
920569596 1:207006580-207006602 AAGAGAAATAGGCTGGGGGCTGG - Intergenic
920627674 1:207618884-207618906 TACAAAAATTAGCTGGGTGGTGG + Intronic
920867893 1:209768541-209768563 CAGAGAGATGAGCTGTGGGCTGG + Intronic
920970424 1:210738720-210738742 TACAAAAATTAGCTGGGTGTGGG - Intronic
921197575 1:212774082-212774104 CAGAGAAGTTAGTTGGGGGTGGG + Intronic
921402513 1:214741505-214741527 CAAAAAAATTAGCTGGGACCAGG - Intergenic
921681503 1:218038107-218038129 CAAAGAAATCAGCTGGGGGCGGG - Intergenic
922125315 1:222715259-222715281 CATAAAAATCACCTGGGGGTGGG - Intronic
922608582 1:226907358-226907380 TACAAAAATTAGCTGTGGCCAGG + Intronic
922817486 1:228460146-228460168 TAAAAAAATTAGCTGGGCGTGGG - Exonic
922873597 1:228922439-228922461 TACAAAAATTAGCCGGGCGCTGG + Intergenic
922949075 1:229542974-229542996 TACAAAAATTAGCTGGGTGTTGG + Intronic
923370389 1:233305598-233305620 TATAAAAATTAGCTGGGCGTGGG - Intergenic
923376029 1:233363857-233363879 AAAAAAAATTAGCTGGGCACGGG + Intronic
923523406 1:234753836-234753858 CAGAACAATTAAAAGGGGGCAGG - Intergenic
923606001 1:235443354-235443376 TACAAAAATTAGCTGGGCGTTGG - Intronic
923645459 1:235815973-235815995 TACAAAAATTAGCTGGGCGTGGG + Intronic
923652224 1:235884416-235884438 TTAAAAAATTAGCTGGGCGCCGG - Intergenic
923724888 1:236497229-236497251 TACAAAAATTAGCTGGGCGTGGG - Intergenic
924688478 1:246321903-246321925 AAAAAAAATTAGCTGAGAGCAGG - Intronic
924732304 1:246723735-246723757 CACAAAAATTAGCAGGGCGTGGG + Intergenic
1063079100 10:2748259-2748281 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1063163487 10:3438490-3438512 CAAAAAAATTAGCTCGGGCATGG - Intergenic
1063235523 10:4111277-4111299 CACAAAAATTAGCTGGGTATGGG + Intergenic
1063236991 10:4127332-4127354 TACAAAAATTAACTGGGGCCAGG + Intergenic
1063408119 10:5815482-5815504 AAAAAAAATTAGCTGGAGGCCGG + Intronic
1063547604 10:6997587-6997609 CAGAAAAATTGCAAGGGGGCCGG + Intergenic
1063655660 10:7985936-7985958 TACAAAAATTAGCTGGGTGTGGG - Intronic
1064002944 10:11678671-11678693 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1064012804 10:11748729-11748751 TACAAAAATTAGCTGGGCGTGGG + Intronic
1064233329 10:13549238-13549260 AAGAAAAATTGGGTGGGGGTAGG + Intergenic
1064406432 10:15068545-15068567 CAAAAAAATTAGCTGGGTGTGGG - Intronic
1064426213 10:15231935-15231957 CAAAAAAATTAGCTGGGCCGTGG + Intronic
1064427119 10:15239455-15239477 TACAAAAATTAGCTGGAGCCGGG - Intronic
1064743603 10:18457592-18457614 AAGAAAAATTAGGAGAGGGCCGG + Intronic
1064915459 10:20451840-20451862 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1065086056 10:22178196-22178218 AAGAAGAAATAGCTGGGGCCAGG + Intergenic
1065145350 10:22762807-22762829 TACAAAAATTAGCTGGGCGTAGG + Intergenic
1065172450 10:23045213-23045235 TACAAAAATTAGCTGGGTGGTGG - Intergenic
1065477338 10:26154332-26154354 TAGAAAAATTAGCTGGGTGTGGG - Intronic
1065677730 10:28196323-28196345 TATAAAAATTAGCTGGGCGTGGG + Intronic
1065713838 10:28544907-28544929 TACAAAAATTAGCTGGGGCGTGG + Intronic
1065937745 10:30535694-30535716 TACAAAAATTAGCTGGGGCGTGG + Intergenic
1065948892 10:30633639-30633661 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1066245309 10:33577468-33577490 CACAAAAATTAGTTGGGTGTGGG + Intergenic
1066631211 10:37460899-37460921 AATAAACATTAGCTGGGGCCGGG + Intergenic
1066679559 10:37923969-37923991 TACAAAAATTAGCGGGGGCCTGG + Intergenic
1067108486 10:43381823-43381845 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1067114445 10:43423823-43423845 TACAAAAATTAGCTGGGCGTAGG + Intergenic
1067122854 10:43489579-43489601 CAGGAAGATTACCTGGGGTCAGG - Intergenic
1067767722 10:49099861-49099883 TACAAAAATTAGCTGGGTGGTGG + Intronic
1067770575 10:49120700-49120722 CAGAAAAATGAGCTGGGCACAGG - Intergenic
1067846064 10:49722349-49722371 CAGAAAAATTAGCAGGACGTGGG + Intergenic
1067899006 10:50217968-50217990 TACAAAAATTAGCTGGGCGTGGG + Intronic
1068434096 10:56968604-56968626 TACAATAATTAGCTGGGCGCGGG + Intergenic
1068884400 10:62083583-62083605 CAGAAAATGAAGCTGGGGGAAGG + Intronic
1068909855 10:62367800-62367822 TACAAAAATTAGCTGGGGCGTGG - Intergenic
1069046263 10:63746807-63746829 TTAAAAAATTAGCTGGGTGCTGG + Intergenic
1069244380 10:66184142-66184164 TACAAAAATTAGCTGGGCGCGGG + Intronic
1069259496 10:66376040-66376062 CAGTAAAACTAGGTGGGGGTTGG + Intronic
1069423600 10:68270166-68270188 TAGAAAAATTAGCTGTGCTCAGG - Intergenic
1069501089 10:68953878-68953900 TAGAAAAATTAGCCGGGTGTGGG + Intergenic
1069507844 10:69017580-69017602 TACAAAAATTAGCTGGGGCATGG + Intergenic
1069556542 10:69402144-69402166 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1069978972 10:72238948-72238970 TACAAAAATTAGGTGGGGCCAGG + Intergenic
1069993218 10:72327721-72327743 TACAAAAATTAGCTGGGTGTTGG - Intergenic
1070003516 10:72399806-72399828 TACAAAAATTAGCTGGGTGGTGG + Intronic
1070125511 10:73618445-73618467 GTAAAAAATTAGCTGGGGCCGGG + Intronic
1070168978 10:73918341-73918363 CAAAAAAATTAGCCGGGTGTGGG + Intronic
1070491296 10:76979321-76979343 CAGAAAAGAGAGCTGGGGTCAGG + Intronic
1070717426 10:78732775-78732797 TACAAAAATTAGCTGGGAGTGGG + Intergenic
1070796743 10:79221375-79221397 CAGAACAAAGAGCTGGGGGCTGG - Intronic
1070804756 10:79264539-79264561 GATAAAAATTTGCTGGCGGCAGG - Intronic
1071406845 10:85343720-85343742 CAAAAAAATTAGCTGGGCGTGGG - Intergenic
1071729705 10:88235105-88235127 CAAAAAAATTAGCCGGGCGTCGG + Intergenic
1071774767 10:88773690-88773712 CAGAACAATTATCTTGGGACTGG - Intronic
1071775404 10:88781307-88781329 CAGAAAATTTAGCTTTGGGTGGG - Intergenic
1072099097 10:92212401-92212423 CACAAAAATTAGCTGGGCAGTGG - Intronic
1072140811 10:92587708-92587730 CAAACAAATTAGCTGGGGCCGGG - Intergenic
1072397135 10:95055936-95055958 TACAAAAATTAGCTGGGTGTGGG + Intronic
1072434469 10:95402759-95402781 ACAAAAAATTAGCTGGGGCCAGG - Intronic
1072457132 10:95586599-95586621 AAAAAAAATTAGCTGGGGCAGGG - Intergenic
1073318300 10:102598306-102598328 TACAAAAATTAGCTGGGCGTTGG - Intronic
1073553005 10:104420905-104420927 CAAAAAAATTAGCCGGGTGTGGG - Intronic
1073938197 10:108660749-108660771 AAGAAAAATCTGTTGGGGGCCGG + Intergenic
1073997164 10:109328698-109328720 AAAAAAAATTAGCTGGGCGTAGG - Intergenic
1074140263 10:110666344-110666366 CTTAAAAATCACCTGGGGGCTGG + Intronic
1074517132 10:114180617-114180639 TACAAAAATTAGCAGGGCGCCGG - Intronic
1074535236 10:114324404-114324426 TACAAAAATTAGCCGGGGGGGGG - Intronic
1074701101 10:116093259-116093281 CAGACAAATTAGATGGGGATAGG - Intronic
1074924976 10:118059525-118059547 TAGAAAAATTAGCTGGGCATGGG + Intergenic
1074988473 10:118679671-118679693 TACAAAAATTAGCTGGGCGTGGG - Exonic
1075038074 10:119086052-119086074 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1075056954 10:119226132-119226154 TACAAAAATTAGCCGGGTGCTGG - Intronic
1075171959 10:120123796-120123818 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1075596893 10:123738438-123738460 CAAAAAAATTAGCTGGGCATGGG - Intronic
1075698558 10:124453306-124453328 TATAAAAATTAGCTGGGCGCAGG - Intergenic
1075790934 10:125084074-125084096 CAAAAAACGTAGCTGGGGCCAGG - Intronic
1075954203 10:126508311-126508333 CAGAAGAATCACCTGGGAGCTGG - Intronic
1075954229 10:126508457-126508479 CAGAAGAATCACCTGGGAGCTGG - Intronic
1075954255 10:126508603-126508625 CAGAAGAATCACCTGGGAGCTGG - Intronic
1075984541 10:126772859-126772881 TAGAAAAATTAGCTGGGCATGGG + Intergenic
1075999272 10:126902804-126902826 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1076132179 10:128021047-128021069 CAAAAAAATTAGCCGGGTGTGGG - Intronic
1076245124 10:128941195-128941217 TACAAAAATTAGCTAGTGGCAGG - Intergenic
1077659952 11:4058992-4059014 CAGAAAATTTAGTTGGGTGTGGG + Intronic
1077778847 11:5302549-5302571 GATAAAAATTAGCTGGGCACAGG + Intronic
1077885102 11:6381614-6381636 TACAAAAATTAGCTGGGCGTGGG + Intergenic
1078063744 11:8064518-8064540 CAGTAACATTTGCTGGGGTCTGG + Intronic
1078239616 11:9519296-9519318 CAAAAAAATTAGCCAGGCGCGGG - Intronic
1078441633 11:11373047-11373069 TAGAAAGATTAGCTGGGACCAGG + Intronic
1078603348 11:12752993-12753015 AAAAAAAATTAGCTGGGTGTTGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078848207 11:15140732-15140754 AAGAAAAATTAGATGGGGCATGG - Intronic
1079123965 11:17705622-17705644 CAGAAAAATTTCCTGAGGACAGG + Intergenic
1079215233 11:18504044-18504066 TAGAAAAATTAGCTAGGTGTAGG + Intronic
1079403432 11:20125196-20125218 TTAAAAAATTAGCTGGGGCCAGG - Intergenic
1079789824 11:24722760-24722782 TACAAAAATTAGCTGGGCGTGGG + Intronic
1080200120 11:29659373-29659395 ACAAAAAATTAGCTGGGGCCTGG - Intergenic
1080474823 11:32580553-32580575 TACAAAAATTAGCTGGGACCTGG - Intergenic
1080651850 11:34228962-34228984 TACAAAAATTAGCTGGGTGTGGG + Intronic
1080662505 11:34308713-34308735 TACAAAAATTAGCTGGGCGTGGG + Intronic
1080776365 11:35390818-35390840 TACAAAAATTAGCTGGGTGTGGG - Intronic
1080830008 11:35884046-35884068 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1081053218 11:38373034-38373056 CAAAAAAATTAGCATGGAGCAGG + Intergenic
1081326616 11:41753558-41753580 TAGAAAAATTAGCTGGGTGTAGG - Intergenic
1081594385 11:44449199-44449221 TAGATAAATTAGCTGGGATCAGG + Intergenic
1081678184 11:44983208-44983230 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1081817965 11:45963121-45963143 CATAGAAAATATCTGGGGGCCGG + Intronic
1081914546 11:46722430-46722452 TACAAAAATTAGCTGGGGTGTGG + Intronic
1081971694 11:47203550-47203572 CACAAAAATTAGCTGGGCATGGG + Intergenic
1081972934 11:47212615-47212637 TACAAAAATTAGCTGGGGCGTGG - Intergenic
1082020254 11:47526894-47526916 TACAAAAATTAGCTGGGCGTGGG + Intronic
1082159895 11:48879457-48879479 TTACAAAATTAGCTGGGGGCGGG + Intergenic
1082639504 11:55639977-55639999 TACAAAAATTAGCTGGGCGCAGG + Intergenic
1082669546 11:56017515-56017537 GAAAAAAAGTAGCTTGGGGCTGG + Intergenic
1082830165 11:57611085-57611107 TACAAAAATTAGCTGGGTGGTGG - Intronic
1082916910 11:58446913-58446935 CAGTGCAAGTAGCTGGGGGCTGG - Intergenic
1082995998 11:59255945-59255967 TACAAAAATTAACTGGGTGCAGG - Intergenic
1083390270 11:62344050-62344072 TACAAAAATTAGCTGGGTGTGGG - Intronic
1083422545 11:62562946-62562968 TTTAAAAATTAGCTGGGAGCTGG + Intronic
1083589316 11:63883738-63883760 CACAAAAATTAGCCGGGGTGTGG - Intronic
1083608458 11:63993067-63993089 CAGTAAAATCTGCTGGAGGCGGG + Intronic
1083838046 11:65285405-65285427 AAAAAAAATTAGCTGGGTGTGGG + Intronic
1083844755 11:65324760-65324782 TACAAAAATTAGCTGGGCACCGG - Intergenic
1083872010 11:65494349-65494371 TACAAAAATTAGCTGGGGTGTGG - Intergenic
1083939352 11:65887289-65887311 TACAAAAATTAGCTGGGTGTGGG + Intronic
1084081525 11:66829088-66829110 AAAAAAAATTAGCTGAGGCCGGG + Intronic
1084129927 11:67125615-67125637 TACAAAAATTAGCTGGGCACTGG + Intronic
1084278450 11:68069527-68069549 TACAAAAATTAGCTGGGTGTGGG + Intronic
1084315773 11:68344472-68344494 TACAAAAATTAGCTGGGGCGTGG - Intronic
1085511352 11:77089716-77089738 TAGAAAAATTAGCTGGGTGTTGG + Intronic
1086101463 11:83104279-83104301 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1086126343 11:83352380-83352402 AAAAAAAATTAGCTGGGTGGCGG + Intergenic
1086342819 11:85864611-85864633 CAAAAAAATTAGGTTTGGGCAGG - Intronic
1086343604 11:85872328-85872350 TAGAAAAATTAGCCGGGTGTGGG + Intronic
1086389362 11:86346469-86346491 CAAAAAAATTAGCTGGGTATGGG - Intergenic
1086593513 11:88543765-88543787 GAGAAAAGTTATCTGGGGGAAGG + Intronic
1086834637 11:91605286-91605308 CATGAAAATTAGCTGGGTGTGGG + Intergenic
1086869626 11:92021351-92021373 AAGATAAATTACATGGGGGCGGG - Intergenic
1086899486 11:92350418-92350440 CAAAAAGATATGCTGGGGGCAGG + Intergenic
1087231423 11:95670094-95670116 TACAAAAATTAGCTGGGTGTAGG - Intergenic
1087510385 11:99085197-99085219 TACAAAAATTAGCTGGGCGTGGG - Intronic
1087538413 11:99483017-99483039 TACAAAAATTAGCTGGGCGTGGG + Intronic
1087658212 11:100952887-100952909 CACAAAAATCAGCTGGGCACTGG - Intronic
1087744205 11:101924618-101924640 CAAAAAAATTAGCCGGGCACGGG - Intronic
1087763246 11:102124105-102124127 TACAAAAATTAGCTGGGGCATGG - Intronic
1087800005 11:102493370-102493392 CTAAAAAATTAGGTGGTGGCAGG - Intronic
1087997773 11:104832251-104832273 TACAAAAATTAGCTGGGTCCCGG + Intergenic
1088121662 11:106377358-106377380 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1088125840 11:106422538-106422560 TACAAAAATTAGCTGGGTGTAGG - Intergenic
1088163289 11:106900336-106900358 TACAAAAATTAGCTGGGTGTGGG - Intronic
1088261606 11:107949155-107949177 TACAAAAATTAGCTGGGTGTGGG + Intronic
1088491389 11:110391396-110391418 TACAAAAATTAGCTGGGGGTGGG + Intergenic
1088923252 11:114277067-114277089 CACAAAAATTAGCTGGCGTTGGG + Intronic
1088935149 11:114392239-114392261 CAAAAAAATTAGCTAAGGGCTGG + Intronic
1088981931 11:114871795-114871817 CAGAACAATGAGCTGGGGCCGGG + Intergenic
1089005037 11:115084068-115084090 CAGAGAGTTTGGCTGGGGGCTGG - Intergenic
1089264882 11:117251613-117251635 AAGAAAAAGTAGCAGGGGTCAGG + Intronic
1089449710 11:118584978-118585000 CAAAAAAATTAGCCGGGCGTAGG - Intronic
1089568096 11:119383024-119383046 ACAAAAAATTAGCTGGGGCCGGG - Intergenic
1089624636 11:119743270-119743292 CACAGGAATTGGCTGGGGGCCGG + Intergenic
1089817495 11:121189526-121189548 CAAAAAAATTAGCCGGGCGTGGG - Intronic
1090299452 11:125622920-125622942 TACAAAAATTAGCTGGGTGTGGG + Exonic
1090439067 11:126711404-126711426 TACAGAAATTAGCTGGGGGGTGG + Intronic
1090734207 11:129597245-129597267 CATAAAACTTAGAAGGGGGCTGG + Intergenic
1090744154 11:129693439-129693461 AACAAAAATTAGCTGGGCGTGGG + Intergenic
1090781186 11:130008116-130008138 ATGAAAAACTAGCTGGGGCCAGG + Intergenic
1090813774 11:130272075-130272097 CAAAAAAATTAGCTGGGTGTAGG + Intronic
1091823629 12:3493482-3493504 TAGAAAAATGAGCCGGGGGTGGG - Intronic
1091865228 12:3828392-3828414 CAAAAAAATTAGCCGGGTGTGGG + Intronic
1091876349 12:3936751-3936773 CAAAAAAATTAGCCGGGCGTGGG + Intergenic
1092361512 12:7840538-7840560 TACAAAAATTAGCTGGGTGTGGG - Intronic
1092379779 12:7986113-7986135 AAAAAAAATTAGCTGGGCGTTGG + Intergenic
1092463429 12:8706603-8706625 CAAAAAAATTAGCCGGACGCAGG - Intronic
1092514570 12:9195597-9195619 AAAAAAAATTAGCAGTGGGCTGG - Intronic
1092617537 12:10229238-10229260 TACAAAAATTAGCTGGGCACGGG + Intergenic
1092866639 12:12767504-12767526 TAGAAAAATTAGATGGGTGTGGG + Intronic
1093299629 12:17438739-17438761 CATAAAATTTGGGTGGGGGCCGG + Intergenic
1093341406 12:17979182-17979204 TACAAAAATTAGCTGGGCTCTGG - Intergenic
1093466190 12:19452043-19452065 TACAAAAATTAGCTGGGTGTGGG - Intronic
1093718946 12:22415395-22415417 TACAAAATTTAGCTGGGCGCAGG + Intronic
1093884868 12:24448024-24448046 CACAAAAATTAGCTGGGCATTGG + Intergenic
1093976182 12:25424765-25424787 TATAAAAATTAGCTGGGCGTGGG + Intronic
1094039365 12:26106773-26106795 CAGAAATATGGGCTGGGGGAAGG - Intergenic
1094123045 12:26994374-26994396 CATAAAAATCACCTGAGGGCTGG + Intronic
1094144339 12:27213444-27213466 CATGAAAATTAGCTGTCGGCAGG - Intergenic
1094187958 12:27665031-27665053 CAAAAAAATTAGCTGGGCATGGG + Intronic
1094232017 12:28116642-28116664 AAGAAGAATAAGCTGGGGGCAGG + Intergenic
1094478883 12:30864246-30864268 CAGAAAAAGAAGCTGAGGGCAGG - Intergenic
1094543749 12:31384919-31384941 GACAAAAATTAGCGGGGGGGTGG - Exonic
1095546471 12:43376785-43376807 CACAAAACTATGCTGGGGGCTGG + Intronic
1095785351 12:46102906-46102928 CAAAAAAATTAGCTGGGCATGGG - Intergenic
1095787516 12:46126230-46126252 TAGAACAATTACCTGAGGGCAGG - Intergenic
1096058183 12:48673141-48673163 CAAGAAAATTAGCTGAGGACAGG - Intronic
1096118864 12:49073305-49073327 ATAAAAAATTAGCTGGGGCCGGG + Intergenic
1096152213 12:49321823-49321845 CACAAAAATTAGCTGGTGGCAGG + Intergenic
1096322659 12:50629031-50629053 TACAAAAATTAGCTGGGTGTGGG - Intronic
1096325122 12:50653493-50653515 CACAAAAATTAGCTGGGCATGGG - Intronic
1096333537 12:50735617-50735639 CACAAAAATTAGCTGGGCGTGGG - Intronic
1096428526 12:51524194-51524216 TACAAAAATTAGCTGGGCGCAGG - Intergenic
1096517614 12:52165801-52165823 GAGGGAAAATAGCTGGGGGCGGG - Intergenic
1096645656 12:53033495-53033517 TACAAAAATTAGCTGGGCGTTGG - Intronic
1096698234 12:53364651-53364673 CAAAAAATTTAGCCGGCGGCCGG - Intergenic
1096698799 12:53368504-53368526 AAGAAAAATTAGCTGAGTGCAGG + Intergenic
1096852200 12:54447643-54447665 TACAAAAATTAGCTGGGGTATGG - Intergenic
1096990829 12:55801286-55801308 TAAAAAAATTAGCTGGGTGTGGG + Intronic
1097023891 12:56039912-56039934 TACAAAAATTAGCTGGGGCCGGG + Intergenic
1097794973 12:63851717-63851739 CAAAAAAATTAGCTGGGCATGGG - Intronic
1098269090 12:68752848-68752870 CAAAAAAATTAGCTGAGGCTGGG + Intronic
1098455259 12:70665676-70665698 CAAAAATATGAGCTGGCGGCCGG - Intronic
1098538917 12:71629319-71629341 TAGAAAAATTAGCCGGGTGGTGG - Intronic
1099093275 12:78340134-78340156 CAGAAAGAACACCTGGGGGCCGG + Intergenic
1099121255 12:78691717-78691739 TACAAAAATTAGCTGGGGTTTGG + Intergenic
1099245753 12:80191281-80191303 CACAAAAATTAGCCAGGCGCGGG + Intergenic
1099468134 12:83012040-83012062 CAGAAAAATTAACTTAGGGAAGG - Intronic
1099839869 12:87951992-87952014 TATAAAAATTAGCTGGGAGTGGG - Intergenic
1100191320 12:92195085-92195107 TACAAAAATTAGCTGGGCGTGGG + Intergenic
1100322419 12:93508260-93508282 TTAAAAAATTAGCTGGGGGTGGG + Exonic
1100534350 12:95492717-95492739 AAAAAAAATTAGCTGGGCGTTGG - Intronic
1100546292 12:95605805-95605827 TTAAAAAATTAGCTGGGGCCAGG - Intergenic
1100831342 12:98519035-98519057 ACAAAAAATTAGCTGGGGGGTGG - Intronic
1100872577 12:98925873-98925895 TCAAAAAATTAGCTGGGGTCAGG - Intronic
1100956298 12:99912645-99912667 TAAAAAAATTAACTGGGGCCAGG - Intronic
1101014091 12:100481618-100481640 TAAAAAAATTAGCTGGGGCTGGG + Intronic
1101114156 12:101515906-101515928 TACAAAAATTAGCTGGGCACGGG - Intergenic
1101362466 12:104041110-104041132 TACAAAAATTAGCTGGGTGTGGG + Intronic
1101378285 12:104189885-104189907 TACAAAAATTAGCTGGGTGGTGG - Intergenic
1101743391 12:107519470-107519492 TATAAAAATTAGCTGGGTGTGGG - Intronic
1101756365 12:107623661-107623683 TAGAAAAATAAGCTAGAGGCCGG - Intronic
1102023395 12:109699374-109699396 AAAAAAATTTAGCTGGGGGCTGG - Intergenic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102161241 12:110770693-110770715 TACAAAAATTAGGTGGTGGCAGG + Intergenic
1102220669 12:111192280-111192302 CAAAAAAATCAGCTGGGCGTCGG - Intronic
1102325855 12:111983140-111983162 AAAAAAAATTAGCTGGGGCCAGG + Intronic
1102370099 12:112375923-112375945 AAAAAAAATTAGCTGGGGTGAGG + Intronic
1102449918 12:113033896-113033918 CACAAAAATTAGCTGGGTGTGGG - Intergenic
1102473775 12:113175490-113175512 ATAAAAAATTAGCTGGGGCCGGG + Intronic
1102877902 12:116461905-116461927 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1102894789 12:116590173-116590195 CAAAAAAATTAGCTGGGCGTGGG - Intergenic
1103072711 12:117957983-117958005 CAAAAAAATTAGCTGGTGTGGGG - Intronic
1103136073 12:118508974-118508996 TACAAAAATTAGCTGGGCGTCGG + Intergenic
1103189707 12:118990955-118990977 TACAAAAATTAGCTGGGTGCGGG - Intronic
1103505384 12:121439533-121439555 TACAAAAATTAGCCGGGGGTTGG - Intronic
1103524445 12:121558607-121558629 TACAAAAATTAGCTGGGGCATGG - Intronic
1103536424 12:121636839-121636861 AAAAAAAATTAGCTGGGGTGTGG - Intronic
1103538802 12:121652088-121652110 CACAAAAATTAGCTGGGCGTGGG - Intronic
1103585273 12:121948563-121948585 TATAAAAATTAGCTGGGTGTGGG + Intronic
1103590461 12:121988888-121988910 TACAAAAATTAGCTGGGCGTGGG - Intronic
1103624908 12:122210882-122210904 TAAAAAAATTAGCTGGGGCATGG + Intronic
1103774497 12:123356594-123356616 CAAAAAAATTAGCTGGGTGTGGG - Intronic
1103790674 12:123468532-123468554 CACAAAAATTAGCCGGGTGTTGG + Intronic
1103806703 12:123579418-123579440 CAAAAAAACTAGCTGGGTGTGGG + Intergenic
1103822746 12:123711889-123711911 CAAAAAAATTAGCTGGACGCGGG + Intergenic
1104020156 12:124986899-124986921 TACAAAAATTAGCTGGGGCGTGG - Intronic
1104102415 12:125625285-125625307 TAAAAAAATTAGCTGGGCGTGGG - Intronic
1104435868 12:128756115-128756137 CAGAAAAACAGGCTGGGTGCGGG + Intergenic
1104500301 12:129278775-129278797 CAGAGAAATTAGCAGGAGACAGG + Intronic
1104503617 12:129310032-129310054 CAGAAAATCTAGATGAGGGCTGG + Intronic
1104621671 12:130318590-130318612 CACAAAAATTAGTTGGGAGGAGG + Intergenic
1104662927 12:130624877-130624899 TACAAAAATTAGCTGGGCGTGGG - Intronic
1104781942 12:131427606-131427628 CTGAGAGATGAGCTGGGGGCTGG + Intergenic
1105491087 13:20888962-20888984 CAAAAAAATTAACTGGGAACTGG - Intronic
1105588189 13:21764092-21764114 CAAAAAAATTAGCCGGGGCCGGG - Intergenic
1105893059 13:24695759-24695781 CAAAAAAATTAGCTGGGCAGGGG - Intronic
1105897932 13:24733260-24733282 ACGAAAAATTAGCTGGGCGTGGG - Intergenic
1105978816 13:25497805-25497827 AAAAAAAATTAGCTGGGTGTGGG + Intronic
1106141522 13:27015653-27015675 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1106341997 13:28838688-28838710 CAGAAAGAAAAGCTGAGGGCTGG - Intronic
1106362863 13:29048757-29048779 TACAAAAATTAGCTGTGTGCAGG - Intronic
1106384917 13:29274883-29274905 AAAAAAAATTAGCTGGGGCATGG - Intronic
1106522284 13:30508355-30508377 TACAAAAATTAGCTGGGCGTGGG + Intronic
1106528689 13:30567502-30567524 CAAAAAAATTAGCTGGGTGTGGG - Intronic
1106738414 13:32612218-32612240 CAAAAAAATTAGCTGGGCTTGGG - Intronic
1106919105 13:34543543-34543565 TACAAAAATTAGCCGGGGGTGGG + Intergenic
1107279021 13:38712073-38712095 TACAAAAATTAGCTGGGGGTGGG - Intronic
1107531911 13:41290547-41290569 TACAAAAATTAGCTGGGCACTGG - Intergenic
1107680166 13:42839775-42839797 CAGAGAAATGAACTGGGGGTGGG + Intergenic
1107909131 13:45088814-45088836 TAAAAAAATTAGCTGGGGCTGGG - Intergenic
1107938765 13:45366240-45366262 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1108386733 13:49906063-49906085 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
1108396941 13:49998772-49998794 TACAAAAATTAGCTGGGCGTGGG + Intronic
1108411873 13:50157647-50157669 AAAAAAAATTAGCTGGGCACGGG + Intronic
1108540879 13:51444238-51444260 AAAAAAAATTAGCTGGGGGGTGG - Intronic
1108563417 13:51670041-51670063 CAGACAAACTGGCTGGGGACTGG - Intronic
1108606542 13:52045282-52045304 CAAAAAAATTAGCCGGGCGTGGG - Intronic
1108612654 13:52099374-52099396 TATAAAAATTAGCCGGGGCCGGG + Intronic
1108905650 13:55468794-55468816 CAAAAAAATTAGCCGGGGCTGGG + Intergenic
1109600566 13:64622385-64622407 TACAAAAATTAGCTGGTGGCAGG + Intergenic
1109601421 13:64634835-64634857 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1109953929 13:69540811-69540833 TAGAAAAATTAGCTGGTGCATGG - Intergenic
1110144849 13:72178187-72178209 CATAAAAGAAAGCTGGGGGCTGG - Intergenic
1110165690 13:72440407-72440429 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1110229997 13:73158006-73158028 CACAAAAATTAGCAGGGGGCCGG - Intergenic
1110608773 13:77465307-77465329 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1110652506 13:77958668-77958690 CATTAAAATAACCTGGGGGCTGG - Intergenic
1110855488 13:80292827-80292849 TACAAAAATTAGCAGGGTGCAGG + Intergenic
1110858627 13:80323908-80323930 TACAAAAATTAGCTGGGCGTGGG + Intergenic
1111110864 13:83707547-83707569 CAAAAAAATTAGCCGGGGGGTGG - Intergenic
1111279744 13:86005733-86005755 CAAAAAAATTAGCGGGGTGGTGG + Intergenic
1111762373 13:92481974-92481996 CAAAAAAATTAGCCGGGTGTCGG + Intronic
1112224579 13:97525943-97525965 CAAAAAAATTAGCTGGGCGTGGG - Intergenic
1112242448 13:97695291-97695313 TAGAAAAATTAGCTGGGTGTGGG - Intergenic
1112270242 13:97961972-97961994 TACAAAAATTAGCTGGGCGTGGG + Intronic
1112280424 13:98058221-98058243 CAAAAAAATTAGCCGGGCGTAGG + Intergenic
1112403777 13:99099747-99099769 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1112453826 13:99539046-99539068 ATGAAAAATTAGCTGGGCGTGGG + Intronic
1112486407 13:99824267-99824289 CAAAAGGATTAGCTGGGGGTGGG - Intronic
1113774638 13:112936123-112936145 TACAAAAATTAGCTGGGTACAGG + Intronic
1115225258 14:31095570-31095592 TACAAAAATTAGCTGGGTGGAGG - Intronic
1115348847 14:32371450-32371472 CAAAAGAATTAGCTGGGCGTGGG + Intronic
1115571736 14:34673042-34673064 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1115573714 14:34690900-34690922 CAAAAAAATTAGCCGGGCGGTGG - Intergenic
1115656844 14:35451606-35451628 TACAAAAATTAGCTGGGTGGTGG - Intergenic
1115935021 14:38542735-38542757 CAAAAAAATTAGCAGGGCGTGGG + Intergenic
1116295846 14:43107664-43107686 AAAAAAAATTAGCTGGGGCATGG + Intergenic
1116806155 14:49495623-49495645 TACAAAAATTAGCTGGGTGTTGG + Intergenic
1116889612 14:50255378-50255400 TACAAAAATTAGCTGGGGCGTGG + Intronic
1117144581 14:52824183-52824205 AAAAAAAATTAGCTGGGTGTGGG + Intergenic
1117674261 14:58140112-58140134 TACAAAAATTAGCTGGGAGTGGG + Intronic
1117988585 14:61412445-61412467 CAGATAAATTAGCAGGGGCCAGG - Intronic
1118212291 14:63776753-63776775 TACAAAAATTAGCTGGGTGGTGG - Intergenic
1118384957 14:65248460-65248482 CAAAAAAATTATCTGGGTGTGGG - Intergenic
1118630265 14:67695952-67695974 CAGAAAAAATAACTGAGAGCTGG - Intergenic
1118834089 14:69463783-69463805 AAAAAAAATTAGCTGGGGCCAGG + Intergenic
1118854074 14:69607726-69607748 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1118858643 14:69644493-69644515 TAGAAAAATTAGCTGGGCTTGGG + Intronic
1119250241 14:73146341-73146363 AAAAATAATTAGCTGGGTGCAGG - Intronic
1119270781 14:73302559-73302581 CAAAAAAATTAGCTGGGTGTGGG - Intronic
1119315586 14:73691850-73691872 TACAAAAATTAGCTGGGGGGGGG - Intronic
1119344122 14:73907735-73907757 TACAAAAATTAGCTGGGGCATGG + Intronic
1119375876 14:74192438-74192460 TACAAAAATTAGCTGGGCGTGGG - Intronic
1119398264 14:74344577-74344599 CAAAAAAATTAGCAGGGGCGTGG + Intronic
1119458132 14:74774386-74774408 CAAAAAAATTAGCTGGGCCATGG - Intronic
1119512628 14:75223391-75223413 ATAAAAAATTAGCTGGGGCCAGG - Intergenic
1119521219 14:75286874-75286896 TGCAAAAATTAGCTGGGGGTGGG + Intergenic
1119753916 14:77100394-77100416 CACAAAAATTAGCTGGGCTTGGG - Intronic
1119797886 14:77415868-77415890 TACAAAAATTAGCTGGGCGTGGG - Intronic
1119933496 14:78569712-78569734 TACAAAAATTAGCTGGGTGTGGG - Intronic
1120189928 14:81431481-81431503 TAGAAAAATTACCTGTGGCCAGG + Intronic
1120226787 14:81799661-81799683 CAGAAATCTTACATGGGGGCAGG - Intergenic
1120338825 14:83192729-83192751 CAGCAAGAGTAGCTGAGGGCAGG + Intergenic
1120789478 14:88566032-88566054 CACAAAAATTAGCCGGGGGGGGG - Intronic
1121009399 14:90511082-90511104 TATAAAAATTAGCTGGGCGTAGG + Intergenic
1121059155 14:90887804-90887826 AAAAAAAATTAGCTGGGGTATGG + Intronic
1121102638 14:91260613-91260635 AAAAAAAATTAGCTGGGCGTGGG + Intergenic
1121140878 14:91540461-91540483 AATAAAAATTAGCTGGGTGTGGG + Intergenic
1121756279 14:96405336-96405358 AAAAAAAATTAGCTGGGGTATGG - Intronic
1121792282 14:96708153-96708175 CATAACAATTAACTGGGGGGGGG - Intergenic
1122051696 14:99065353-99065375 CAGAACAACCAGGTGGGGGCGGG - Intergenic
1122115289 14:99524429-99524451 CAGGGAAATTATCTGGGGGAGGG - Intronic
1122163037 14:99800646-99800668 CTTAAAAATTAGCTGGGTGCAGG - Intronic
1122595688 14:102888923-102888945 CAGGAAAATTAGGTGGGGCTGGG - Intronic
1122598219 14:102907984-102908006 CAGGAAAACTACCTGAGGGCAGG - Exonic
1122646927 14:103201052-103201074 CAGAAGAATTAGGTGGGGTGGGG - Intergenic
1122708002 14:103633507-103633529 CAGAGAAGCTAGGTGGGGGCAGG + Intronic
1123587871 15:21775054-21775076 AAAAAAAATTAGCTGGGCGTGGG - Intergenic
1123624509 15:22217619-22217641 AAAAAAAATTAGCTGGGCGTGGG - Intergenic
1124020644 15:25919581-25919603 TATAAAAATTAGCTGGGTGTGGG - Intergenic
1124097813 15:26665599-26665621 CAGAAAAAGGAGCTGGTGTCAGG + Intronic
1124373481 15:29116292-29116314 CAGGAAAGTGTGCTGGGGGCTGG - Intronic
1124498871 15:30209104-30209126 TACAAAAATTAGCTGGGCACTGG + Intergenic
1124649878 15:31466614-31466636 CAAAAAAATTAGCCGGGGCCAGG - Intergenic
1124744708 15:32329572-32329594 TACAAAAATTAGCTGGGCACTGG - Intergenic
1124831841 15:33156434-33156456 CAAAAAAACTAGCTGGGTGGTGG - Intronic
1124854350 15:33372658-33372680 ACAAAAAATTAGCTGGGGCCGGG - Intronic
1125365636 15:38912490-38912512 AAAAAAAATTAGCTGGGCGCGGG - Intergenic
1125630618 15:41144075-41144097 TAGAAAAATTAGCTGGGCATGGG - Intergenic
1125668103 15:41448562-41448584 TACAAAAATTAGCTGGGTGTGGG + Intronic
1125800674 15:42443957-42443979 TACAAAAATTAGCTGGGGGTGGG + Intronic
1125867642 15:43068342-43068364 TACAAAAATTAGCTGGGGTGTGG - Intronic
1126160417 15:45607616-45607638 TACAAAAATTAGCTGGGTGTGGG + Exonic
1126909532 15:53403059-53403081 TAGAAAAATTAGCCGGGGGCTGG + Intergenic
1126963596 15:54026565-54026587 CAGCAAAATCAGCTGGAGACTGG - Intronic
1127076048 15:55326710-55326732 CAAAAAAATTAGCCGGGCGTGGG + Intronic
1127104422 15:55597848-55597870 AAAAAAAATTAGCTGGGGATGGG - Intergenic
1127120969 15:55771745-55771767 CAAAAAAATTAGCCGGGGCATGG + Intergenic
1127240267 15:57105564-57105586 TACAAAAATTAGCTGGGTGTGGG - Intronic
1127375518 15:58381078-58381100 TACAAAAATTAGCTGGGGGGCGG + Intronic
1127446822 15:59071536-59071558 AACAAAAATTAGCTGGGCGTGGG + Intronic
1127587014 15:60388031-60388053 TACAAAAATTAGCTGGGCGTGGG + Intronic
1127918734 15:63476574-63476596 CAGAGACATTAGCTAGGTGCTGG + Intergenic
1127952288 15:63821256-63821278 TAAAAAAATTAGCAGGGGGCCGG + Intronic
1128253345 15:66179285-66179307 TACAAAAATTAGCTGGGTGTGGG - Intronic
1128459760 15:67857965-67857987 TATAAAAATTAGCTAGGGGGTGG + Intergenic
1128718943 15:69931397-69931419 CAGTAAATTTAGCTGGTGGCTGG + Intergenic
1128808303 15:70551172-70551194 AAGAAAAATTAGGTAGTGGCCGG - Intergenic
1128825167 15:70708621-70708643 CAAAAAAATTAGCCGGGTGTGGG - Intronic
1128922556 15:71625160-71625182 TACAAAAATTAGCCGGGGGGTGG - Intronic
1129017676 15:72482994-72483016 CAAAAAAATAAGCTGGGGTGTGG - Intronic
1129096083 15:73209850-73209872 CACAAAAATTAGCTGGGCGTGGG + Intronic
1129204793 15:74030492-74030514 TACAAAAATTAGCTGGGCGTGGG + Intronic
1129327757 15:74810428-74810450 TTAAAAAATTAGCTGGGGGCTGG + Intergenic
1129602329 15:77007451-77007473 TACAAAAATTAGCTGGGGCGTGG + Intronic
1129677495 15:77640142-77640164 CAGAAAAATAAACTGAGGCCAGG - Intronic
1129818859 15:78582329-78582351 TACAAAAATTAGCTGGGCGGTGG + Intronic
1129857565 15:78835503-78835525 TACAAAAATTAGCTGGGCGTAGG - Intronic
1129863989 15:78888309-78888331 TAAAAAAATTAGCTCGGGGGTGG + Intronic
1129865900 15:78908409-78908431 CAAAAAAATTAGCTGGGTTATGG - Intergenic
1129986103 15:79921144-79921166 CACAAAAATTAGCTGGGCATGGG + Intronic
1130066640 15:80610326-80610348 TATAAAAATTAGCTGGGGTGTGG - Intergenic
1130308707 15:82734155-82734177 CAAATAAATTAGCTGGGGCCAGG + Intergenic
1130328820 15:82903838-82903860 TAGAAAAATTAGCTGGGGGCTGG + Intronic
1130529267 15:84733732-84733754 AACAAAAATTAGCTGGGCACTGG - Intergenic
1130662465 15:85841430-85841452 CTGAAAAATAAGATGGGGCCAGG - Intergenic
1131134575 15:89923983-89924005 CACAAAAATTAGCTGGGAGTGGG + Intergenic
1131181822 15:90245318-90245340 CACAAAAATTAGCTGGGTGTGGG + Exonic
1131211293 15:90498970-90498992 TACAAAAATTAGCTGGGCGTTGG - Intronic
1131229928 15:90652492-90652514 TACAAAAATTAGCTGGGTGTTGG - Intergenic
1131251462 15:90833449-90833471 CAGACAAACTAGCTGGGTGTGGG - Intergenic
1131266641 15:90919391-90919413 TATAAAAATTAGCTGGGCGTGGG - Intronic
1131374817 15:91914865-91914887 AAGAGAAAATAGCTGGGGCCGGG - Intronic
1131736113 15:95334240-95334262 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1132439421 15:101843990-101844012 CAGAAAGTTCAGCTGGGAGCAGG + Intergenic
1132562650 16:604761-604783 TTGAAAAATTAGCCTGGGGCTGG + Intronic
1132819851 16:1859385-1859407 TACAAAAATTAGCTGGGTGTGGG + Intronic
1132876486 16:2141093-2141115 TACAAAAATTAGCTGGGTGTGGG + Intronic
1132926841 16:2434456-2434478 TACAAAAATTAGCTGGGTGGTGG + Intronic
1132984027 16:2754444-2754466 TACAAAAATTAGCTGGGCGGCGG - Intronic
1132991999 16:2800384-2800406 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1133043766 16:3074887-3074909 CAGAAAAGAAAGTTGGGGGCCGG + Intronic
1133057564 16:3153804-3153826 TAGAAAAATTAGCCGGGCGTGGG + Intergenic
1133158258 16:3890957-3890979 CAAAAAAATTAGCTGGGCATGGG - Intergenic
1133181645 16:4059230-4059252 TACAAAAATTAGCTGGTGGCGGG + Intronic
1133544156 16:6788769-6788791 CAGAAAAATCAGTGGGGGGCCGG - Intronic
1133760103 16:8791767-8791789 GTGAAAAATTAGCTGGGTGTAGG - Intronic
1133811805 16:9166471-9166493 TACAAAAATTAGCTGGGCGTCGG + Intergenic
1133964707 16:10522147-10522169 TACAAAAATTAGCTGGGGGTGGG + Intergenic
1134013981 16:10875856-10875878 TAGAAAAATTAGCTGGATGTAGG + Intergenic
1134102021 16:11459349-11459371 ACAAAAAATTAGCTGGGCGCGGG - Intronic
1134139456 16:11705047-11705069 CAGAAAAATTAGCTGGACATGGG - Intronic
1134164555 16:11919717-11919739 TAGAAAAATTACCAGGGGGTTGG - Intergenic
1134172699 16:11981120-11981142 CAAAAAAGTTAGCTGGGTGTGGG - Intronic
1134274982 16:12767800-12767822 TATAAAAATTAGCTGGGTGTGGG + Intronic
1134563536 16:15231351-15231373 CAAAAAAATTAGCCGGGCACGGG + Intergenic
1134724788 16:16410637-16410659 TAAAAAAATTAGCTGGGTGTGGG - Intergenic
1134816488 16:17210201-17210223 TAGAAAAATTATCTGTAGGCTGG + Intronic
1134831265 16:17325243-17325265 CAAAAAAATTAGCTGGGCATAGG + Intronic
1134942644 16:18301222-18301244 TAAAAAAATTAGCTGGGTGTGGG + Intergenic
1135009025 16:18856489-18856511 CAAAAAAATTAGCTGGGCGTGGG - Intronic
1135022042 16:18970926-18970948 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1135127155 16:19820492-19820514 ACAAAAAATTAGCTGGGCGCAGG + Intronic
1135267047 16:21036168-21036190 TACAAAAATTAGCTGGGGGGTGG + Intronic
1135316061 16:21445384-21445406 CAAAAAAATTAGCCGGGCGTGGG - Intronic
1135368986 16:21877646-21877668 CAAAAAAATTAGCCGGGCGTGGG - Intronic
1135442830 16:22493497-22493519 CAAAAAAATTAGCCGGGCGTGGG + Intronic
1135542955 16:23346374-23346396 TACAAAAATTAGCTGGTGGCGGG - Intronic
1135566835 16:23517522-23517544 GAAAAAAATTAGCTGGGGCCGGG - Intronic
1135714071 16:24745800-24745822 CCTAACAATTAGCTGGGGGGGGG - Intronic
1135771067 16:25218723-25218745 TACAAAAATTAGCTGGGCGTGGG + Intronic
1135836933 16:25834790-25834812 TACAAAAATTAGCTGGGTGTGGG + Intronic
1135877506 16:26216837-26216859 CAGATTAAATAGCTGAGGGCTGG + Intergenic
1135959025 16:26980392-26980414 TACAAAAATTAGCTGGGTGGTGG + Intergenic
1136116114 16:28095835-28095857 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1136312738 16:29424120-29424142 CAAAAAAATTAGCTGGGCATGGG - Intergenic
1136326173 16:29525871-29525893 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
1136440862 16:30265855-30265877 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
1136634315 16:31509784-31509806 TACAAAAATTAGCTGGGCGTGGG + Intergenic
1136684407 16:31985765-31985787 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1136717981 16:32300468-32300490 AAAAAAAATTAGCTGGGTGTGGG + Intergenic
1136751658 16:32641826-32641848 CACAAAAATTAGCTGGGCATGGG - Intergenic
1136785035 16:32929308-32929330 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1136884748 16:33924496-33924518 TACAAAAATTAGCTGGGCGTGGG + Intergenic
1136985678 16:35102182-35102204 CAAAAAAATTAGCCGGGCGTGGG + Intergenic
1137439561 16:48486308-48486330 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1137461928 16:48672301-48672323 TACAAAAATTAGCTGGGTACGGG + Intergenic
1137740749 16:50770603-50770625 CACAAAAATTAGCTGGGCTCGGG - Intronic
1137945932 16:52733233-52733255 CAAAAAAATTAGTTGGGCGTGGG + Intergenic
1137979862 16:53060460-53060482 TTTAAAAATTAGCTGGGGCCTGG + Intronic
1137987593 16:53123015-53123037 TATAAAAATTAGCTGGGTGTGGG - Intronic
1138094912 16:54204005-54204027 CAGAAAAATGGGATGGGTGCCGG + Intergenic
1138327501 16:56188029-56188051 CAGAAAAATCACCTGGGGAGTGG + Intergenic
1138454088 16:57111328-57111350 TACAAAAATTAGCTGGGCGTGGG - Intronic
1138461218 16:57148938-57148960 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1138486432 16:57347814-57347836 CAAAAAAATTAGCTGGGGCATGG + Intergenic
1138513626 16:57523633-57523655 AAAAAAAATTAGCTGGGAACGGG - Intronic
1138759563 16:59525920-59525942 AAAAAAAATTAGCTGGGCGTAGG + Intergenic
1138984846 16:62315802-62315824 GACAAAAATGAGCTGGGAGCTGG + Intergenic
1139394106 16:66626306-66626328 CTAAAAAATTAGCTGTGGCCAGG + Intronic
1139530764 16:67541671-67541693 CAGAAGAAGCAGCTGAGGGCTGG - Exonic
1139542315 16:67627501-67627523 AGAAAAAATTAGCTGGGGCCAGG + Intronic
1139550778 16:67671825-67671847 CAAAAAAATTAGCTGGGCACTGG + Intergenic
1139561471 16:67745128-67745150 CAAAAAAATTAGCTGGGCATCGG - Intronic
1139677196 16:68531983-68532005 TACAAAAATTAGCTGGGCGTTGG + Intronic
1139710113 16:68769771-68769793 TAAAAACATTAGCTGGGGCCTGG + Intronic
1139887376 16:70218171-70218193 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
1139912432 16:70406351-70406373 AACAAAAATTAGCCGGGGGGTGG + Intronic
1139913195 16:70411228-70411250 TACAAAAATTAGCTGGGCGTGGG + Intronic
1140043101 16:71422470-71422492 CAAAGAAATTAGCTGGGGTGTGG - Intergenic
1140249587 16:73284160-73284182 TACAAAAATTAGCTGGGCACGGG + Intergenic
1140359381 16:74331575-74331597 CTCAAAAATTACCTGGGGCCAGG + Intergenic
1140485900 16:75292955-75292977 CAGAAAAATGACCTGTGGTCAGG + Intergenic
1140707039 16:77640468-77640490 CAAAAAAATTAGCCGGGCGCAGG + Intergenic
1140826291 16:78709883-78709905 TACAAAAATTAGCTGGGCGTCGG - Intronic
1141105142 16:81227261-81227283 AAAAAAAATTAGCTGGGGCCAGG - Intergenic
1141463642 16:84192997-84193019 CAAAAAAATTAGCTGGGCACGGG - Intronic
1141478535 16:84290660-84290682 AAAAAAAATTAGCTGGGTGGTGG + Intergenic
1141521568 16:84583610-84583632 AAAAAAAATTAGCTGGGGCATGG - Intronic
1141541154 16:84722712-84722734 TACAAAAATTAGCTGGGCGTGGG - Intronic
1141992397 16:87618006-87618028 TACAAAAATTAGCTGGGGCATGG + Intronic
1142032915 16:87847315-87847337 CAGAAACATCGTCTGGGGGCTGG + Intronic
1142068296 16:88075048-88075070 TAAAAAAATTAGCTGGGGCCGGG + Intronic
1203008447 16_KI270728v1_random:217297-217319 AAAAAAAATTAGCTGGGTGTGGG - Intergenic
1203053794 16_KI270728v1_random:901079-901101 CACAAAAATTAGCTGGGCATGGG - Intergenic
1203087695 16_KI270728v1_random:1193317-1193339 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1203146538 16_KI270728v1_random:1807034-1807056 AAAAAAAATTAGCTGGGTGTGGG + Intergenic
1142723918 17:1797845-1797867 TACAAAAATTAGCTGGGCGTGGG + Intronic
1142732108 17:1866611-1866633 TAAAAAAATTAGCCGGTGGCCGG - Intronic
1142790469 17:2260414-2260436 CAAAAAAACTAGCTGGAAGCAGG - Intronic
1142889496 17:2933620-2933642 CAGGAAAGTGAGCAGGGGGCTGG - Intronic
1142995320 17:3756698-3756720 AACAAAAAGTAGCTGGGGCCAGG - Intronic
1143074933 17:4333519-4333541 TACAAAAATTAGCTGGGCGCTGG + Intronic
1143175480 17:4952616-4952638 TACAAAAATTAGCTGAGGCCGGG - Intronic
1143262188 17:5607653-5607675 CTCAAAAATTACGTGGGGGCTGG + Intronic
1143349705 17:6278260-6278282 CATAAAAATAAGCTGGAGGCCGG - Intergenic
1143358663 17:6350172-6350194 CAGATGGATTAGCTGGGGTCGGG - Intergenic
1143409237 17:6698481-6698503 CAGAAACACTAGTTGGGGCCGGG - Intronic
1143708980 17:8720678-8720700 TAAAAAAATTAGCTGGGCGTGGG - Intergenic
1143848087 17:9788359-9788381 TACAAAAATTAGCTGGGGGTGGG - Intronic
1143909539 17:10236310-10236332 CACAAAAATTAGCCGGGCGGTGG + Intergenic
1144137693 17:12314319-12314341 CAGAGAACAAAGCTGGGGGCCGG - Intergenic
1144146608 17:12405084-12405106 AAAAAAAATTAGCTGGGGCGTGG - Intergenic
1144155365 17:12495111-12495133 TACAAAAATTAGCTGGGCGTGGG + Intergenic
1144273052 17:13637788-13637810 TATAAAAATTAGCTGGGTGTGGG + Intergenic
1144545611 17:16192358-16192380 ACAAAAAATTAGCTGGGGCCGGG + Intronic
1144583830 17:16475890-16475912 TATAAAAATTAGCTGGGTGTTGG + Intronic
1144696658 17:17308435-17308457 TACAAAAATTAGCTGGGCGTGGG + Intronic
1144720886 17:17469191-17469213 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1144799669 17:17917003-17917025 TACATAAATTAGCTGGGCGCAGG + Intronic
1144871293 17:18373210-18373232 CACAAAAATTAGCTGGGCAGTGG + Intergenic
1144967061 17:19083709-19083731 TACAAAAATTAGCTGGGCGTGGG + Intergenic
1144980859 17:19168358-19168380 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1145055304 17:19699554-19699576 TTTAAAAATTAGCTGGGGGAGGG - Intronic
1145104590 17:20104586-20104608 TACAAAAATTAGCTGGGTGTGGG + Intronic
1145300900 17:21635817-21635839 ACAAAAAATTAGCTGGGGCCGGG - Intergenic
1145349400 17:22067461-22067483 CAAAAAAATTAGCTGGGGCCGGG + Intergenic
1145790325 17:27622620-27622642 CAGAAAAATTGTCTGGAGCCAGG - Exonic
1145930202 17:28679833-28679855 TACAAAAATTAGCTGGGCGTGGG + Intronic
1145938941 17:28731381-28731403 TAAAAAAATTAGCTGGGCGTGGG + Intronic
1146022143 17:29288987-29289009 TACAAAAATTAGCTGGGCGTGGG + Intronic
1146065896 17:29635056-29635078 TACAAAAATTAGCTGGGGTGTGG - Intronic
1146069402 17:29666216-29666238 TACAAAAATTAGCTGGGGGCTGG + Intronic
1146070914 17:29680390-29680412 TACAAAAATTAGCTGGGTGCAGG + Intronic
1146110717 17:30086595-30086617 AAAAAAAATTAGCCGGGGCCGGG + Intronic
1146116718 17:30147282-30147304 TACAAAAATTAGCTGGGGCATGG - Intronic
1146231681 17:31116820-31116842 CAAAAAAATTAGCTGGGCATGGG - Intronic
1146387770 17:32392538-32392560 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1147135620 17:38432382-38432404 TTTAAAAATTAGCTGGGGCCAGG + Intronic
1147206874 17:38843721-38843743 AAAAAAAATTAGCTGGGTGGCGG - Intergenic
1147226783 17:38985348-38985370 CACAAAAATTAGCCGGGTGTGGG - Intergenic
1147474659 17:40699171-40699193 TTAAAAAATTAGCTGGAGGCTGG - Intronic
1147648265 17:42047325-42047347 CAAAAAAATTAGCCGGGGCCAGG - Intronic
1147796637 17:43048355-43048377 TACAAAAATTAGCTGGGCGTAGG - Intronic
1147799444 17:43072861-43072883 AAAAAAAACTAGCTGGGGCCAGG - Intronic
1147939822 17:44038498-44038520 TACAAAAATTAGCTGGGCGTGGG + Intronic
1147943956 17:44069787-44069809 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1148099635 17:45080920-45080942 TATAAACATTAGCTGGGGCCTGG - Intronic
1148118327 17:45191554-45191576 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1148231629 17:45939107-45939129 TTTAAAAATTAGCTGGGGCCGGG - Intronic
1148504311 17:48115214-48115236 CACAAAAATTAGCTGGGCGTGGG - Intronic
1148648461 17:49232679-49232701 CACAAAAATTAGCTGGGCATGGG - Intergenic
1148706447 17:49637645-49637667 TAGAAGAACTAGCTTGGGGCTGG - Intronic
1148711825 17:49687509-49687531 GACAAAAATTAGCTGGGCGTGGG + Intergenic
1148939880 17:51199249-51199271 CAAAAAAATTAGCTGGGCCTGGG - Intronic
1149014211 17:51889367-51889389 CAAAAAAATTAGCTAGGTGTTGG + Intronic
1149015222 17:51901337-51901359 CAGAGAACAAAGCTGGGGGCTGG - Intronic
1149138460 17:53399769-53399791 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1149482171 17:57012521-57012543 AAAAAGAATTAGCTGGTGGCCGG - Intergenic
1149509098 17:57223127-57223149 CAAAAAAATTAGCCGGGCGCGGG + Intergenic
1149694765 17:58608126-58608148 TACAAAAATTGGCTGGGCGCAGG + Intronic
1149697031 17:58624127-58624149 CAAAAAAATTAGCCGGGCGTAGG + Intronic
1149698212 17:58633670-58633692 CACAAAAATTAGCCGGGGGCCGG + Intronic
1149819179 17:59758527-59758549 TAGAAAAATTAGATGGGGCCAGG + Intronic
1150017523 17:61573285-61573307 TACAAAAATTAGCTGGGGGATGG - Intergenic
1150105094 17:62456803-62456825 TACAAAAATCAGCTGGGGGGGGG + Intergenic
1150155424 17:62849165-62849187 CACAAAAATTAGCTGGGACCAGG - Intergenic
1150333727 17:64314897-64314919 AAAAAAAATTAGCTGGGGTGTGG - Intergenic
1150351217 17:64446149-64446171 TAGAAAAACTATCTGGAGGCCGG - Intergenic
1150491224 17:65575681-65575703 CAAAAAAATTAGCCGGGTGGTGG + Intronic
1150545595 17:66154358-66154380 TACAAAAATTAGCTGGGTGTGGG + Intronic
1150628544 17:66859431-66859453 CAGTAAAATGTGCTGGAGGCAGG + Intronic
1150679962 17:67276764-67276786 ACAAAAAATTAGCTGGGGCCAGG - Intergenic
1150720565 17:67610764-67610786 TACAAAAATTAGCTGGGCACTGG + Intronic
1150745661 17:67814540-67814562 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1150958847 17:69892563-69892585 CAGAAAAATATGCTGGGGAAAGG + Intergenic
1151356869 17:73564068-73564090 CAAAAAGATTTACTGGGGGCTGG - Intronic
1151359449 17:73579820-73579842 CACAAAAATTAGCTGGGGGTTGG + Intronic
1151544419 17:74783881-74783903 TGCAAAAATTAGCTGGGGGGTGG - Intronic
1151850943 17:76689243-76689265 CAAAAAAATTAGCTGGGCTTGGG - Intronic
1151871401 17:76839399-76839421 CAGAAAAATCTGTTGGGGCCGGG - Intergenic
1151982624 17:77522770-77522792 CAAAAAAATTAGCTGGGCGTCGG - Intergenic
1152001552 17:77648788-77648810 TACAAAAATTAGCTGGGCACAGG - Intergenic
1152099686 17:78293872-78293894 TACAAAAATTAGCTGGGTGTAGG - Intergenic
1152136841 17:78509260-78509282 TAAAAAAATTAGCGGGGGACCGG - Intronic
1152832787 17:82508972-82508994 CAAAAAAATGAGCTGGTGGCCGG + Intergenic
1152835708 17:82529540-82529562 TACAAAAATTAGCTGGGAGTGGG - Intronic
1152981300 18:279742-279764 CATAAAAATTAGCTGGGCATGGG + Intergenic
1153111151 18:1589184-1589206 TACAAAAATTAGCTGGGGCGTGG + Intergenic
1153204521 18:2682616-2682638 AAGAAAAAGTATCAGGGGGCCGG - Intronic
1153664547 18:7357249-7357271 ACAAAAAATTAGCTGGGTGCGGG + Intergenic
1154335520 18:13461908-13461930 CAGAAAAAGTGGGAGGGGGCAGG + Intronic
1155028931 18:21967400-21967422 TTAAAAAATTAGCGGGGGGCCGG + Intergenic
1155034915 18:22018074-22018096 AAAAAAAATTAGCTGGGTGTGGG + Intergenic
1155091890 18:22520166-22520188 CAGAAGGATAAGCTGGGAGCTGG - Intergenic
1155212452 18:23613885-23613907 TACAAAAATTAGCTGGGCGTGGG - Intronic
1155867359 18:30982647-30982669 CAAAAAAATTAGCTGGGCTTGGG - Intergenic
1155952378 18:31927551-31927573 AAAAAAAATTAGCTGGTAGCTGG - Intronic
1156172319 18:34500616-34500638 TACAAAAATTAGCTGGGCGTGGG - Intronic
1156467226 18:37355516-37355538 CACAAAAATTAGCTGGGCGCAGG + Intronic
1157216496 18:45787878-45787900 CAAAAAAATTAGCTGGGCGTCGG + Intergenic
1157250568 18:46092455-46092477 AAAAAAAATTAGCTGGGCACGGG + Intronic
1157295595 18:46439982-46440004 TACAAAAATTAGCTGGGTGTAGG - Intronic
1157307185 18:46525754-46525776 CTGAAAGATTTGCTGGGTGCAGG + Intronic
1157420197 18:47541370-47541392 CAGAAATATCAGGTGGAGGCTGG + Intergenic
1157673151 18:49547826-49547848 TAGAACAATTAGCTGGGGGTGGG + Intergenic
1157685137 18:49637290-49637312 CAAAAAAATTAGCGGAGGCCAGG - Intergenic
1157869040 18:51212452-51212474 AAAAAAAATTAGCTGGGGCGTGG + Intronic
1157955788 18:52096072-52096094 CACAAAAATTAGCCGGGAGGTGG + Intergenic
1158040970 18:53093125-53093147 TATAAAAATTAGCTGGGCGTGGG + Intronic
1158129276 18:54134713-54134735 CAAAAAAATTAGCTAAGGGATGG + Intergenic
1158364707 18:56720293-56720315 TACAAAAATTAGCTGGGTGTGGG + Intronic
1158596968 18:58825096-58825118 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1158706883 18:59800648-59800670 CACAAAAATTAGCTGTGTGGTGG - Intergenic
1158956934 18:62549062-62549084 ACAAAAAATTAGCTGGGGGAGGG + Intronic
1158968395 18:62643734-62643756 CAGAAAAGTAAGTTTGGGGCTGG + Intergenic
1158992627 18:62885503-62885525 TACAAAAATTAGCTGGGTGTGGG + Intronic
1159041493 18:63326992-63327014 TACAAAAATTAGCTGGGCGTGGG + Intergenic
1159452188 18:68616626-68616648 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1159642211 18:70876733-70876755 TAGAAAGACAAGCTGGGGGCTGG - Intergenic
1159846260 18:73464479-73464501 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1160167552 18:76527606-76527628 TACAAAAATTAGCCGGGCGCGGG + Intergenic
1160199761 18:76786940-76786962 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1160335071 18:78031527-78031549 CAGAGAAATGGGCTGGGGGAGGG - Intergenic
1160459682 18:79029062-79029084 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1160518737 18:79492406-79492428 TACAAAAATTAGCTGGGCGTGGG + Intronic
1160755021 19:752523-752545 CAAAAAAAAAAGCGGGGGGCGGG + Intronic
1161073154 19:2272315-2272337 CACAAAAATTAGCTGGGCATCGG - Intronic
1161195787 19:2985778-2985800 CAAAAAGAGTAGCTGGGGCCAGG + Intronic
1161305934 19:3568028-3568050 CACAAAAATTAGCTGGGCATGGG - Intronic
1161340828 19:3741155-3741177 TACAAAAATTAGCTGGGGGCGGG - Intronic
1161342229 19:3749496-3749518 AAAAAAAATTAGCTGGGTGTGGG - Intronic
1161382185 19:3971211-3971233 CCGAAAAGGCAGCTGGGGGCGGG - Intergenic
1161416009 19:4146799-4146821 TACAAAAATTAGCTGGGCACAGG - Intergenic
1161459427 19:4388013-4388035 TACAAAAATTAGCTGGGCGTGGG - Intronic
1161554819 19:4935120-4935142 TACAAAAATTAGCTGGTGGTGGG - Intronic
1161813946 19:6487664-6487686 CTAAAAAAATAGCTGGGTGCAGG + Intergenic
1161979662 19:7623973-7623995 CAGAGCACTTGGCTGGGGGCTGG - Intronic
1161992984 19:7695619-7695641 TAAAAAAATTAGCTAGGGCCAGG + Intronic
1162049468 19:8023990-8024012 AATAAAAATTAGCTGGGGGTTGG + Intronic
1162050561 19:8029871-8029893 TAAAAAAATTAGCTGGGGCTGGG + Intronic
1162050603 19:8030177-8030199 AAAAAAAATTAGCTGGGGCCGGG + Intronic
1162104063 19:8359424-8359446 AAAAAAAATTAGCTGGGGCCCGG - Intronic
1162104117 19:8359732-8359754 TTAAAAAATTAGCTGGGGCCAGG - Intronic
1162125110 19:8495393-8495415 TAAAAAAACTAGCTGGGGCCGGG - Intronic
1162230783 19:9264291-9264313 CACAAAAATTAGCTGGGCATGGG - Intergenic
1162309615 19:9898204-9898226 TAAAAAAATTAGCTGGGGCCAGG - Intronic
1162367044 19:10255990-10256012 ACAAAAAATTAGCTGGGGCCAGG + Intronic
1162387825 19:10370661-10370683 TACAAAAATTAGCTGGGTGTGGG + Intronic
1162399170 19:10434358-10434380 CAAAAAAATTAGCTGGGCTATGG - Intronic
1162463610 19:10828132-10828154 TACAAAAATTAGCCGGGGGTTGG + Intronic
1162503327 19:11067159-11067181 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1162530792 19:11235403-11235425 TACAAAAATTAGCTGGGGCCAGG - Intronic
1162644401 19:12038222-12038244 CACACAAATTAGCTGGGTGTGGG + Intronic
1162657683 19:12143790-12143812 TACAAAAATTAGCTGGGTGTGGG + Intronic
1162775537 19:12976673-12976695 ATTAAAAATTAGCTGGGCGCCGG + Intergenic
1162882412 19:13669621-13669643 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1163000618 19:14364383-14364405 AATAAAAATTAGCTGGGTGTGGG + Intergenic
1163077708 19:14909743-14909765 TACAAAAATTAGCTGGGGCGTGG + Intergenic
1163295396 19:16408503-16408525 TACAAAAATTAGCTGGGTGTGGG + Intronic
1163316853 19:16546452-16546474 TACAAAAATTAGCTGGGGGTAGG - Intronic
1163390660 19:17027889-17027911 TATAAAAATTAGCTGGGTGCGGG - Intergenic
1163410699 19:17152400-17152422 TACAAAAATTAGCTGGGTGGGGG + Intronic
1163440703 19:17321284-17321306 TAGAAAAATTAGCTGGGTGTAGG - Exonic
1163504706 19:17698739-17698761 ACAAAAAATTAGCTGGGGCCGGG - Intergenic
1163512336 19:17742847-17742869 CAAAAAAATTAGCTGGGTGTGGG - Intergenic
1163570828 19:18081390-18081412 CAGAAAAGGATGCTGGGGGCTGG - Intronic
1163631672 19:18420701-18420723 TACAAAAATTAGCTGGGCGTGGG + Intronic
1163654231 19:18536504-18536526 TACAAAAATTAGCTGGGTGTGGG - Intronic
1163715839 19:18871515-18871537 AAAAAAAGTTAGCTGGGGCCAGG - Intronic
1163718477 19:18886252-18886274 TATAAAAATTAGCTGGGGCCGGG + Intronic
1163733543 19:18964423-18964445 CAAAACAATGAGCTGGGGCCAGG + Intergenic
1163770981 19:19191198-19191220 CAAAAAAATTAGCTGGGCATGGG + Intronic
1163788300 19:19289445-19289467 TACAAAAATTAGCTGGGCGTGGG + Intronic
1163788509 19:19290960-19290982 TACAAAAATTAGCTGGGCGTGGG + Intronic
1164077431 19:21833420-21833442 CAAAAAAATTAGCTGGGTGCAGG - Intronic
1164233788 19:23314622-23314644 GAGAAAAATAACCTAGGGGCTGG - Intronic
1164285421 19:23811169-23811191 CACAAAATTTAGCTGGGTGGTGG - Intronic
1164303387 19:23981713-23981735 GAGAAAAATAACCTAGGGGCTGG + Intergenic
1164309664 19:24034644-24034666 CGCAAAAATTAGCTGGGCGTCGG - Intronic
1164313994 19:24070857-24070879 CAAACAAATTACCTGGGTGCAGG - Intronic
1164649867 19:29884011-29884033 TATAAAAATTAGCTGGAGGCTGG - Intergenic
1164770908 19:30808244-30808266 CACAAAAATTAGCTGGGCGTGGG - Intergenic
1165048775 19:33127861-33127883 TACAAAAATTAGCTGGGTGTGGG - Intronic
1165210507 19:34231946-34231968 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1165224826 19:34347388-34347410 TACAAAAATTAGCTGGGTGTGGG - Intronic
1165310863 19:35028907-35028929 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1165354458 19:35295106-35295128 AAGAAAAATTAACTGGGTGTGGG + Intronic
1165414444 19:35683599-35683621 TACAAAAATTAGCCAGGGGCTGG - Intergenic
1165449814 19:35875614-35875636 TACAAAAATTAGCTGGGGCCGGG - Intronic
1165466969 19:35980452-35980474 GACAAAAATTAGCCGGAGGCCGG + Intergenic
1165583101 19:36886689-36886711 TACAAAAATTAGCTGGGGGCCGG + Intronic
1165715343 19:38041570-38041592 TACAAAAATTAGCTGGGGCCTGG - Intronic
1165947769 19:39455263-39455285 TAAAAAAATTACGTGGGGGCTGG + Intronic
1165986242 19:39771372-39771394 TTTAAAAATTAGCTGGGTGCTGG - Intergenic
1166092397 19:40518585-40518607 TACAAAAATTAGCTGGGCGTGGG - Intronic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166308032 19:41946308-41946330 TACAAAAATTAGCTGGGGTGTGG - Intergenic
1166530233 19:43538238-43538260 AAAAAAATTTAGCTGGGGGCTGG - Intergenic
1166542592 19:43615267-43615289 TACAAAAATTAGCTGGGTGTGGG - Intronic
1166717491 19:44977707-44977729 CAGAAAAAGCAGCTGGAGACAGG + Intronic
1166735785 19:45083752-45083774 TAGAAAAATTAGCTGGGCAAAGG - Intronic
1166757805 19:45204343-45204365 CAAAAAAATTAGCTGGGGCATGG - Intronic
1166774021 19:45301702-45301724 TACAAAAATTAGCTGGGGCCAGG + Intronic
1166776850 19:45318251-45318273 TACAAAAATTAGCTGGGTGTGGG + Intronic
1166865253 19:45832137-45832159 CAAAAAAAACAGCTGAGGGCTGG - Intronic
1166884408 19:45951318-45951340 TACAAAAATTAGCCAGGGGCCGG + Intronic
1166978394 19:46618448-46618470 TAAAAAAATTAGCTGGGTGCTGG - Intergenic
1166992589 19:46701464-46701486 TACAAAAATTAGCTGGGCGTGGG + Intronic
1167063578 19:47167252-47167274 TACAAAAATTATCTGGGCGCAGG - Intronic
1167078446 19:47263338-47263360 AAGCAAAATCAGCAGGGGGCGGG + Intronic
1167089661 19:47335037-47335059 AAAAAAAATTAGCTGGGCGTGGG - Intronic
1167151424 19:47712527-47712549 AACAAAAATTAGCTGGATGCAGG - Intergenic
1167171099 19:47832638-47832660 TACAAAAATTAGCTGGGCACAGG - Intronic
1167451277 19:49571123-49571145 AAAAAAAATTAGCTGGGCGTGGG - Intronic
1167518118 19:49935164-49935186 AAAAAAAATTAGGTGGGGCCGGG + Intronic
1167584640 19:50367123-50367145 TACAAAAATTAGCTGGGTGTAGG - Intronic
1167785774 19:51635037-51635059 CACAAAAATTAGCTGGGCATGGG + Intronic
1167840942 19:52119220-52119242 TACAAAAATTAGCTGGGTGTGGG + Intronic
1168050528 19:53826391-53826413 AAAAAAAATTAGCTGGGGTTTGG + Intergenic
1168419899 19:56194759-56194781 TATAAAAATTAGCTGGGCGGGGG - Intronic
1168535046 19:57162043-57162065 TAGAAAAATTAGCTGGGTGTGGG - Intronic
1168690791 19:58376071-58376093 TACAAAAATTAGCTGGGCGTGGG - Intronic
925180420 2:1813729-1813751 TAGAAAAATTAGCTTCCGGCCGG + Intronic
925406623 2:3609823-3609845 CAAAAAAATTAGCAGGGGTTGGG - Intronic
925603975 2:5639511-5639533 TACAAAAATTAGCTGGGTGTGGG + Intergenic
925667758 2:6279267-6279289 TACAAAAATTAGCTGGGCGTTGG - Intergenic
926058466 2:9790447-9790469 CACAAAAATTAGCTGGGGTGTGG - Intergenic
926169686 2:10544757-10544779 CACAAAAATTAGCCGGGCGTGGG + Intergenic
926246518 2:11125669-11125691 TACAAAAATTAGCTGGGTGTGGG - Intergenic
926271139 2:11366939-11366961 TACAAAAATTAGCTGGGGCGTGG + Intergenic
926460119 2:13118627-13118649 CAAAAAAATTAGCCGGGCGTGGG + Intergenic
926678391 2:15645752-15645774 ACAAAAAATTAGCTGGGGGTGGG + Intergenic
927170936 2:20368772-20368794 TACAAAAATTAGCTGGGTGGTGG + Intergenic
927540929 2:23910711-23910733 TACAAAAATTAGCTGGGCGTGGG + Intronic
927541269 2:23913483-23913505 TACAAAAATTAGCTGGGCGTGGG + Intronic
927552882 2:24014306-24014328 CACAAAAATTAGCTGTAGACTGG - Intronic
927674534 2:25095539-25095561 TACAAAAATTAGCTGGGTGTGGG + Intronic
927782289 2:25949432-25949454 AAAAAAAATTAGCTGGGAGGAGG + Intronic
927789630 2:26000229-26000251 TACAAAAATTAGCTGGGCGTGGG + Intergenic
927891906 2:26756289-26756311 TACAAAAATTAGCTGGTGGCGGG + Intergenic
928010745 2:27605296-27605318 TACAAAAATTAGCTGGGTGTGGG + Intronic
928157975 2:28894275-28894297 TAAAAAAATTAGCCGTGGGCTGG - Intergenic
928193419 2:29194666-29194688 CACAAAAATTAGCGGGGGTGGGG - Intronic
928538716 2:32264276-32264298 TACAAAAATTAGCTGGGGCGCGG + Intronic
928751288 2:34473132-34473154 TACAAAAATTAGCTGGGTGTGGG - Intergenic
928866631 2:35924695-35924717 GAGGAAAATTACATGGGGGCTGG - Intergenic
928969683 2:37014820-37014842 TACAAAAATTAGCTGGGCGTGGG + Intronic
929270571 2:39966753-39966775 CACAAAAATTAGCGGGGAGGGGG + Intergenic
929552267 2:42902076-42902098 TAAAAAAATCAGCTGGGTGCGGG + Intergenic
929594267 2:43166303-43166325 AAAAAAAATTAGCTGGGTGTAGG + Intergenic
929611914 2:43277055-43277077 CAGGGAAATCAGCTGGGGGCTGG - Intronic
929728932 2:44465441-44465463 TACAAAAATTAGCTGGGTGGTGG + Intronic
930053859 2:47237240-47237262 CTCAAAAATGAGCTGGGGCCGGG + Intergenic
930063071 2:47306907-47306929 TTTAAAAATTAGCTGGGCGCAGG + Intergenic
930132406 2:47865953-47865975 TAAAAACATTAGCTGGGGTCAGG + Intronic
930494742 2:52126877-52126899 CAGGAAAATTTGCTGAGGTCTGG + Intergenic
930509245 2:52324278-52324300 TTAAAAAATTAGCTGGGGCCAGG - Intergenic
930628079 2:53720962-53720984 CAAAAAAATTAGCTGGCCACAGG + Intronic
930662902 2:54072857-54072879 TAAAAAAGGTAGCTGGGGGCTGG - Intronic
930670890 2:54149094-54149116 CACAAAAATTAGCTGGGCATGGG + Intronic
930781547 2:55228994-55229016 TATAAAAATTAGCTGGGCGCAGG + Intronic
930828187 2:55715558-55715580 TACAAAAATTAGCTGGGCGTGGG + Intergenic
931160110 2:59680199-59680221 TACAAAAATTAGCTGGGTGTGGG - Intergenic
931336058 2:61345116-61345138 TACAAAAATTAGCTGGGGCATGG + Intronic
931409122 2:62012094-62012116 CAAAAAAATTAGCTGGGGCTGGG + Intronic
931469784 2:62527116-62527138 CAGAAATATGAGCTCGTGGCTGG - Intergenic
931556802 2:63514915-63514937 AAGAAAAATTAGCCAGGGCCAGG + Intronic
931559036 2:63536918-63536940 CAAAAAAATTGGCTGGGTGTGGG - Intronic
932041714 2:68306144-68306166 AAAAAAAATTAGCTGGGTGTGGG + Intronic
932252031 2:70252894-70252916 TACAAAAATTAGCTGGGCGTGGG - Intergenic
932282903 2:70509985-70510007 GAGAAACATTAGCTGGAGGCAGG - Intronic
932294115 2:70609986-70610008 TACAAAAATTAGCTGGGCGTGGG + Intronic
932373863 2:71217287-71217309 TAGAAAAATTAGCTGGGCCGTGG - Intronic
932602497 2:73137924-73137946 CAAAAAAATTAGCCGGGTGTGGG - Intronic
932606282 2:73167846-73167868 TTAAAAAATTAGCTGGGGCCAGG - Intergenic
932785419 2:74597477-74597499 CAGAAAAAAGGGCTGGGGGTGGG - Intronic
933164978 2:79065793-79065815 CAGAGAAAGTGGCTGGGTGCGGG - Intergenic
933569182 2:83988950-83988972 TACAAAAATTAGCTGGGTGTGGG + Intergenic
933573791 2:84043991-84044013 TACAAAAATTAGCTGGGTGTGGG - Intergenic
933635843 2:84708288-84708310 TACAAAAATTAGCTGGGCGTAGG + Intronic
933718847 2:85383676-85383698 CAGAACAATTTGCTGAGGTCTGG - Intronic
933874498 2:86605147-86605169 CAGAGAAGAAAGCTGGGGGCTGG + Exonic
933926147 2:87092596-87092618 TTAAAAAATTAGCTGGGGCCAGG + Intergenic
934668282 2:96189406-96189428 CATAAATCTTAGCTGGGGGCTGG + Intronic
935040029 2:99417293-99417315 AAAAAAAATTAGCTGGGGGTAGG - Intronic
935119593 2:100172151-100172173 TACAAAAATTAGCCGGGCGCAGG - Intergenic
935179181 2:100675081-100675103 GAGAGAGAATAGCTGGGGGCCGG - Intergenic
935558375 2:104535555-104535577 AAAAAAAATTAGCTGGGCGTGGG + Intergenic
935903130 2:107814099-107814121 AAAAAAAATTAGCTGGGGTGTGG - Intergenic
936369663 2:111893052-111893074 TAGAAAAATGAGCTAGGGCCAGG - Intergenic
936434483 2:112492428-112492450 TACAAAAATTAGCTGGGTGTGGG + Intronic
936592376 2:113816477-113816499 CAGATAAAATAACTGGAGGCTGG + Intergenic
936704840 2:115059714-115059736 AAGAAAAATAAGCTGATGGCGGG + Intronic
937557434 2:123175348-123175370 TACAAAAATTAGCTGGGTGTTGG + Intergenic
937814278 2:126233849-126233871 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
937948154 2:127360901-127360923 GAGAAAAATTAGGTGGCTGCAGG + Intronic
938013593 2:127848814-127848836 TATAAAAATTAGCTGGGTGAGGG - Intronic
938054227 2:128201709-128201731 AAAAAAAATTAGCTGGGCGTGGG + Intergenic
938271313 2:129974673-129974695 CAAAAAAATTAGCCGGGCGAGGG + Intergenic
938458054 2:131479683-131479705 TACAAAAATTAGCTGGGTGTGGG + Intronic
938650500 2:133377911-133377933 CAGTCTAATTGGCTGGGGGCAGG + Intronic
938762629 2:134439540-134439562 TACAAAAATTAGCTGGGTGTGGG + Intronic
938882498 2:135605837-135605859 TAGAAAAATTAGCCGGGTGTGGG - Intronic
938897548 2:135767204-135767226 TACAAAAATTAGCTGGGCGTGGG + Intronic
939556932 2:143686249-143686271 TACAAAAATTAGCTGGGTGGAGG + Intronic
939674582 2:145056168-145056190 CACAAAAATTAGCTGGGCTTGGG + Intergenic
939898756 2:147826056-147826078 CAGAAAAGCTAGCTGGGGTTTGG - Intergenic
940473864 2:154134835-154134857 TACAAAAATTAGCTGGTGACGGG + Intronic
940663528 2:156577183-156577205 CAGAAAAATCAACTGATGGCTGG + Intronic
940898917 2:159108486-159108508 CAGAGAAAATAGATGAGGGCAGG + Intronic
942026400 2:171914820-171914842 TAAAAAAATTAGCTGGGGCCAGG + Intronic
942084302 2:172429212-172429234 CACAGAAATTAGCTGGGGGTGGG + Intronic
942086747 2:172450998-172451020 CACAAAAATTAGCTGGACGTGGG + Intronic
942325176 2:174770205-174770227 CAAAGAAATTAGGTGGGAGCTGG + Intergenic
942344431 2:174987588-174987610 TACAAAAATTAGCTGGTGGCGGG - Intronic
942475316 2:176313546-176313568 CACAAAAATTAGCTGGGTGGTGG - Intronic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
943328995 2:186536476-186536498 CAGAAAAATGAGATGGTGACTGG + Intergenic
943814504 2:192235618-192235640 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
944078632 2:195759694-195759716 TAAAAAAATTAGCTGGGTGTTGG + Intronic
944554383 2:200873342-200873364 CACAAAAATTAGCTGGGCATGGG - Intronic
944584802 2:201164108-201164130 TACAAAAATTAGCTGGGTGTGGG + Exonic
944792860 2:203151174-203151196 TACAAAAATTAGCTGGGCGTAGG + Intronic
944850790 2:203716999-203717021 TACAAAAATTAGCTGGGTGTGGG - Intronic
944865829 2:203860705-203860727 TAGAAAAATTAGCTGGGCGTGGG - Intergenic
945100532 2:206258656-206258678 TAAAAAAATTAGCTGGGGAATGG + Intergenic
945892554 2:215445011-215445033 TACAAAAATTAGCTGGGCGTTGG - Intergenic
946132810 2:217620689-217620711 CAGAAAAAATGACTGGGGGGGGG - Intronic
946218750 2:218207901-218207923 CAAAAAAATTAGCTGGGGTGTGG + Intergenic
946233656 2:218308739-218308761 TACAAAAATTAGCTGAGGGGTGG - Intronic
946265265 2:218535554-218535576 TACAAAAATTAGCTGGGAGTGGG + Intronic
946305122 2:218852254-218852276 TACAAAAATTAGCTGGGTGTTGG - Intergenic
946383849 2:219369437-219369459 AAAAAAAATTAGCTGGGTGTGGG + Intergenic
946718482 2:222578682-222578704 CAAAAAAATTAGCTGGGGCCGGG + Intronic
946794614 2:223336665-223336687 CAAAAAAATTAGCAGGGGCATGG + Intergenic
946837686 2:223788456-223788478 TACAAAAATTAGCTGGGGCTGGG + Intronic
946912279 2:224476170-224476192 TACAAAAATTAGCTGGTGGTGGG - Intronic
947377580 2:229512226-229512248 CACAAAAATTAGCTGGGTGTGGG + Intronic
947495697 2:230634821-230634843 TACAAAAATTAGCTGGGGGATGG + Intergenic
947566968 2:231200516-231200538 TACAAAAATTAGCTGGGCGTTGG + Intronic
947634165 2:231671776-231671798 CAGAAAAATTACATGCTGGCTGG - Intergenic
947725146 2:232393537-232393559 CAAAACAATTAGCCGGGGGTGGG - Intergenic
947759734 2:232595105-232595127 TACAAAAATTAGCTGGGTGTAGG + Intergenic
947802966 2:232943262-232943284 CAGAAAACTCAGCTGGTGACAGG - Intronic
948394355 2:237633365-237633387 CAGAAAACTCAGCTGTGGACAGG + Intronic
948490692 2:238310723-238310745 AATAAAAATTAGCTGATGGCCGG + Intergenic
948507857 2:238442264-238442286 CACAAAAATTAGCCGGGTGTGGG - Intronic
948522969 2:238552934-238552956 AAAAAAAATTAGCTGGGTGTAGG + Intergenic
948959645 2:241323160-241323182 AAAAAAAATTAGATGGTGGCTGG - Intronic
1168748028 20:261367-261389 TACAAAAATTAGCCGGGGTCGGG - Intergenic
1168828181 20:828206-828228 CAGAAAAATTAGCTGCGCATGGG + Intergenic
1169078573 20:2779114-2779136 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1169121272 20:3097434-3097456 AAAAAAAATTAGCTGGTGGCCGG - Intergenic
1169121320 20:3097747-3097769 TTTAAAAATTAGCTGGTGGCAGG - Intergenic
1169183068 20:3588000-3588022 TATAAAAATTAGCTGGGTGTTGG - Intronic
1169185298 20:3610890-3610912 GTCAAAAATCAGCTGGGGGCTGG - Intronic
1169323490 20:4655315-4655337 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1169373787 20:5049512-5049534 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1169737861 20:8856459-8856481 TACAAAAATTAGCTGGGCGTGGG + Intronic
1169814840 20:9645738-9645760 CAGAAAAATTAGCTTGGGCATGG - Intronic
1170022778 20:11854391-11854413 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1170244653 20:14207250-14207272 CACAAAAATTAGCTGGGCGTAGG - Intronic
1170408579 20:16065063-16065085 CATATAAATGTGCTGGGGGCAGG + Intergenic
1170583852 20:17719277-17719299 GAAAAAAATTAGCTGGGCGTGGG - Intronic
1170862558 20:20121647-20121669 TACAAAAATTAGCTGGGCACAGG - Intronic
1170936385 20:20813602-20813624 CAGAAAAATTATATGCTGGCTGG - Intergenic
1171470083 20:25363371-25363393 TACAAAAATTAGCTGGGCGTGGG - Intronic
1171504912 20:25625117-25625139 TACAAAAATTAGCCGGGGGGTGG - Intergenic
1171559306 20:26108467-26108489 CCAAAAAATTAGCTGGGGCCGGG + Intergenic
1172000630 20:31773444-31773466 TACAAAAATTAGCCGGGGCCAGG - Intronic
1172026548 20:31952676-31952698 AAAAAAAATTAGCTGGGTGAGGG + Intergenic
1172030193 20:31976537-31976559 TACAAAAATTAGCTGGGTGTGGG - Intronic
1172069327 20:32244928-32244950 ACGAAACATTAGCTGGGGCCAGG + Intergenic
1172197328 20:33100858-33100880 TAGAAAAATTAGCTGGGCATAGG + Intronic
1172290327 20:33771398-33771420 TACAAAAATTAGCTGGGCGTGGG - Intronic
1172377983 20:34461552-34461574 TACAAAAATTAGCTGGGCGTGGG + Intronic
1172402677 20:34663319-34663341 AACAAAAATTAGCTGGGGCATGG + Intronic
1172451611 20:35029095-35029117 CACAAAAATGAGCTGGGCGTGGG + Intronic
1172576371 20:36012001-36012023 TACAAAAATTAGCTGGGGCCAGG + Intronic
1172663237 20:36581781-36581803 TACAAAAATTAGCTGGGCGTAGG - Intronic
1172722118 20:37007092-37007114 CAAAAAAATTAGCTAGGCGTGGG + Intronic
1172849298 20:37949202-37949224 GAGAAACATGAGCTGGGGGAGGG + Intergenic
1172925822 20:38533982-38534004 TACAAAAATTAGCTGGGGGTGGG + Intronic
1172955892 20:38758490-38758512 TAGAAAAATTAGCCGGGCGTCGG + Intronic
1173239169 20:41278186-41278208 TACAAAAATTAGCTGGGTGTTGG + Intronic
1173241634 20:41302224-41302246 CAGAGAAATGAGCTAGGGCCTGG - Intronic
1173411449 20:42813983-42814005 AAGAAAAAATGGCTTGGGGCCGG - Intronic
1173538124 20:43831296-43831318 TAAAAAAATTAGCTGGGTGTGGG + Intergenic
1173882088 20:46423112-46423134 CAAGAAAATTAGCTGGGGGAAGG - Intronic
1174147109 20:48459662-48459684 AAGAAAAATCACCTGGGGGCCGG - Intergenic
1174252814 20:49232180-49232202 TACAAAAATGAGCTGGGGCCGGG - Intronic
1174325666 20:49776800-49776822 TACAAAAATTAGCTGGGTGTAGG - Intergenic
1174331240 20:49820333-49820355 CAAAAAAATTAGCTGGGTGTGGG + Intronic
1174446396 20:50593972-50593994 CAGAAAAATGCTCTGGCGGCCGG + Intronic
1174470686 20:50758273-50758295 TAGAAAAATTAGCTGGGTTGTGG + Intergenic
1174518797 20:51113943-51113965 TAAAAAAATTAGCCAGGGGCTGG - Intergenic
1174613458 20:51817904-51817926 TATAAAAATTAGCTGGGTGTGGG - Intergenic
1174674156 20:52337236-52337258 CAAAAAAATTAGCCGGGTGGTGG + Intergenic
1174838610 20:53880791-53880813 TACAAAAATTAGCTGGGGCATGG + Intergenic
1175099435 20:56568025-56568047 TACAAAAATTAGCTGGGTGAGGG - Intergenic
1175129820 20:56780783-56780805 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1175148708 20:56916106-56916128 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1175406160 20:58730754-58730776 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1175668765 20:60882957-60882979 CATGAGAAATAGCTGGGGGCAGG - Intergenic
1175841367 20:62029749-62029771 TACAAAAATTAGCTGGGCGTGGG + Intronic
1176188989 20:63798372-63798394 TACAAAAATTAGCTGGGCGTTGG + Intronic
1176651646 21:9553616-9553638 ACAAAAAATTAGCTGGGGCCGGG - Intergenic
1176907891 21:14526018-14526040 CAAAAAAATTAGCTGGGCGTGGG - Intronic
1177163423 21:17573752-17573774 TACAAAAATTAGCTGGGTGGTGG + Intronic
1177608769 21:23418789-23418811 CAAAAAATTTAGCTGGGTGTGGG + Intergenic
1178304585 21:31480906-31480928 CAAAAAAATTAGTTGGGCGTGGG - Intronic
1178419127 21:32429506-32429528 TACAAAAATTAGCTGGGTGTAGG - Intronic
1178456073 21:32752789-32752811 TACAAAAATTAGCTGGTGGCGGG - Intronic
1178565425 21:33679850-33679872 CAAAAAAATTAGCTGGATGTGGG - Intronic
1178618891 21:34157350-34157372 AACAAAAATTAGCTGGGTGTAGG - Intergenic
1178629015 21:34243249-34243271 CAGTGAAATGAGCTGGGGGTGGG + Intergenic
1178731546 21:35107428-35107450 CAGAAAAATTATGATGGGGCTGG - Intronic
1179084187 21:38203088-38203110 AAGAACCATTAGGTGGGGGCAGG + Intronic
1179333134 21:40424941-40424963 CAAAAAAATTAGCTGGGCATGGG + Intronic
1179589019 21:42393087-42393109 TACAAAAATTAGCTGGGTGTGGG + Intronic
1179630847 21:42677795-42677817 TACAAAAATTAGCTGGGCGTGGG - Intronic
1179892472 21:44343543-44343565 CAAAAAAATTAGCTGGGCATGGG + Intergenic
1180616198 22:17129525-17129547 CAATAAAATTAGCTGGGGTGTGG + Intronic
1180627279 22:17202419-17202441 TACAAAAATTAGCTGTTGGCCGG - Intronic
1180781120 22:18520316-18520338 TACAAAAATTAGCTGGGTGGTGG + Intergenic
1180800079 22:18627626-18627648 TACAAAAATTAGCTGGGCGTGGG + Intergenic
1180845168 22:18976804-18976826 CAAAAAAATTAGCTTGGTGGTGG - Intergenic
1180925397 22:19550272-19550294 TATAAAAATTAGCTGGGGCCAGG - Intergenic
1181010557 22:20037932-20037954 CAAAAAAATTAGCTGGGCATGGG + Intronic
1181238007 22:21459657-21459679 TACAAAAATTAGCTGGGTGGTGG + Intergenic
1181480996 22:23198965-23198987 CACAAAAATTAGCTGGACGTGGG + Intronic
1181618991 22:24074963-24074985 CAGAAAGATTACATGGGGCCAGG + Intronic
1181753016 22:25002933-25002955 TACAAAAATTAGCTGGGCACTGG - Intronic
1181825150 22:25508991-25509013 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1182144278 22:27987575-27987597 TACAAAAATTAGCTGGGCGTGGG + Intronic
1182242479 22:28926965-28926987 TACAAAAATTAGCTGGGTGTGGG + Intronic
1182510563 22:30817029-30817051 CAGAAAATTGAAATGGGGGCTGG - Intronic
1182524081 22:30904981-30905003 CAATAAAATTAGCTGGGTGTGGG + Intronic
1182592910 22:31396180-31396202 AAAAAAAATTAGCTGGGTACAGG - Intergenic
1182619758 22:31612564-31612586 CAGAAAAATTAGCTGGGTGTAGG + Intronic
1182631693 22:31690934-31690956 AAAAAAAATTAGCTGGAGGCCGG - Intronic
1182658667 22:31909600-31909622 ATAAAAAATTAGCTTGGGGCCGG + Intergenic
1182781627 22:32873103-32873125 TACAAAAATTAGCCGGGTGCAGG - Intronic
1182859322 22:33545737-33545759 TATAAAAATTAGCTGGGTGTTGG - Intronic
1182980493 22:34666132-34666154 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1183066220 22:35364926-35364948 TACAAAAATTAGCTGGGTACGGG - Intergenic
1183108651 22:35632205-35632227 TATAAAAATTAGTTGGGGGTGGG + Intronic
1183151521 22:36041544-36041566 CCAAAAAATTAGCTGAGGCCGGG + Intergenic
1183445771 22:37853476-37853498 TACAAAAATTAGCTGGGGCATGG + Intronic
1183459076 22:37938906-37938928 CAAAAAAATTAGCCAGGGCCGGG - Intronic
1183468487 22:37992693-37992715 TATAAAAATTAGCCGGGGGGCGG - Intronic
1183691387 22:39390755-39390777 TACAAAAATTAGCTGGGTGGTGG + Intergenic
1183710050 22:39498019-39498041 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1183835330 22:40448014-40448036 CAAAAAAATTAGCTGGGGCTGGG + Intronic
1183858765 22:40653852-40653874 TATAAAAATTAGCTGGGGCATGG + Intergenic
1183934088 22:41252175-41252197 TACAAAAATTAGCTGGGCGCGGG + Intronic
1184007968 22:41724628-41724650 AAAAAAAATTAGCTGGGCGTGGG + Intronic
1184081040 22:42220483-42220505 TGAAAAAATTAGCTGGGGCCAGG - Intronic
1184216769 22:43072775-43072797 CAAAAAAATTAGCTGGGTGGTGG - Intronic
1184359845 22:44008832-44008854 AAAAAAAATTAGCTGGGTGTGGG + Intronic
1184643717 22:45885292-45885314 CAGACAAATTCGCTGAGGGGAGG - Intergenic
1184672507 22:46022503-46022525 TAAAAAAATTAGCTGGGTGGTGG + Intergenic
1184711596 22:46253566-46253588 TAGAAAAATTAGCTGGGCGTTGG + Intergenic
1184796130 22:46733885-46733907 TACAAAAATTAGCTGGTGGCAGG + Intronic
1185251806 22:49806039-49806061 CATAAAAATTAGCTGGGTGTGGG - Intronic
1185273593 22:49939917-49939939 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1185381767 22:50511940-50511962 TACAAAAATTAGCTGGGGCCAGG - Intronic
949153068 3:793815-793837 CAAAAAAATTAGCTGGGTTCGGG + Intergenic
949359283 3:3214692-3214714 CAGAAAAATTGTTGGGGGGCAGG + Intergenic
949502323 3:4692822-4692844 CATAAAAATAAGATGGAGGCAGG + Intronic
949525654 3:4900728-4900750 CCAAAAAATCAGCTGGGGCCTGG + Intergenic
949539866 3:5023995-5024017 AAAAAAAATTAGCTGGGTGTCGG - Intergenic
950272294 3:11627423-11627445 AAGAAAAATTAGCTGGGCGTGGG + Intronic
950389726 3:12687066-12687088 TACAAAAATTAGCTGGGGCATGG + Intergenic
950400480 3:12766010-12766032 CCAAAAAATTAGCCGGGCGCAGG - Intronic
950471893 3:13191463-13191485 AAAAAAAATTAGCTGGGTGTGGG - Intergenic
950814959 3:15691277-15691299 TACAAAAATTAGCTGGGGCATGG - Intronic
951073472 3:18361034-18361056 AAGATGAATTAGCAGGGGGCTGG + Intronic
951183806 3:19688839-19688861 AAGAAACATTGGGTGGGGGCAGG - Intergenic
951212778 3:19993885-19993907 TACAAAAATTAGCCGGGGGTGGG - Intronic
951725874 3:25758422-25758444 AAGAAAAATTAGCTGGGCTTGGG + Intronic
952283135 3:31942385-31942407 TACAAAAATTAGCTGGGTGGCGG + Intronic
952510134 3:34044626-34044648 CAGAAAAATTCTCTCGGGGGAGG - Intergenic
952781347 3:37102651-37102673 AAAAAAAATTAGCTGGGTGTGGG - Intronic
952793626 3:37219810-37219832 TAAAAAAATTAGCTGGGTGTGGG - Intergenic
953318490 3:41950541-41950563 TACAAAAATTAGCTGGGAGTGGG - Intronic
953630701 3:44614305-44614327 AAAAAAAATTAGCTGGGCGTGGG - Intronic
953828583 3:46276186-46276208 AACAAAAATTAGCTGGGTGTGGG + Intergenic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
953976990 3:47389457-47389479 AATAAAAATTAGCTGGGGCCAGG + Intronic
954062427 3:48079497-48079519 TACAAAAATTAGCTGGGGCCTGG + Intronic
954203497 3:49039905-49039927 CAAAAAAATTAGCTGGGCGTGGG + Intronic
954382799 3:50228397-50228419 CAAAAAAATTAGCTGGGCGTGGG + Intronic
954629906 3:52042179-52042201 TACAAAAATTAGCTGGGCGTGGG + Intergenic
954643616 3:52117196-52117218 AAAAAAAATTAGCTGGGTGTGGG + Intronic
954786500 3:53096897-53096919 TACAAAAATTAGCTGGGCGTAGG - Intronic
954835214 3:53460868-53460890 TACAAAAATTAGCTGGGTGTGGG - Intergenic
955185712 3:56712866-56712888 CATAAAAATTAGCTAGGCGTGGG + Intergenic
955278491 3:57570963-57570985 CAAAAAAATCAGGTGGGGGGTGG - Intergenic
955339002 3:58110414-58110436 AAAAAAAATTAGCTGGGTGGTGG - Intronic
955402120 3:58599827-58599849 GCAAAAAATTAGCTGGGTGCAGG - Intronic
955403030 3:58607119-58607141 CAGAAAACTTACCAGGAGGCTGG - Intronic
955710576 3:61775006-61775028 CAAAAAAATTAACTGGGGTTGGG - Intronic
956254365 3:67267886-67267908 TACAAAAATTAGCTGGGTGGTGG - Intergenic
956774207 3:72551443-72551465 TTAAAAAATTAGCTGGAGGCTGG + Intergenic
956777465 3:72577440-72577462 TAGAAAAATTAGTTGGGTGTGGG - Intergenic
957307668 3:78479284-78479306 AAGAAAAATAAGGTGGAGGCAGG - Intergenic
957627926 3:82678796-82678818 CATAAAACATAGCTGGGGCCAGG - Intergenic
957713004 3:83888590-83888612 TACGAAAATTAGCTGGGGGGTGG - Intergenic
957890823 3:86355076-86355098 TACAAAAATTAGCTGGGCGTGGG + Intergenic
959375727 3:105586785-105586807 CAAAAAAATTAGCCCGGTGCGGG - Intergenic
959699069 3:109281337-109281359 TAGAAAAATTAACTGGGTGGTGG - Intergenic
959701025 3:109299214-109299236 AAAAAAAATTGACTGGGGGCTGG + Intronic
959706976 3:109347478-109347500 CACAAAAATTAGCCGGGCGTGGG + Intergenic
959983675 3:112548195-112548217 TACAAAAATTAGCTGGGCGTGGG + Intronic
960087400 3:113605849-113605871 CAAAAAAATTAGCTGAGTGGTGG + Intronic
960091238 3:113640984-113641006 TACAAAAATTAGCTGGGGGGTGG - Intergenic
960103659 3:113770938-113770960 CAAAAAAATTAGCTGGGTGTGGG + Intronic
960263876 3:115598240-115598262 AAGAAAAAAGAGCTGGGGGTGGG + Intergenic
960307369 3:116078478-116078500 CAAAAAACTTAGCTGGGTGTTGG - Intronic
960468751 3:118032957-118032979 AAAAAAAATTAGCAGGGGGGTGG - Intergenic
960803696 3:121562986-121563008 TATAAAAATTAGCTAGGCGCAGG - Intergenic
960911618 3:122654854-122654876 CAAAAAAATTAGCTGGGGCATGG + Intergenic
960930817 3:122847497-122847519 CAAAAAAATTAGCCGGGTGTGGG - Intronic
961029466 3:123589248-123589270 TACAAAAATTAGCTGGGCGTGGG - Intergenic
961326322 3:126111514-126111536 CAGAAACATGAGCTGAGGGCAGG + Intronic
961338384 3:126199762-126199784 TACAAAAATTAGCTGGGGGCGGG + Intergenic
961433337 3:126898691-126898713 TACAAAAATTAGCTGGGCGTGGG - Intronic
961585558 3:127919382-127919404 CACAAAAATTAGCTGGGCATGGG - Intronic
961719762 3:128885544-128885566 CAAAAAAATTAGCTGGGCATGGG - Intronic
962140062 3:132780889-132780911 AAGAAAACCTAGCTGGGGACTGG - Intergenic
962182721 3:133225340-133225362 CACAAAAATTAATTAGGGGCTGG - Intronic
962296174 3:134189616-134189638 CAAAAAAATTAGCCGGGCGTGGG + Intronic
963146200 3:141997693-141997715 TACAAAAATTAGCTGGGCGTGGG + Intronic
963186174 3:142419652-142419674 TACAAAAATTAGCTGGGTGGTGG + Intronic
963597609 3:147347513-147347535 AAAAAAAATTAGCTGGGTGTGGG + Intergenic
963637409 3:147816332-147816354 TACAAAAATTAGCTGGGCGTGGG - Intergenic
963648576 3:147947608-147947630 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
964060235 3:152513125-152513147 CAAAAAAATTAGCTGGGCGTGGG + Intergenic
964196479 3:154070709-154070731 GAAAAAAATTAGGTGGGGGGAGG + Intergenic
964311412 3:155397253-155397275 CAAAAAAATTAGCTGGGCGTGGG + Intronic
964360261 3:155888574-155888596 AAAAAAAATTAGCTGGGAGTGGG - Intronic
964725069 3:159805962-159805984 TACAAAAATTAGCTGGGTGTGGG - Intronic
964757075 3:160098044-160098066 AAAAAAAATTAGCTGGGGTGTGG + Intergenic
964863707 3:161230532-161230554 AAGAATAATTGGCTGGGGGGTGG + Intronic
964875731 3:161366483-161366505 GAGAGAAATTAACTGGGAGCTGG + Intronic
965063283 3:163808664-163808686 TAAAAAAATTAGCTGGGGTGTGG + Intergenic
965397927 3:168182928-168182950 TACAAAAATTAGCTGGGCGTGGG + Intergenic
965817276 3:172650346-172650368 TATAAAAATTAGCTGGGACCGGG + Intronic
965968605 3:174526829-174526851 TACAAAAATTAGCTGGGTGTGGG - Intronic
966185246 3:177221230-177221252 AACAAAAATTAGCTGGGTGTGGG + Intergenic
966366338 3:179191790-179191812 TACAAAAATTAGCTGGGCCCTGG - Intronic
966384187 3:179377909-179377931 AAAAAAAATTAGCCGGTGGCAGG + Intronic
966705091 3:182904731-182904753 TACAAAAATTAGCTGGGGTGTGG + Intronic
967053302 3:185804835-185804857 AAAAAAAATTAGCTGGGAGTGGG + Intronic
967053437 3:185805927-185805949 TACAAAAATTAGCTGGGGGTGGG - Intronic
967240186 3:187431006-187431028 CACAAAAATGGGCTCGGGGCAGG + Intergenic
967253195 3:187564064-187564086 CACAAAAATTAGCTGGGCATGGG + Intergenic
967336114 3:188346412-188346434 AAAAAAAATTAGCTGGGCGTGGG - Intronic
967384322 3:188896341-188896363 TACAAAAATTAGCTGGGCGTGGG - Intergenic
967457322 3:189703277-189703299 TAGAAAAATTAGCTGGTCGTGGG + Intronic
967935400 3:194723626-194723648 TACAAAAATTAGCTGGTGGTGGG + Intergenic
968122282 3:196134199-196134221 TATAAAAATTAGCTGGGCGTGGG - Intergenic
968211164 3:196850057-196850079 TACAAAAATTAGCTGGGTGGTGG - Intergenic
968262851 3:197339170-197339192 TACAAAAATTAGCTGGGTGTGGG - Intergenic
968499302 4:939559-939581 TACAAAAATTAGCTGGGCGTGGG + Intronic
969270257 4:6094839-6094861 CAAAAAAATTAGCTGGGCATAGG + Intronic
969372888 4:6745421-6745443 CACAAAAATTAGCTGGGCCATGG + Intergenic
969861837 4:10042143-10042165 CAAAAAAATTAGCTGGGTGGTGG + Intronic
970252773 4:14134005-14134027 CACAAAAATTAGCTGGGTGTGGG - Intergenic
970261698 4:14231502-14231524 CACAAAAATTAGCTGGGTGTGGG - Intergenic
970578188 4:17448150-17448172 AAAAAAAATTAGCTGGGTGGTGG - Intergenic
970682981 4:18532910-18532932 TACAAAAATTAGCTGGGCGTCGG - Intergenic
970774346 4:19655284-19655306 TACAAAAATTAGCTGGGGCGTGG - Intergenic
971085294 4:23267869-23267891 TACAAAAATTAGCTGGGTGTTGG - Intergenic
971688971 4:29808778-29808800 AAAAAAAATTAGCTGGGCGGTGG - Intergenic
972470135 4:39396124-39396146 TACAAAAATTACCTGGAGGCCGG - Intergenic
972476532 4:39455533-39455555 CTTAAAAATTAGCTGGGGCCAGG + Intronic
972501525 4:39682518-39682540 TAGAAAAATTAGCTGGGCATGGG - Intergenic
972520432 4:39850114-39850136 TACAAAAATTAGCTGGGTGTTGG + Intronic
973066014 4:45794273-45794295 CCTAAAAATTAGCTGGGAGTGGG + Intergenic
973079006 4:45966175-45966197 CAAAAAAATCAGTTGGGGGAGGG - Intergenic
973112852 4:46416397-46416419 TTTAAAAATTAGCTGAGGGCCGG - Intronic
973152908 4:46909993-46910015 TACAAAAATTAGCTGGGCGTGGG + Intergenic
973185475 4:47322814-47322836 TACAAAAATTAGCTGGGTGCTGG + Intronic
973618581 4:52705117-52705139 TACAAAAATTAGCTGGGTGTGGG + Intergenic
973628562 4:52797004-52797026 CAGAAAAATTAGTTTGGGAAGGG + Intergenic
973629906 4:52810741-52810763 AAAAAAAATTAGGTGGGGCCGGG + Intergenic
973742422 4:53931008-53931030 TAGAAAAACTAGCTGGGTGTGGG + Intronic
973747869 4:53982099-53982121 AAAAAAAATTAGCTGGGTGGTGG - Intronic
974164180 4:58179023-58179045 TACAAAAATTAGCTGGGTGTGGG - Intergenic
974171667 4:58274519-58274541 CAGAAAAATAATCTGAGGCCGGG + Intergenic
974291149 4:59932754-59932776 TACAAAAATTAGCTGGGTGTGGG - Intergenic
974296939 4:60012510-60012532 CAAAAAAATTAGCAGGGCGTGGG - Intergenic
974875551 4:67699755-67699777 CAAAAAAATTAGCTGGGCGTAGG - Intronic
975294653 4:72719409-72719431 CAAAAAAATTAGCTGGGCATGGG + Intergenic
975606917 4:76164351-76164373 TACAAAAATTAGCTGGGGCTGGG + Intronic
976241939 4:82967071-82967093 TAGAAAAATTAGCTGGGTGGTGG + Intronic
976249329 4:83034496-83034518 CAAAAAAATTAGCCGGGCGTAGG - Intronic
976296020 4:83473122-83473144 TACAAAAATTAGCTGGGGTGTGG + Intronic
976639344 4:87321182-87321204 TACAAAAATTAGCTGGGTGCGGG - Intronic
976640854 4:87336247-87336269 TACAAAAATTAGCTGGGCGTAGG - Intergenic
976776690 4:88714259-88714281 TACAAAAATTAGCTGGGTGTTGG - Intergenic
976841446 4:89437197-89437219 AATAAAAATTACCTGGGGCCGGG - Intergenic
977035863 4:91952335-91952357 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
977144694 4:93423499-93423521 CAAAAAAATTAGCTGGGCGTGGG - Intronic
977540416 4:98312224-98312246 CAGAATTATTAGCTGGAGACTGG - Intronic
977563867 4:98561921-98561943 CAGGAAGATTAGCTGTGGGCAGG + Intronic
978099179 4:104815934-104815956 ATGAAAAAGTGGCTGGGGGCAGG + Intergenic
978427000 4:108593518-108593540 TACAAAAATTAGCTGGTGGCCGG - Intergenic
978534851 4:109750149-109750171 AACAAAAATTAGCTGGGCGTGGG - Intronic
979695455 4:123608211-123608233 TACAAAAATTAGCTGGGTGTGGG - Intergenic
979783087 4:124680818-124680840 CAGGAGAAATAGCTGGGGGTAGG + Intronic
980045251 4:127980667-127980689 CACAAAAATTCGCTGGGGTGGGG + Intronic
980697380 4:136377230-136377252 TAGAAAAATTACCTGGGTGTGGG - Intergenic
980749508 4:137070508-137070530 CAGAATAGTCAGGTGGGGGCAGG + Intergenic
980767750 4:137330006-137330028 TAAAAAAATTAGCTGGGTGTGGG - Intergenic
980797552 4:137703975-137703997 TAAAAAAATTAGCCGGTGGCGGG - Intergenic
980913014 4:139010481-139010503 CAGATAAATAAACTGGGGGCAGG - Intergenic
981108937 4:140913365-140913387 CAGAAAAGTAGGCTGGGGCCAGG - Intronic
981182540 4:141763122-141763144 TACAAAAATTAGCTGGGTGGTGG + Intergenic
981313116 4:143315834-143315856 CAAAAAAATTAGCCGGGTGTTGG - Intergenic
981431701 4:144668595-144668617 TACAAAAATTAGCTGGGTGTGGG + Intronic
981793780 4:148571245-148571267 TTTAAAAATTAGCTGGGGCCAGG + Intergenic
982261774 4:153500255-153500277 TATAAAAATTAGCTGGGGGTGGG - Intronic
982286307 4:153739264-153739286 TACAAAAATTAGCTGGGTGTTGG + Intronic
982525428 4:156471610-156471632 AAAAAAAATTAGCTGGGTGTAGG - Intergenic
982680596 4:158424439-158424461 TACAAAAATTAGCTGGGTGGTGG - Intronic
983330871 4:166327220-166327242 CAAAAAAATTAGCTAGGCACGGG - Intergenic
983556970 4:169067834-169067856 CAAAAAAATTAGCCGGGGCCGGG + Intergenic
983611459 4:169649927-169649949 TATAAAAATTAGCTGGGGCATGG + Intronic
983665773 4:170180642-170180664 TACAAAAATTAGCCAGGGGCAGG - Intergenic
983778361 4:171637519-171637541 CACAAAAATTAGCTGGAGAGTGG - Intergenic
984010572 4:174366661-174366683 CAGAACAATTTGCTGAGGCCTGG + Intergenic
984350638 4:178587812-178587834 TTTAAAAATTAGCTGGGGGCCGG + Intergenic
984371867 4:178877879-178877901 TACAAAAATTAGCTGGGGTGTGG - Intergenic
984471141 4:180175875-180175897 CAGAAAAATCAGCTGGGAGTGGG + Intergenic
984528712 4:180889195-180889217 TAAAAAACTTAGCTGGGGGATGG + Intergenic
984666782 4:182437494-182437516 CAAAAAAAATAGCTGATGGCTGG + Intronic
985002854 4:185503073-185503095 CAAAAAAATTAGCCGGGCGTGGG + Intronic
985036463 4:185845166-185845188 ATAAAAAATTAGCTGGGGGGTGG - Intronic
985268524 4:188172957-188172979 TTTAAAAATTAGCTGGAGGCTGG + Intergenic
985292761 4:188403764-188403786 TACAAAAATTAGCTGGGCGGTGG - Intergenic
985676473 5:1234039-1234061 AAATAAAATTAGCTGGGTGCTGG - Intronic
985694895 5:1334597-1334619 TACAAAAATTAGCTGGGCGTGGG + Intronic
985709348 5:1419656-1419678 CAGCAAAATCAGCTGTGGCCGGG - Intronic
986036082 5:3941319-3941341 TACAAAAATTAGCTGGGGTGTGG - Intergenic
986841277 5:11700236-11700258 AAGAAAAATTAGCTGGGCTTGGG + Intronic
986928832 5:12794277-12794299 CAGAAAACTTAGATGGGAGGAGG + Intergenic
987029219 5:13960604-13960626 CAGAAAAATTCGCTGGCCTCTGG + Intergenic
987043676 5:14086594-14086616 CACAAATATTGGCTGGGTGCAGG + Intergenic
988055972 5:26097244-26097266 CAGAAAAGTTTGCTGGAGTCTGG - Intergenic
988395593 5:30694004-30694026 CAAAAAAATTAGCCGGGGCGAGG + Intergenic
988457520 5:31399706-31399728 CATAAAAATTATCTGGGTGATGG + Intergenic
988842311 5:35094981-35095003 TACAAAAATTAGCTGGGTGTTGG - Intronic
988939536 5:36128563-36128585 TACAAAAATTAGCTGGGTGGTGG + Intronic
989016625 5:36942583-36942605 TAAAAAAATTAGCTGGGGGGTGG + Intronic
989062443 5:37422775-37422797 AAAAAAATTTAGCTGAGGGCTGG - Intronic
989138276 5:38176714-38176736 TACAAAAATTAGCTGGGTGTGGG + Intergenic
989183911 5:38604550-38604572 TACAAAAATTAGCTGGTGGTGGG + Intronic
989711709 5:44405681-44405703 TACAAAAATTAGCTGGGCGTGGG + Intergenic
989843988 5:46116468-46116490 TAAAAAAATTAGCCGGGTGCTGG - Intergenic
990150706 5:52814299-52814321 TACAAAAATTAGCTGGGTGAGGG - Intronic
990285143 5:54293979-54294001 TACAAAAATTAGCTGGGTGTGGG - Intronic
990388304 5:55290858-55290880 TACAAAAATTAGCTGGGTGTGGG + Intronic
990577310 5:57135831-57135853 TAGAAAAATTCCCTGGGGCCGGG + Intergenic
991276391 5:64852625-64852647 TACAAAAATTAGCTGGGGCATGG - Intronic
991527970 5:67583679-67583701 TACAAAAATTAGCTGGGTGTGGG - Intergenic
991602579 5:68368224-68368246 CAGAAAAATGAGCTGGTTGACGG + Intergenic
991771192 5:70042549-70042571 TACAAAAATTAGCTGGGGCGAGG + Exonic
991850484 5:70917966-70917988 TACAAAAATTAGCTGGGGCGAGG + Exonic
992273636 5:75091774-75091796 TAGCAACAGTAGCTGGGGGCAGG - Intronic
992430085 5:76701986-76702008 TACAAAAATTAGCTGGGCGGTGG - Intronic
992699149 5:79323104-79323126 TATAAAAATTAGCTGGGGCATGG - Exonic
992880708 5:81106526-81106548 CAGAGAAATCAGTTGGAGGCAGG - Intronic
993126044 5:83836819-83836841 TAGAAATATTAGCTTAGGGCAGG - Intergenic
993376398 5:87153909-87153931 TACAAAAATTAGCTGGGTGTGGG - Intergenic
993389723 5:87304620-87304642 CACAAAAATTAGCTGGGTATGGG - Intronic
993602363 5:89943293-89943315 CAGAAAATTTAGCTGCAGACGGG + Intergenic
993702697 5:91136840-91136862 AAGAAAATTAAGCTTGGGGCTGG + Intronic
994737055 5:103568377-103568399 TACAAACATTAGCTGGAGGCTGG + Intergenic
995560389 5:113374834-113374856 TACAAAAATTAGCTGGGGCATGG + Intronic
995910142 5:117176865-117176887 TACAAAAATTAGCTGGGCGTGGG + Intergenic
995955331 5:117769977-117769999 AAGGACCATTAGCTGGGGGCAGG - Intergenic
996064448 5:119066163-119066185 AAAAAAAATTAGCTGGGCGTAGG - Intronic
996347438 5:122502103-122502125 TATAAAAATTAGCTGGGTGGTGG + Intergenic
996373879 5:122782391-122782413 TACAAAAATTAGCTGGGCGTGGG - Intronic
996448260 5:123583986-123584008 CATAAAAATCAACTGGGGCCAGG - Intronic
996619093 5:125478453-125478475 CAGAAAGAGAAGCTGGGGCCAGG - Intergenic
996853101 5:127974820-127974842 TATAAAAATTAGCTGGGGCGTGG - Intergenic
997156908 5:131571236-131571258 AATAAAAAGTAGTTGGGGGCGGG - Intronic
997191733 5:131943952-131943974 TACAAAAATTAGCTGGGTGGTGG + Intronic
997221093 5:132165084-132165106 CAGAATAAGTAGGTGGTGGCGGG - Intergenic
997314263 5:132919040-132919062 CACAAAAATTAGTTGGGCACGGG - Intronic
997384751 5:133463871-133463893 CAGCAAAGTTAGGTGGAGGCTGG + Intronic
997537101 5:134631055-134631077 AAAAAAAATTTGCTGGGTGCAGG - Intronic
997546213 5:134710385-134710407 TACAAAAATTAGCTGGGGTGTGG - Intronic
997555353 5:134793000-134793022 TATAAAAATTAGCTGGGTGTGGG + Intronic
997636088 5:135408147-135408169 AAAAAAAATTAGCTGGGTGGTGG - Intergenic
997961448 5:138324912-138324934 CACAAAAATTAGCTGGGCCGTGG + Intronic
998020424 5:138765334-138765356 TAAGAAAATTAGCTGGGGCCGGG - Intronic
998150506 5:139754539-139754561 CAAAAAAAATAGCTGGGGCGTGG + Intergenic
998488524 5:142525227-142525249 AGGAAAAATTAGCTGGGCGTGGG + Intergenic
998779433 5:145640188-145640210 CAAAAAAATTGGCCGGCGGCCGG + Intronic
999286365 5:150396587-150396609 AAGAAGAAGAAGCTGGGGGCCGG + Exonic
999330348 5:150669799-150669821 TAGAAAAATTAGCTGGGCGTAGG - Intronic
999744553 5:154582215-154582237 CACAAAAATAAGCTGTGGGTAGG + Intergenic
1000222760 5:159229786-159229808 TACAAAAATTAGCTGGGTGGTGG + Intergenic
1000340943 5:160276937-160276959 CACAAAAATTAGCTGGGTGTTGG - Intronic
1000766258 5:165294210-165294232 CAAAAAAATTAGCTGGGCGTTGG + Intergenic
1000778192 5:165445062-165445084 TACAAAAATTAGCTGGGAGCTGG + Intergenic
1001065662 5:168533188-168533210 TACAAAAAATAGCTGGTGGCGGG + Intergenic
1001578425 5:172780762-172780784 CAAAAAAATTAGCTGGGTGTGGG + Intergenic
1002023385 5:176380639-176380661 TACAAAAATTAGCTGGGCGGTGG - Exonic
1002136500 5:177111136-177111158 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1002156872 5:177289163-177289185 TAGAAAAATTAGCTGGGCCGTGG + Intronic
1002508176 5:179695201-179695223 CAAAAAAATTAGCCGGGTGTGGG - Intronic
1002991117 6:2239838-2239860 CAAAAAAATTAGCTGGGCATGGG - Intronic
1003025424 6:2550913-2550935 CAAAAGAATTAGGAGGGGGCAGG + Intergenic
1003065171 6:2898657-2898679 AATAAAAATTAGCTGGGCGTGGG + Intronic
1003262140 6:4527720-4527742 CAGACAAATTACCTGAGGCCAGG + Intergenic
1003298516 6:4855441-4855463 GATAAAAATTAGCTGGGTGGTGG - Intronic
1003362949 6:5446046-5446068 CAAAAAAATTAGCCGGGCGTGGG + Intronic
1003368068 6:5496062-5496084 TAGAAGAATTAGCTGGGGGTGGG - Intronic
1003371051 6:5526769-5526791 CACAAAAATTAACTGGGTGTAGG - Intronic
1003931680 6:10929785-10929807 AAAAAAAATTAGCTGGGTGGTGG + Intronic
1003942096 6:11039722-11039744 GAGAAAAATAAGCTAGGGGAAGG - Intronic
1004086668 6:12456292-12456314 TACAAAAATTAGCTGGGTGTTGG - Intergenic
1004387016 6:15181972-15181994 TACAAAAATTAGCTGGGGATGGG + Intergenic
1004484437 6:16052779-16052801 TAAAAAAATTAGCTGGGTGTGGG + Intergenic
1004710975 6:18170061-18170083 TAAAAAAATTAGCTGGGCGTGGG - Intronic
1004913362 6:20308058-20308080 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1004923182 6:20395671-20395693 TACAAAAATTAGCTGGGCGTTGG + Intergenic
1004941953 6:20568171-20568193 TTTAAAAATTAGCTGGGTGCTGG - Intronic
1005059119 6:21759801-21759823 CAAAAAAATTAGCTGGGTATGGG - Intergenic
1005248853 6:23920708-23920730 CAGAAAGATCAGCTGGGGTCAGG + Intergenic
1005307211 6:24525400-24525422 TAGAAAATTCAGCTGAGGGCCGG + Intronic
1005385700 6:25281958-25281980 TACAAAAATTAGCTGGGCGTGGG + Intronic
1005640217 6:27788654-27788676 TACAAAAATTAGCTGGGCGTGGG + Intergenic
1005767571 6:29028471-29028493 CAGCAGAATTAGCTGGGCGCTGG + Intergenic
1006013803 6:31064727-31064749 TACAAAAATTAGCTGGGCGCTGG + Intergenic
1006022344 6:31124811-31124833 TACAAAAATTAGCCGGGTGCGGG + Intronic
1006537942 6:34715397-34715419 TATAAAAATTAGCTGGGCGTGGG - Intergenic
1006548800 6:34803018-34803040 TACAAAAATTAGCTGGGTGTGGG + Intronic
1006563568 6:34934829-34934851 GAGAAAAATAGGCTGGGGGTGGG - Intronic
1006695530 6:35927443-35927465 TAAAAAAAATACCTGGGGGCCGG - Intergenic
1006890681 6:37425096-37425118 TACAAAAATTAGCTGGGTGGTGG - Intergenic
1006891767 6:37434761-37434783 CACAAAAATTAGCCGGGTGGTGG - Intronic
1006915798 6:37593236-37593258 AAAAGAAATTTGCTGGGGGCGGG + Intergenic
1007211922 6:40199515-40199537 CAAAAAAATTAGCTGGGGCGTGG - Intergenic
1007488091 6:42196371-42196393 TACAAAAATTAGCTGGCTGCTGG - Intergenic
1007552388 6:42740072-42740094 TACAAAAATTAGCTGGGCGTGGG + Intergenic
1007554237 6:42752897-42752919 AAAAAAAGTCAGCTGGGGGCAGG - Intronic
1007639464 6:43326349-43326371 TAGAAAAATTAGCTGGGCATGGG - Intronic
1007643403 6:43362000-43362022 TTGAAAAATTAGCTGGGCGTCGG + Intronic
1008594505 6:53027849-53027871 CACAAAAATTAGCCGGGCGCCGG + Intronic
1008615414 6:53221431-53221453 CACAAAAATTAGCTGGGCATGGG - Intergenic
1008833883 6:55803129-55803151 TACAAAAATTAGCTGGGGTGGGG + Intronic
1009518531 6:64652252-64652274 TAGAGAAATTAACTGGGGGTGGG + Intronic
1009982192 6:70740402-70740424 TAGAAAAATTAGCTGGGCATAGG + Intronic
1010106494 6:72175516-72175538 TACAAAAATTAGCTGGGCGTGGG + Intronic
1010407671 6:75523142-75523164 TACAAAAATTAGCTGGGTGGAGG + Intergenic
1010860032 6:80899347-80899369 CAGAAAACATGGCTGGGGGCGGG + Intergenic
1011440955 6:87386722-87386744 AAGAAAAAAAAGCAGGGGGCGGG + Intronic
1011476932 6:87757465-87757487 TACAAAAATTAGCTGGGGCATGG - Intergenic
1011485853 6:87840799-87840821 AAAAAAAATTAGCTGGGGCATGG - Intergenic
1011610008 6:89141518-89141540 CACAACAATTAGCTGGGTGTTGG - Intergenic
1011690137 6:89859404-89859426 CAAAAATATTAGCTGGGTGTAGG - Intronic
1011690730 6:89865291-89865313 TACAAAAATTAGCTGGGCGTGGG + Intronic
1012238770 6:96848920-96848942 TACAAAAATTAGCTGGGGGCCGG + Intergenic
1012430193 6:99155851-99155873 CAAAAAAATTAGCTGGGCCTGGG + Intergenic
1012445594 6:99304129-99304151 CAAAAAAATTAGCCGGGCGTGGG + Intronic
1012671230 6:102050495-102050517 TACAAAAATTAGCTGGGCGTAGG + Intronic
1012918674 6:105198425-105198447 AAAATAAATTAGCTGGGGGGTGG + Intergenic
1012980375 6:105823272-105823294 TATAAAAATTAGCTGGGCGTGGG - Intergenic
1013000772 6:106020070-106020092 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1013045855 6:106484472-106484494 GAAAAAAATTAGCTGGGTGTGGG - Intergenic
1013084293 6:106842346-106842368 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1013103096 6:107003851-107003873 AAAAAAAATTAACTGGGAGCAGG + Intergenic
1013129011 6:107213602-107213624 TAGAAAAATTAGCCGGGTGGTGG + Intronic
1013240299 6:108239053-108239075 CAAAAAAATTAGCTGGGTGTGGG - Intronic
1013247446 6:108300302-108300324 CAAAAAAATTAGCTGGGCAGTGG - Intronic
1013342536 6:109229428-109229450 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1013416499 6:109930001-109930023 TACAAAAATTAGCTGGGCGTAGG + Intergenic
1013731138 6:113168913-113168935 CATAAAAAAGATCTGGGGGCTGG + Intergenic
1014600195 6:123401790-123401812 TACAAAAATTAGCTGGGTGTGGG + Intronic
1015112487 6:129609207-129609229 CAGAGAAATTTGGTGGGGCCAGG + Intronic
1015120112 6:129692079-129692101 CAGAAAAATGGGCAGGGGCCTGG - Intronic
1015389254 6:132662805-132662827 CACAAAAACTAGCTGGGTGTGGG - Intergenic
1015535766 6:134266137-134266159 TACAAAAATTAGCTGGGCGTGGG - Intronic
1015592081 6:134831925-134831947 CAAAAAATTTAGATTGGGGCTGG + Intergenic
1015612883 6:135044922-135044944 CAGAAAAAATAGCTCCTGGCAGG - Intronic
1015780234 6:136857968-136857990 TACAAAAATTAGCTGGGTGGTGG - Intronic
1015780838 6:136863751-136863773 TAGAAAAATTAGCAGGGGCATGG + Intronic
1015819069 6:137240840-137240862 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1015908969 6:138147554-138147576 AAAAAAAATTAGCTGGGCGTGGG + Intergenic
1016529025 6:145037862-145037884 CACAAAAATTAGCTGAGTGTGGG + Intergenic
1016544715 6:145208031-145208053 TACAAAAATTAGCTGGGCGTGGG + Intergenic
1016894067 6:149035601-149035623 TACAAAAATTAGCTGGGTGTGGG + Intronic
1017008862 6:150048823-150048845 CAAAAAAATTAGCCGGGTGTGGG - Intergenic
1017137675 6:151162399-151162421 CAACAAAATTAGCTGGGCTCAGG + Intergenic
1017145560 6:151231200-151231222 TACAAAAATTAGCTGGGGCTTGG + Intergenic
1017430542 6:154366407-154366429 CAAAAAAATTAGCTGGGCGTGGG - Intronic
1017982211 6:159409593-159409615 TACAAAAATTAGCTGGGTGCGGG + Intergenic
1018162070 6:161054448-161054470 GAGAAAAATTAGTTTGGGCCGGG - Intronic
1018254858 6:161907921-161907943 CACAAAAATTAGCCGGGTGTGGG + Intronic
1018270870 6:162076121-162076143 TACAAAAATTAGCTGGGTGTGGG - Intronic
1018398931 6:163403258-163403280 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1018833000 6:167460395-167460417 AAATAAAATTAGCTGGGTGCGGG - Intergenic
1018926189 6:168208654-168208676 CAGAAAAGTGAGCAGGGGCCGGG + Intergenic
1019554718 7:1623257-1623279 AAAAAAAATTAGCTGGGGGTTGG + Intergenic
1019680104 7:2342945-2342967 CAAAAAAATTAGCCGGTGGTGGG - Intronic
1019760260 7:2806322-2806344 CACAAAAATTAGTTGGGTGTGGG + Intronic
1019816942 7:3208246-3208268 TTTAAAAATTAGCTGGGCGCCGG + Intergenic
1019985732 7:4654240-4654262 AAAAAAAATCAGCTGAGGGCTGG - Intergenic
1020070052 7:5221259-5221281 CAAAAGAATTAGCTGGGTGTGGG - Intronic
1020122225 7:5511280-5511302 CAAAAAAATTAGCCAGGGGCCGG + Intronic
1020489990 7:8769878-8769900 CAGAAAAATAAACTGGGTTCAGG - Intergenic
1020893056 7:13903606-13903628 TACAAAAATTAGCTGGGTGTGGG + Intronic
1020956891 7:14750956-14750978 TACAAAAATTAGCTGGGTGAGGG - Intronic
1021128880 7:16886877-16886899 CACAAAAATTAGCTGGGTATGGG - Intergenic
1021325807 7:19266158-19266180 CAAAAAAATTAGCCGGGCGTGGG + Intergenic
1021384222 7:20008293-20008315 CATAAAAATTAGCTAGATGCAGG - Intergenic
1021821311 7:24500438-24500460 CAAAAAAATTAGCTGGGTGTAGG - Intergenic
1021993614 7:26159161-26159183 CAGCAAGAGCAGCTGGGGGCTGG - Intronic
1022410996 7:30138267-30138289 TAGAAAAATTAGCTGGGCGTGGG - Intronic
1023069751 7:36417829-36417851 TACAAAAATTAGCTGGGTGTGGG - Intronic
1023198688 7:37669567-37669589 CAGTAAAATTAGCTGGATGGTGG + Intergenic
1023821148 7:43981182-43981204 TAAAAAAATTAGCTGGGTGGTGG + Intergenic
1023911304 7:44558779-44558801 TAAAAAAATTAGCCAGGGGCTGG - Intergenic
1023940133 7:44763980-44764002 TACAAAAATTAGCTGGGGCATGG + Intronic
1023944241 7:44791055-44791077 TACAAAAATTAGCTGGGTGGTGG - Intergenic
1023987055 7:45102889-45102911 GAGAACAATTAGCCAGGGGCTGG - Intronic
1024393554 7:48841628-48841650 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1024593954 7:50916778-50916800 CACAAAAATTAGCTGGGTGTGGG - Intergenic
1025062963 7:55826951-55826973 CAGAAAACTTAGGCAGGGGCAGG - Intronic
1025116252 7:56260928-56260950 TAGAAAAATTAGCTGGGTGGTGG + Intergenic
1025132551 7:56384074-56384096 TAGAAAAATTAGCTGGGCGTGGG - Intergenic
1025651365 7:63472630-63472652 CAAAAAAATTAGCTGGGTGGTGG + Intergenic
1025841446 7:65153413-65153435 TACAAAAATTAGCTGGGGCATGG + Intergenic
1025881601 7:65542556-65542578 TACAAAAATTAGCTGGGGCATGG - Intergenic
1025891838 7:65660060-65660082 TACAAAAATTAGCTGGGGCATGG + Intergenic
1025991363 7:66499543-66499565 AAAAAAAATTAGCTGGGTGTGGG - Intergenic
1026330312 7:69346353-69346375 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1026588642 7:71678278-71678300 TACAAAAATTAGCTGGGGCAGGG - Intronic
1026632133 7:72046555-72046577 TACAAAAATTAGCTGGGTGTTGG + Intronic
1026995542 7:74613656-74613678 AAAAAAAATTAGCTGTGGCCAGG - Intergenic
1027004379 7:74679924-74679946 TAGAAAAATTATCTGGGTGGTGG + Intronic
1027213614 7:76169387-76169409 AAAAAAAATTAGCTGGGTGTGGG - Intergenic
1027225676 7:76242328-76242350 TACAAAAATTAGCTGGGCGTGGG + Intronic
1027230580 7:76269434-76269456 CAGAAAAGTGAGATGGGGGATGG + Intronic
1027251160 7:76399679-76399701 CAGAAAAATTAGCAAGGTGTTGG - Intronic
1027397808 7:77774431-77774453 TACAAAAATTAGCTGGGGCCAGG + Intronic
1027410789 7:77915364-77915386 TACAAAAATTAGCTGGGCGTGGG - Intronic
1027489470 7:78804911-78804933 TACAAAAATTAGCTGGGTGCGGG + Intronic
1027500605 7:78945214-78945236 TACAAAAATTAGCTGGGTGTGGG - Intronic
1028131507 7:87181002-87181024 CAGAAAAATTAGCTGGTGGCAGG - Intronic
1028166808 7:87547571-87547593 ATCAAAAAATAGCTGGGGGCTGG + Intronic
1028437907 7:90826371-90826393 TACAAAAATTAGCTGGGAGTGGG - Intronic
1029185607 7:98736313-98736335 CAGCTAAATTAGCTTGTGGCAGG + Intergenic
1029246665 7:99207028-99207050 AAAAAAAAATAGCGGGGGGCAGG - Intronic
1029351199 7:100014281-100014303 TACTAAAATTAGCTGGGTGCAGG - Intergenic
1029358307 7:100069394-100069416 TACAAAAATTAGCTGGGGCGTGG + Intronic
1029434029 7:100551730-100551752 AAAAAAAATTAGCTGGGTGTGGG + Intronic
1029499305 7:100918162-100918184 TATAAAAACTAGCTGGGGCCGGG - Intergenic
1029533697 7:101142828-101142850 TTAAAAAATTAGCTGGGGCCAGG - Intergenic
1029533716 7:101142956-101142978 TTAAAAAATTAGCTGGGGCCGGG - Intergenic
1029555718 7:101267691-101267713 CAAAAATATTAGCAGGGGCCGGG - Intergenic
1029688576 7:102165517-102165539 TACAAAAATTAGCTGGGCGTGGG - Intronic
1029710370 7:102295925-102295947 CTGAACAATGAGTTGGGGGCAGG - Intronic
1029749421 7:102534621-102534643 TAAAAAAATTAGCTGGGTGGTGG + Intergenic
1029767367 7:102633726-102633748 TAAAAAAATTAGCTGGGTGGTGG + Intronic
1030032190 7:105379820-105379842 TACAAAAATTAGCTGGGGAGTGG + Intronic
1030086231 7:105818323-105818345 TACAAAAATTAGCTGGGGCGTGG - Intronic
1030212060 7:107006350-107006372 CAGAAATCACAGCTGGGGGCGGG - Intergenic
1030336767 7:108337107-108337129 CAGAAAAATTAGCTGGGCTGGGG + Intronic
1031021200 7:116629804-116629826 TAGAAAAATTAGCTGGGTGTGGG + Intergenic
1031277749 7:119752027-119752049 CACAAAAATTAGCTGGGCATGGG + Intergenic
1031377634 7:121047857-121047879 CAAAAAAATTAGCCGGGCGTGGG - Intronic
1031615006 7:123869842-123869864 TACAAAAATTAGCTGGGTGGGGG - Intronic
1031898603 7:127384387-127384409 ACAAAAAATTAGCTGGGGGGCGG - Intronic
1031975170 7:128089206-128089228 CACAAAAATTAGCTGGGCATGGG - Intronic
1032177910 7:129647688-129647710 AAGAAAAATAAGCTTTGGGCTGG - Intronic
1032258874 7:130318563-130318585 TACAAAAATTAGCTGGGGGTGGG - Intronic
1032467360 7:132154366-132154388 CAGAAAATTCACCTGGGAGCAGG + Intronic
1033169057 7:139067303-139067325 TACAAAAATTAGCTGGGGTGTGG - Intronic
1033309698 7:140251970-140251992 CACAAAAATTAGCCAGGGGCTGG - Intergenic
1033320904 7:140338909-140338931 TACAAAAATTAGCTGGGCGGGGG - Intronic
1033460936 7:141546953-141546975 TACAAAAATTAGCTGGGCACAGG - Intergenic
1033610194 7:142957650-142957672 CAGGGACATTAGCTGGGGGTGGG - Intronic
1033648631 7:143323399-143323421 CAGTGAAATGAGCTGGGGCCAGG + Intronic
1033931745 7:146531697-146531719 TACAAAAATTAGCTGGGCGTGGG - Intronic
1033972586 7:147060566-147060588 CAAAAAAAATATCTGGGGCCGGG + Intronic
1034134604 7:148754906-148754928 TTTAAAAATTAGCTGGGAGCTGG - Intronic
1034500536 7:151447907-151447929 TACAAAAATTAGCTGGGCGTGGG + Intergenic
1034624466 7:152482026-152482048 AAGAAAACTTAGCTGGGGGCTGG + Intergenic
1034761132 7:153672935-153672957 CAAAAAAATTAGCTGGGGCATGG - Intergenic
1035140965 7:156760284-156760306 GAGAAAAATTAGCTTGGGGAAGG + Intronic
1035210930 7:157327529-157327551 TACAAAACTTAGCTGGGGCCGGG - Intergenic
1035447668 7:158953858-158953880 CCTAAAAATTAGCTTGGGGAAGG + Intronic
1035660220 8:1342103-1342125 CAGAAAAATCAGCTGGGGGTAGG - Intergenic
1036053993 8:5230049-5230071 ACAAAAAATTAGCTGGGGGTGGG - Intergenic
1036142211 8:6218870-6218892 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1036526494 8:9539688-9539710 TAGAAAAATTAGCTGGGGCCTGG - Intergenic
1036567670 8:9951456-9951478 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1037110768 8:15161878-15161900 TACAAAAATTAGCTGGGCGTGGG + Intronic
1037174663 8:15932718-15932740 TACAAAAATTAGCTGGGTGTAGG - Intergenic
1037277697 8:17199395-17199417 CAGAAAAGAAAACTGGGGGCAGG - Intronic
1037574907 8:20192645-20192667 TACAAAAATTAGCTGGGTGGTGG + Intergenic
1037594729 8:20345521-20345543 ATGAAAAATGAACTGGGGGCTGG + Intergenic
1037874154 8:22530674-22530696 TACAAAAATTAGCTGGGGTGTGG + Intronic
1038274313 8:26107812-26107834 TAAAAAAATTAGCTGGGTGTGGG + Intergenic
1038782248 8:30578135-30578157 TATAAAAATTAGCTGGGCGTTGG - Intergenic
1038921272 8:32087623-32087645 TACAAAAATTAGCTGGGCGTGGG - Intronic
1038956065 8:32470016-32470038 AAAAAAAATTAGCTGGGCGTGGG - Intronic
1038969020 8:32609825-32609847 TACAAAAATTAGCTGGGGTGTGG - Intronic
1039067832 8:33624386-33624408 TACAAAAATTAGCTGGGCGTCGG + Intergenic
1039284315 8:36023964-36023986 GAGAAAAACCAGATGGGGGCCGG + Intergenic
1039307380 8:36277484-36277506 CAGGATCATGAGCTGGGGGCAGG - Intergenic
1039514433 8:38119968-38119990 CAAAAAAATTAGCTGGGCCTGGG + Intronic
1039528079 8:38233772-38233794 TACAAAAATTAGCTGGGCGGCGG + Intronic
1039535568 8:38309169-38309191 CCAAAAAACTAGCTGGAGGCTGG + Intronic
1039714685 8:40094721-40094743 CAGAGAAACTAGGTGGGGGAAGG - Intergenic
1039797665 8:40928972-40928994 CAAAAAAATTAGCCGGGTGTGGG - Intergenic
1039809093 8:41028674-41028696 TACAAAAATTAGCTGGTGGTGGG - Intergenic
1039985389 8:42443469-42443491 TACAAAAATTAGCTGGGCCCTGG - Intronic
1040493675 8:47947611-47947633 TACAAAAATTAGTTGGGGCCGGG + Intronic
1040593048 8:48813790-48813812 CAGAAAAATCACCTGGGGAATGG + Intergenic
1040804734 8:51381805-51381827 AAAAAAAATTAGCTGGGCGTGGG - Intronic
1040955526 8:52976124-52976146 AAGAAAATTGGGCTGGGGGCAGG - Intergenic
1040991395 8:53353989-53354011 TACAAAAATTAGCTGGTGGTGGG + Intergenic
1041068885 8:54107128-54107150 GAAAAAAATTAGCTGGGCTCAGG + Intergenic
1041234429 8:55785208-55785230 TATAAAAATTAGCTGGGCCCAGG - Intronic
1041247537 8:55903145-55903167 TATAAAAATTAGCTGGGCGTAGG - Intronic
1041261300 8:56022624-56022646 AAAAATAAATAGCTGGGGGCCGG - Intergenic
1041740493 8:61152005-61152027 TAGAAAAGAAAGCTGGGGGCGGG - Intronic
1042277180 8:67018270-67018292 TATAAAAATTAGCTGGGGCGTGG - Intronic
1042544344 8:69937615-69937637 CAAAATAATTAGCTGGGTGTGGG + Intergenic
1043545768 8:81313805-81313827 CAGAAGAAATGGCGGGGGGCGGG + Intergenic
1044389987 8:91638734-91638756 CATAAAAATTAGATGGGGCTGGG - Intergenic
1044413960 8:91915212-91915234 TACAAAAATTAGCTGGGTGGCGG + Intergenic
1044664936 8:94625100-94625122 TACAAAAATTAGCCGGGTGCGGG - Intergenic
1044665023 8:94625702-94625724 CACAAAAATTAGCTGGGCATTGG + Intergenic
1044679599 8:94763821-94763843 CAGAAAAATCACCTGGGGCTGGG - Intronic
1045059170 8:98397372-98397394 TACAAAAATTAGCTGGGTGAGGG + Intergenic
1045213294 8:100121266-100121288 TAGAAAAACTGGCTAGGGGCTGG - Intronic
1045909880 8:107394523-107394545 CAGAATAAGGAGCTGGGGGGAGG + Intronic
1046022162 8:108678517-108678539 AAAAAAAAATAGCTGGGTGCAGG - Intronic
1046088793 8:109473213-109473235 CAGAAAACTTCACTGGAGGCTGG + Intronic
1046461075 8:114536849-114536871 CACAAAAATTAGCTGGGTGTGGG - Intergenic
1046839955 8:118844987-118845009 ACAAAAAATTAGCTGGTGGCGGG + Intergenic
1046996682 8:120531546-120531568 CACAAAAATTAGGAGGGGGCGGG + Intronic
1047317841 8:123750779-123750801 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1047470565 8:125167508-125167530 TACAAAAATTAGCTGGGTTCGGG + Intronic
1047517921 8:125571012-125571034 CACAAAAATTAGCTGGGGGCGGG - Intergenic
1047591837 8:126335387-126335409 ACAAAAAATTAGCTGGGGCCTGG + Intergenic
1047675568 8:127197741-127197763 CAGAAAAATTAAGAAGGGGCAGG + Intergenic
1047938253 8:129802692-129802714 TAGAAAAATTAGCTGGGTGTAGG + Intergenic
1048094046 8:131272065-131272087 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
1048184490 8:132227214-132227236 TACAAAAATTAGCTGGGTGTTGG - Intronic
1048243296 8:132765935-132765957 TACAAAAATTAGCTGGTGGCGGG - Intergenic
1049177813 8:141205305-141205327 TACAAAAATTAGCCGGGTGCGGG + Intergenic
1049830372 8:144697642-144697664 CAAAAAAATTAGCTGGGCATGGG - Intergenic
1049919207 9:347349-347371 CAAAAAAATTAGCCAGGGGTGGG + Intronic
1049969440 9:808468-808490 CAAAAAAATTAGCTGGGCGTGGG + Intergenic
1050262163 9:3851988-3852010 CAAAAAAATTAGCTGGATGTGGG + Intronic
1050704847 9:8385368-8385390 TCTAAAAATTAGCTGGGGGTGGG + Intronic
1051200034 9:14607291-14607313 TATAAAAATTAGCTGGGTGTGGG + Intergenic
1051275651 9:15395444-15395466 TAAAAAAATTAGCTGGGGCCAGG + Intergenic
1051304299 9:15692219-15692241 CACAAAAATTAGCTGGGCATGGG + Intronic
1051645328 9:19262584-19262606 TACAAAAATTAGCTGGGTGTGGG - Intronic
1051892924 9:21961198-21961220 TACAAAAATTAGCTGGGCGTGGG - Intronic
1052353428 9:27480593-27480615 TACAAAAATTAGCTGGGGCCAGG - Intronic
1052828372 9:33194378-33194400 ACAAAAAATTAGCTGGGGCCGGG + Intergenic
1052868705 9:33482600-33482622 AAAAAAAATTAGCTGGGGCTGGG + Intergenic
1053287627 9:36860040-36860062 AAAAAAAATCATCTGGGGGCCGG + Intronic
1053348686 9:37396904-37396926 CAAAAAAATTAGCTGGGCATCGG + Intergenic
1053402197 9:37835281-37835303 AAAAAAAATTAGCTGGGGCCGGG + Intronic
1053811772 9:41860549-41860571 AAAAAAAATTAGCTGGGCGCGGG + Intergenic
1054618823 9:67326890-67326912 AAAAAAAATTAGCTGGGCGCGGG - Intergenic
1054767536 9:69054659-69054681 TACAAAAATTAGCTGGGTGTGGG - Intronic
1054898602 9:70342491-70342513 CACAAAAAACAGCTGGGGGTGGG - Intronic
1055013087 9:71588272-71588294 GAGAAAAATTCTATGGGGGCTGG + Intergenic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1055173172 9:73285742-73285764 CAAAAAAATTAGCTGGGCCTGGG + Intergenic
1055452976 9:76447393-76447415 AATAAAAATTAGCTGGGGCGTGG - Intronic
1055480451 9:76704377-76704399 TACAAAAATTAGCTGGGCGTGGG - Intronic
1055578470 9:77683258-77683280 CAAAAAAATTAGCTGGATGTGGG + Intergenic
1055610702 9:78021178-78021200 TACAAAAATTAGCTGGGCGTGGG - Intronic
1055680193 9:78706504-78706526 TACAAAAATTAGCTGGGCGTAGG - Intergenic
1055774501 9:79752876-79752898 TACAAAAATTAGCTGGGCACGGG + Intergenic
1055995175 9:82149542-82149564 GGAAAAAATTAGCTGGGGGTTGG + Intergenic
1056119116 9:83469838-83469860 CAGAAAACTAAGATGGGGGGCGG + Intronic
1056217206 9:84416289-84416311 CACAAAAATTAGCTGGGTGTGGG + Intergenic
1056523801 9:87424178-87424200 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1056666212 9:88582820-88582842 TACAAAAATTAGCTGGGTGTGGG - Intronic
1056748637 9:89327958-89327980 TACAAAAATTAGCTGGGTGTGGG - Intronic
1056780785 9:89548778-89548800 CAGAAAAATTAGCTGGGTGTGGG + Intergenic
1057053100 9:91940754-91940776 TACAAAAATTAGCCGGGGGTGGG - Intronic
1057091303 9:92260498-92260520 TACAAAAATTAGCTGGGCGTGGG + Intronic
1057358930 9:94355877-94355899 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1057535279 9:95896576-95896598 TAGAAAAATTAGCTGGGCACAGG - Intronic
1057648824 9:96901716-96901738 TACAAAAATTAGCTGGGCGTGGG + Intronic
1057713045 9:97464510-97464532 TACAAAAATTAGCTGGGTGTGGG - Intronic
1057730346 9:97602933-97602955 CAAAAAAATAAGCTGGGTGGTGG - Intronic
1058002043 9:99875869-99875891 TACAAAAATTAGCTGGGAGTGGG - Intergenic
1058022293 9:100102251-100102273 CACAAAAATTAGCTGGGCTGTGG - Intronic
1058045226 9:100351380-100351402 CAAAAAAAAAAGCTGGGGGTCGG + Intronic
1058242481 9:102582925-102582947 TACAAAAATTAGCTGGGTGGTGG + Intergenic
1058454120 9:105123451-105123473 ACAAAAAATTAGCTGGAGGCTGG - Intergenic
1058682370 9:107451218-107451240 TACAAAAATTAGCTGGGGTGTGG + Intergenic
1058697729 9:107573987-107574009 AAAAATAATTAGCTGGGGCCAGG - Intergenic
1058891815 9:109367643-109367665 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1059101589 9:111477261-111477283 CAAAAAAATTAGCCGGGTGTTGG - Intronic
1059114706 9:111590653-111590675 CAGAAAAATTACATGAAGGCTGG - Intronic
1059195331 9:112366126-112366148 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1059201743 9:112423866-112423888 TATAAAAATTAGCTGGGCGTGGG - Intronic
1059214387 9:112547222-112547244 CCAAAAAATTAGCTGGGAGTGGG + Intronic
1059599500 9:115761037-115761059 CAGAGATATTAGCTGGTGGGGGG + Intergenic
1060179805 9:121526042-121526064 TACAAAAATTAGCTGGGCGTTGG - Intergenic
1060636360 9:125202367-125202389 TAGAAAAATGAGCTGGGCGTGGG + Intronic
1060697282 9:125720175-125720197 TACAAAAATTAGCTGGGTGGGGG - Intergenic
1060888639 9:127174103-127174125 TACAAAAATTAGCTGGGGTTGGG + Intronic
1061145511 9:128795753-128795775 AAAAAAAATTAGTTGGGGCCAGG - Intronic
1061153258 9:128841539-128841561 AACAAAAATTAGCTGGGCGTGGG + Intronic
1061463258 9:130757404-130757426 TACAAAAATTAGCTGGGGCATGG + Intronic
1061529764 9:131201310-131201332 TACAAAAATTAGCTGGGCGTTGG + Intronic
1061792401 9:133065548-133065570 ATTAAAAATTAGCTGGGGACTGG + Intronic
1061998278 9:134200089-134200111 TAAAAAAATTAGCTGGGTGGGGG + Intergenic
1062231056 9:135481393-135481415 CACATAAATTAGCTGGGCGTGGG - Intronic
1203483526 Un_GL000224v1:29915-29937 TACAAAAATTAGCTGGGCGTGGG - Intergenic
1203629377 Un_KI270750v1:57171-57193 ACAAAAAATTAGCTGGGGCCGGG - Intergenic
1185433536 X:23712-23734 ACAAAAAATTAGCTGGGTGCAGG + Intergenic
1185442742 X:235780-235802 ACAAAAAATTAGCTGGGTGCAGG + Intergenic
1185536261 X:863711-863733 CAAAAAAATTAGCCGGGCGTGGG - Intergenic
1185580381 X:1207408-1207430 CAAAAAAATTAGCCGGGCGCGGG - Intronic
1185588828 X:1260390-1260412 AAGAAAAATTAGCCGGGCGTGGG - Intergenic
1185634924 X:1544827-1544849 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1185698220 X:2211999-2212021 AAAAAAAATTAGCTGGGCGTGGG + Intergenic
1185704549 X:2257108-2257130 TACAAAAATTAGCTGGGCGTGGG - Intronic
1185718090 X:2359523-2359545 CAAAAAAATTAGCTGGGCGTGGG + Intronic
1185726074 X:2422955-2422977 CACAAAAATTAGCTGGGCTTGGG - Intronic
1185888413 X:3802738-3802760 TAAAAAAATTAGCTGGGGCTGGG + Intergenic
1185888459 X:3803059-3803081 AAGAAAAATTATCTGGGGCTGGG + Intergenic
1186090812 X:6047321-6047343 CACAAAAATTAGCTGGTCGTGGG + Intronic
1186766993 X:12781282-12781304 AAGAAAACTGAGCTGGGGGTTGG + Intergenic
1187136802 X:16555844-16555866 AAAAAAAATTAGCTGGGCGTGGG - Intergenic
1187180326 X:16938060-16938082 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1187398982 X:18942690-18942712 AAAAAAAATTAGCTGGGTGTGGG + Intronic
1187417643 X:19106762-19106784 TACAAAAATTAGCTGGGCGGTGG + Intronic
1188257996 X:27985944-27985966 TACAAAAATTAGTTGGGTGCGGG + Intergenic
1188350385 X:29123182-29123204 TACAAAAATTAGCTGGGTGTGGG - Intronic
1188490792 X:30737219-30737241 TACAAAAATTAGCTGGGTGCAGG - Intergenic
1189136609 X:38557132-38557154 TACAAAAATTAGCTGGGTGTGGG - Intronic
1189433563 X:40970935-40970957 AAAAAAAATTAGCTGGGGCCGGG - Intergenic
1189904371 X:45742827-45742849 TACAAAAATTAGCTGGGTGGTGG + Intergenic
1189975777 X:46460421-46460443 AAAAAAAAAAAGCTGGGGGCAGG + Intronic
1190020595 X:46870403-46870425 TTAAAAAAATAGCTGGGGGCTGG - Intronic
1190021067 X:46876272-46876294 TTAAAAAATTAGCTGGGTGCAGG - Intronic
1190032076 X:46983521-46983543 CAGCAAAAGTAGCTGGGAACGGG + Intronic
1190049833 X:47141386-47141408 TAGAAAAATTAGCTGGGCATGGG + Intergenic
1190081521 X:47360123-47360145 TACAAAAATTAGCTGGGGTGTGG + Intergenic
1190177131 X:48159602-48159624 TACAAAAATTAGCTGGGAGTGGG - Intergenic
1190327762 X:49217252-49217274 CAGAAAACCTAGCTTGGGCCGGG - Intronic
1190635602 X:52430557-52430579 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1190749883 X:53352898-53352920 TACAAAAATTAGCTGGGTGCGGG - Intergenic
1190821457 X:53977177-53977199 AAAAAAAATTAGCTGGGGAATGG + Intronic
1191080373 X:56504367-56504389 AAGAACCATTAGGTGGGGGCTGG - Intergenic
1191674982 X:63784642-63784664 CAGAAAATCTAGTTGGGGGCAGG + Intronic
1191692058 X:63950584-63950606 CACAAAAATTAGCTGGGTTGTGG - Intergenic
1192108110 X:68335772-68335794 TATAAAAATTAGCTGGGCACGGG + Intronic
1192314301 X:70040056-70040078 CTGCAAAATGAGCTGGAGGCTGG - Intergenic
1192327089 X:70142176-70142198 TACAAAAATTAGCTGGGTGGTGG + Intronic
1192416486 X:70985607-70985629 TACAAAAATTAGCTGGGTGCAGG + Intergenic
1192734388 X:73834829-73834851 TACAAACATTAGCTGGGGGCGGG + Intergenic
1192814034 X:74572718-74572740 CACAAAAATTAGCCAGTGGCGGG - Intergenic
1192881097 X:75284906-75284928 AAGGAACATTAGGTGGGGGCAGG + Intronic
1193134937 X:77960224-77960246 TACAAAAATTACCTGGGGCCTGG + Intronic
1193150366 X:78118421-78118443 AAAAAAAATTAGCTGGGCGGTGG + Intronic
1193926123 X:87487665-87487687 TACAAAAATTAGCCGGGGGGGGG + Intergenic
1194020800 X:88690157-88690179 CAAAAAAATTAGCTGGGTGTGGG - Intergenic
1194117454 X:89920734-89920756 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1194141780 X:90217920-90217942 GAGAATAATTTGGTGGGGGCGGG + Intergenic
1195046957 X:101063086-101063108 TTTAAAAATTAGCTGGGGCCGGG - Intergenic
1195758329 X:108220947-108220969 TACAAAAATTAGCTGGTGGCAGG + Intronic
1196243798 X:113374433-113374455 CAAAAAAATTAGCCGGTGGCGGG - Intergenic
1196658137 X:118241331-118241353 GAGAAAAATTAGCCTGGGCCAGG - Intergenic
1196701920 X:118679081-118679103 TAAAAAAATTAGCTGGGGTATGG - Intronic
1197237308 X:124081842-124081864 TAGAAAAATTAGCTGGGAGTGGG + Intronic
1197623955 X:128781865-128781887 CAGAAAAATTATCTTGGTGTAGG - Intergenic
1197695517 X:129545863-129545885 AAAAAAAATTAGCTGGGGGGTGG - Intronic
1197780982 X:130159974-130159996 TAGAAAAATTAGCTGGGCGTTGG - Intronic
1197855012 X:130904982-130905004 AAGAAAAATCGGCTGGGTGCCGG + Intergenic
1197855597 X:130910799-130910821 CAAAAAAATTAGCTGGGCGTGGG - Intergenic
1198065747 X:133094938-133094960 TAGAAAAATTAGCTGGGCATAGG + Intronic
1198098540 X:133403849-133403871 CACAAAAATTAGCTGGGGTGTGG - Intronic
1198156988 X:133970706-133970728 CAAAAAAATGAGCTGGGGGGTGG + Intronic
1198198733 X:134392950-134392972 CAAAAAAATTAGCTGGGGTGTGG - Intronic
1198477381 X:137008799-137008821 TACAAAAATTAGCTGGGTGTGGG - Intergenic
1198919661 X:141711205-141711227 TACAAAAATTAGCTGGGGCATGG + Intergenic
1199024981 X:142925872-142925894 CAGAAAAATTAGGTTTGGGAAGG - Intergenic
1199582317 X:149372746-149372768 CTGAAAATATAGCTGGAGGCTGG + Intergenic
1200240642 X:154491297-154491319 TACAAAAATTAGCCGGGCGCGGG - Intergenic
1200333115 X:155319243-155319265 CAAAAGAAATAACTGGGGGCTGG + Intronic
1200487533 Y:3787021-3787043 GAGAATAATTTGGTGGGGGCGGG + Intergenic
1200606325 Y:5267356-5267378 AAAAAAAATTAGCTGGGTGTGGG - Intronic
1200769823 Y:7113295-7113317 CACAAAAATTAGCCGGGTGCCGG + Intergenic
1200821436 Y:7587675-7587697 CATAAGAATTAGCTGGGGTTGGG - Intergenic
1200859404 Y:7974427-7974449 GAGTAACATTAACTGGGGGCTGG + Intergenic
1200942141 Y:8795513-8795535 TACAAAAATTAGCTGGGTGTGGG + Intergenic
1201255451 Y:12103712-12103734 TACAAAAATTAGCTGGGGTGTGG - Intergenic
1201334481 Y:12865519-12865541 AAAAAAAATTAGCTGGGTGTGGG - Intergenic
1201952022 Y:19575928-19575950 CAAAAAAATTACCTGGGTGTGGG + Intergenic
1202238868 Y:22745077-22745099 CATAAGAATTAGCTGGGGTTGGG + Intergenic
1202277258 Y:23135540-23135562 TACAAAAATTAGCTGGGTGACGG + Intronic
1202288770 Y:23285149-23285171 TACAAAAATTAGCTGGGTGACGG - Intronic
1202302041 Y:23426964-23426986 CAAAAATATTACTTGGGGGCAGG - Intergenic
1202430250 Y:24769264-24769286 TACAAAAATTAGCTGGGTGACGG + Intronic
1202440542 Y:24900823-24900845 TACAAAAATTAGCTGGGTGACGG - Intronic
1202568770 Y:26243634-26243656 CAAAAATATTACTTGGGGGCAGG + Intergenic