ID: 903943123

View in Genome Browser
Species Human (GRCh38)
Location 1:26945280-26945302
Sequence TCTCAGGTGCAGGATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 1, 2: 2, 3: 28, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903943115_903943123 6 Left 903943115 1:26945251-26945273 CCTCTGGATCCAGTGTAGGCCTG 0: 1
1: 0
2: 1
3: 8
4: 142
Right 903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG 0: 1
1: 1
2: 2
3: 28
4: 284
903943118_903943123 -3 Left 903943118 1:26945260-26945282 CCAGTGTAGGCCTGCAAGGGTCT 0: 1
1: 0
2: 1
3: 12
4: 97
Right 903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG 0: 1
1: 1
2: 2
3: 28
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903943123 Original CRISPR TCTCAGGTGCAGGATGTGGA TGG Intronic
901636079 1:10670808-10670830 TCACAGCTGAAGGATGGGGAAGG - Intronic
902192762 1:14775055-14775077 TCTTAGGTGCAGAGTGTGGGTGG - Intronic
902702412 1:18181548-18181570 TGTCAGGAGCAGGAAGGGGAAGG - Intronic
902879927 1:19365177-19365199 TCTCAAGTCCAGGATGTGAGAGG - Intronic
903328835 1:22586617-22586639 TCACGGGTGCAGGCTGAGGACGG - Exonic
903482059 1:23660944-23660966 TCTGAGCTGCGGCATGTGGAAGG - Intergenic
903799742 1:25957769-25957791 TCTGAAGTCCAGGAAGTGGAAGG + Intergenic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
904093034 1:27958406-27958428 TGCAAGGTGCAGGATGGGGATGG + Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906684571 1:47755298-47755320 GCTCAGGTTTGGGATGTGGAAGG + Intergenic
908499958 1:64733281-64733303 TCTCAGATGCAGGAACTGAAGGG + Intergenic
909089616 1:71208932-71208954 TGTCAGGGTCAGGATGTAGAGGG - Intergenic
910852021 1:91657744-91657766 ACTTAGGGGCAGGATGAGGAAGG - Intergenic
911587329 1:99705589-99705611 GGACTGGTGCAGGATGTGGAAGG + Intergenic
912677331 1:111695974-111695996 ACTCTGGTGCAGGATGTTGATGG + Intronic
916078166 1:161215188-161215210 TCTCTTGTGCAGGAAGGGGAAGG + Intergenic
916784747 1:168078429-168078451 GCTCTAGTGCAGGATGTTGATGG + Intergenic
918094663 1:181324923-181324945 TCCCAGATGCAGGAGATGGAAGG - Intergenic
920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG + Exonic
923247684 1:232148607-232148629 ACTCTGGTGCAGGATGTCAATGG + Intergenic
923338643 1:232990307-232990329 TCTCAGGTGCAGTGTCTTGAGGG + Intronic
923627428 1:235625371-235625393 ACTCTGGTGCAGGATGTTCATGG - Intronic
923648276 1:235846124-235846146 TTTCTGGTGCAGGTGGTGGAGGG - Intronic
923663202 1:235976911-235976933 TCTGAGGTACAGGATGGGGCTGG - Exonic
1063245385 10:4212515-4212537 TCTCAGCTGCATGTGGTGGAGGG + Intergenic
1064251468 10:13709609-13709631 TCTCACGTAAGGGATGTGGATGG + Intronic
1064561567 10:16599454-16599476 TCCCTGGTGCAGGATGTGGTGGG - Intronic
1064745079 10:18470777-18470799 TCTCAAATGCTGGGTGTGGATGG + Intronic
1065854675 10:29820794-29820816 GCTCAGGTGCAGGGTATGAAGGG - Intergenic
1066180288 10:32955848-32955870 TCTCATGTGCAGAATGTTGAGGG + Intronic
1067189608 10:44058359-44058381 TCTCAGGTGAGGGCTGTGGCTGG + Intergenic
1070610431 10:77928509-77928531 TCTCAGGAGCAGGACTGGGAGGG - Intergenic
1072571457 10:96661496-96661518 ACTCTGGTGCTGGATGTTGATGG + Intronic
1072626694 10:97116711-97116733 TCTCTGGTGCAGGCTGGGGGTGG + Intronic
1075689439 10:124385704-124385726 TCTCAGGTGCAGGAGGCTGAGGG + Intergenic
1076871674 10:133197795-133197817 TGTCAGGTGCAGGAGCTGGTGGG - Intronic
1077494546 11:2880560-2880582 TCTCAGCTGCTGGGTGAGGAAGG - Intergenic
1077522226 11:3043216-3043238 TCTCAGATGCAGGTTGTGTAAGG - Intronic
1078845240 11:15114327-15114349 TGGCAGGTCCAAGATGTGGAGGG + Intronic
1079400701 11:20104240-20104262 TCTCATGGCCAGGATGTGGGAGG + Intronic
1081802435 11:45869377-45869399 GCTCAGCTGCCAGATGTGGAGGG - Intronic
1082749640 11:57002274-57002296 TGTCAGGTTCAGGATGGGGATGG + Intergenic
1082922411 11:58509937-58509959 TCTTTGGTGCAGGGTGTGGTGGG + Intergenic
1084670403 11:70603433-70603455 GGTCAGGGTCAGGATGTGGAGGG - Intronic
1084993873 11:72956052-72956074 TCTCTGGTGCAGGATGTTCCAGG - Intronic
1085542754 11:77288038-77288060 ACACAGGTGCAGGTTGTGGTAGG - Intronic
1085549688 11:77357231-77357253 TCCAAGGTGCAGGATGTAGTTGG - Intronic
1086011042 11:82103786-82103808 ACTCTGGTGCAGGATGTTGGTGG + Intergenic
1086538003 11:87872392-87872414 ACCCAGGTGCAGGATGTTGATGG - Intergenic
1087477491 11:98654959-98654981 TTTCAGGTGGAGGATATGTATGG - Intergenic
1087648597 11:100837729-100837751 TATCAGGTGCACGATGAGAATGG + Intronic
1088714581 11:112537601-112537623 TCCCAAGTGAAGGTTGTGGAAGG - Intergenic
1089127852 11:116190022-116190044 TCTCAGGAGCTGGGGGTGGAGGG + Intergenic
1091313077 11:134588493-134588515 TCGCAGGTGCAGCACGTGGCAGG - Intergenic
1091313101 11:134588665-134588687 TCGCAGGTGCAGCACGTGGCAGG - Intergenic
1091552462 12:1546870-1546892 CCTCAGGTTCAGGATGTAGGAGG + Intronic
1092039198 12:5368625-5368647 TCTGCAGTGCAGGCTGTGGAGGG - Intergenic
1092057067 12:5516411-5516433 TCTCAGGAGGAGGATTTAGAAGG + Intronic
1092192381 12:6530300-6530322 ACCCTGGTGCAGGATGTTGAAGG - Intronic
1094042573 12:26133216-26133238 TTTCAGGTGCAGGGACTGGATGG + Intronic
1096340952 12:50798597-50798619 TCTCAGGTTCAGGCTGGGCATGG - Intronic
1097260396 12:57716528-57716550 TCAGAGGAGCAGGATGGGGATGG + Intronic
1097631013 12:62062422-62062444 TCACAGCTGCAGCATGAGGAAGG - Intronic
1101821335 12:108186299-108186321 ACTCTGGTGCGGGATGTTGATGG - Intronic
1102487711 12:113269423-113269445 TTCCATGAGCAGGATGTGGAAGG - Intronic
1102896933 12:116605740-116605762 ACTCTGGGGCAGGATGTTGATGG - Intergenic
1103574043 12:121863862-121863884 TTTCAGGTTCAGGAAGTGGAAGG - Intergenic
1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG + Intergenic
1109292684 13:60495829-60495851 TCTTAGGAGCAGTTTGTGGAGGG + Intronic
1110242635 13:73285931-73285953 TCTCAGGTTCATGATTTGGGTGG - Intergenic
1110762521 13:79245980-79246002 TTTCACGTGGAAGATGTGGAAGG + Intergenic
1111386609 13:87536685-87536707 TCTCAGAAGCGGGATGTGGTAGG + Intergenic
1113513437 13:110873170-110873192 TGTCTGGGGCAGGACGTGGATGG - Intergenic
1113548474 13:111173513-111173535 GCTCAGCCCCAGGATGTGGAGGG + Intronic
1114132944 14:19814437-19814459 ACTCAGTAGCAGGATGTTGACGG - Intronic
1115035745 14:28854352-28854374 ACTCAGGAGCTGGAGGTGGAAGG + Intergenic
1115460830 14:33658684-33658706 TGTCAGGGGGAGGATGGGGAAGG + Intronic
1115807097 14:37063573-37063595 ACTGAGGTGCATGTTGTGGAGGG + Intronic
1116601795 14:46935327-46935349 TCTTAGGTGCGGGATATGTAGGG - Intronic
1117394717 14:55297928-55297950 TCTCAAGTCCAAGAAGTGGACGG - Intronic
1119019302 14:71093720-71093742 TCAGAGGTGGAGGAGGTGGAAGG - Intronic
1121771342 14:96544775-96544797 TCTCAGGTTCAAGATGATGAAGG - Intronic
1123468253 15:20531601-20531623 GCACAGGTGAAGGATGTGGAGGG + Intergenic
1123576034 15:21670253-21670275 ACTCAGTTGTAGGATGTTGACGG - Intergenic
1123612655 15:22112727-22112749 ACTCAGTTGTAGGATGTTGACGG - Intergenic
1123649863 15:22469463-22469485 GCACAGGTGAAGGATGTGGAGGG - Intergenic
1123728570 15:23126811-23126833 GCACAGGTGAAGGATGTGGAGGG + Intergenic
1123740264 15:23278282-23278304 GCACAGGTGAAGGATGTGGAGGG - Intergenic
1123746734 15:23324276-23324298 GCACAGGTGAAGGATGTGGAGGG + Intergenic
1124279001 15:28347592-28347614 GCACAGGTGAAGGATGTGGAGGG + Intergenic
1124303697 15:28564016-28564038 GCACGGGTGAAGGATGTGGAGGG - Intergenic
1124686652 15:31788666-31788688 TGGCAGCTGCAGGAGGTGGAAGG + Intronic
1126819007 15:52482936-52482958 ACTCAGGTGAAGGATGAGCAGGG + Intronic
1127884676 15:63189193-63189215 TCTGAGGTCCTGGATTTGGAAGG + Intergenic
1128183629 15:65625768-65625790 TATCAGGTCAAGGATGTAGAAGG - Exonic
1128246333 15:66135180-66135202 TTTGAGGTGAAGGATGTGGCTGG - Intronic
1129444409 15:75606757-75606779 TTTCAGGGTCAGGATGTGGTTGG + Intronic
1129464594 15:75716794-75716816 TCTCAGGAGCCAGCTGTGGAAGG + Intergenic
1131379728 15:91953886-91953908 TCTGAGGTGGAGGATGGGAATGG + Intronic
1202984902 15_KI270727v1_random:404498-404520 ACTCAGTTGTAGGATGTTGACGG - Intergenic
1132641289 16:979765-979787 TCCCAGGGGCAGGGGGTGGAAGG + Intronic
1132799307 16:1743845-1743867 TCTCAGGGGCAGGATGTGTCTGG - Intronic
1135246178 16:20859138-20859160 TGACAGGTGCAGCATGTTGATGG + Exonic
1135998183 16:27268957-27268979 ACTGAGGTGCAGGAGGCGGAGGG - Intronic
1138199928 16:55080983-55081005 TCTCAGGTGCATGGGGTGGCAGG + Intergenic
1138889539 16:61125926-61125948 ACTGTGGTGTAGGATGTGGATGG - Intergenic
1139082861 16:63546720-63546742 TCTCTGGGGCATGATGTTGATGG - Intergenic
1139223202 16:65205955-65205977 TCTCACTTGCTGGATGGGGAGGG + Intergenic
1139585036 16:67897056-67897078 TCTCAGCTGTATGATGTGAATGG + Intronic
1140307143 16:73813743-73813765 TCTGAGGTACAGGAAGAGGAGGG - Intergenic
1141169040 16:81679791-81679813 TGTCAGGTGGAGCGTGTGGATGG - Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141510097 16:84506268-84506290 TCTCAGGTGCAGGTACTGGGGGG + Intronic
1141675120 16:85513737-85513759 TCTCAGGAGCAGGACAGGGAAGG - Intergenic
1142352064 16:89585098-89585120 TTTCACCTGCAGGAAGTGGAAGG - Intronic
1142428734 16:90014547-90014569 TCTCCAGTGCAAGATGGGGAAGG - Intronic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1144810755 17:17997407-17997429 TTTCAGGAGCAGGCTGCGGAGGG - Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145860964 17:28209654-28209676 TGTCAGGGGCTGGATGAGGACGG + Intergenic
1146897330 17:36553507-36553529 TCTCTGGTGCTGGTTGGGGAAGG + Intronic
1147460102 17:40562908-40562930 CATAAGGTGCAGGAAGTGGAGGG - Intronic
1147655745 17:42089760-42089782 TCTCAGCAGCAGAATGTGTACGG + Intergenic
1152190709 17:78885691-78885713 TGTGAGGGGCAGGAGGTGGAGGG + Intronic
1152703067 17:81829041-81829063 CCTGAGGTGGTGGATGTGGAGGG + Intronic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1154370065 18:13752322-13752344 TCTCATTTGCAGGATATGGCTGG - Exonic
1154458967 18:14560329-14560351 CCTCAGTTGTAGGATGTTGACGG - Intergenic
1155819433 18:30355610-30355632 TCTCAGGTACAGGCTGAGGCGGG + Intergenic
1155995362 18:32325423-32325445 ACTCTGGTGCAGGATGTTAATGG + Intronic
1157291173 18:46410944-46410966 TGTCAGGTGCTGGCTGTGCATGG + Intronic
1158846081 18:61444168-61444190 TCTATGGTGCAGAATGGGGAGGG - Intronic
1160558167 18:79739575-79739597 TCCCAGCTGCAGGAGGTGGTTGG + Intronic
1160584044 18:79903045-79903067 TCTCGGGTCCAGGGAGTGGAGGG - Exonic
1161196600 19:2989877-2989899 TCCCAGGTTCAGGAGGTGGCAGG - Intronic
1161575163 19:5051013-5051035 CCACAGGTGCAGGTTGGGGAGGG - Intronic
1161617732 19:5281559-5281581 GCTCAAGTTCTGGATGTGGAAGG - Intronic
1161743734 19:6042074-6042096 GCCCAGGTGCAGTACGTGGAAGG - Exonic
1162935034 19:13978022-13978044 AGCCAGGTGCAGTATGTGGAGGG - Exonic
1163148976 19:15400084-15400106 TCCCAGGCGGAGGCTGTGGATGG - Intronic
1163290814 19:16377917-16377939 TGTGGGGTGGAGGATGTGGATGG - Intronic
1163491263 19:17618375-17618397 TCCCAGGTGGGGGATGTAGAGGG - Intronic
1164155457 19:22593890-22593912 GCTGAAGTGCATGATGTGGATGG + Intergenic
1164769891 19:30800399-30800421 TCTCGGCTGAAGGAGGTGGAAGG - Intergenic
1165065866 19:33227275-33227297 TCTCTGGGGCTGGAGGTGGAGGG - Intergenic
1165705149 19:37970647-37970669 CCTCTCCTGCAGGATGTGGAGGG + Intronic
1165821097 19:38676607-38676629 CCTCTGGGGCCGGATGTGGAAGG + Intronic
1166061535 19:40328614-40328636 TCTCAGGGTCAGGATGGAGAAGG + Intronic
1168137770 19:54362920-54362942 TCACAGGGACAGGATGTGGCTGG + Intronic
1168160252 19:54505704-54505726 TCACAGGGACAGGATGTGGCTGG - Intronic
925917775 2:8619164-8619186 CCTCAGGTGCAGGATGGAGCTGG - Intergenic
926040833 2:9671685-9671707 TCTTTGGTGCAGAATGTTGATGG - Intergenic
926065797 2:9838825-9838847 GCGCAGGTGCATGAGGTGGAAGG - Intergenic
927524132 2:23721607-23721629 TCTCAGGTCTAGGATATGGTAGG - Intergenic
929083257 2:38142425-38142447 CCTCAGGGGCAGGGTGTGGTGGG - Intergenic
929453480 2:42051224-42051246 TGTCAGGGGCGGGATGGGGAGGG - Intronic
929890965 2:45918254-45918276 TCTCATGTGCTGGCTGTGGAAGG + Intronic
929967886 2:46549075-46549097 TCAAAGGTCCAGGATGGGGATGG - Intronic
930376473 2:50573413-50573435 TCTCAGATGAAGGACCTGGATGG + Intronic
933316090 2:80717140-80717162 TTTCAGGTGGAGAATATGGAGGG - Intergenic
933832077 2:86219114-86219136 TTTCAGTTGTAGGATGTGGATGG - Intronic
935078815 2:99772078-99772100 TCTGAGGTGGAGGATGGGAAAGG - Intronic
937338650 2:121077116-121077138 TGGCAGGTGCAGGTTGTGCAGGG - Intergenic
937505485 2:122531920-122531942 TGTCAGATGCAGGCTGGGGAGGG - Intergenic
938191144 2:129281892-129281914 TGTCTCCTGCAGGATGTGGATGG + Intergenic
938830300 2:135043547-135043569 ACTCTGGTGCAGGCTGTTGATGG - Intronic
939432675 2:142130898-142130920 TGCCTGGAGCAGGATGTGGAAGG + Exonic
940900220 2:159120004-159120026 TCTCAGGTGCAGCCTGTTGTGGG + Intronic
943872852 2:193024133-193024155 ACTCTGATGCAGGATGTTGATGG - Intergenic
944024013 2:195142203-195142225 CCTCAGGAGCAGTTTGTGGAGGG + Intergenic
944863225 2:203835199-203835221 ACTGAGGTCCAGGATGAGGATGG - Intergenic
945128152 2:206536413-206536435 TACCAGGGGCAGGAGGTGGAGGG + Intronic
946164425 2:217855303-217855325 TTTCACGGGCAGGATGAGGAAGG - Intronic
949001830 2:241619161-241619183 GCCCAGGCGCAGGCTGTGGAAGG + Intronic
1170732598 20:18987638-18987660 TCTTTGGTGGAGGAGGTGGATGG - Intergenic
1171489312 20:25505277-25505299 TCACAGGAGCAGGGTGTAGAAGG + Intronic
1171491945 20:25526131-25526153 TCACAGGGGCAGAATGGGGAAGG - Intronic
1173790129 20:45823076-45823098 TCTGAGCGGCGGGATGTGGAAGG - Intergenic
1173910066 20:46661622-46661644 TCCCAGGTGCAGGAAATGGGGGG - Intronic
1174527091 20:51181463-51181485 TTGCAGGGGAAGGATGTGGAGGG - Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175806130 20:61830315-61830337 TCTGAGGCAGAGGATGTGGATGG - Intronic
1175965737 20:62659347-62659369 TCACAAGTGCAGGATGGGCAAGG - Intronic
1176060238 20:63169311-63169333 TCCCAGGCACAGGATGGGGAGGG + Intergenic
1176815172 21:13593006-13593028 CCTCAGTTGTAGGATGTTGACGG + Intergenic
1177552500 21:22643869-22643891 TCTCAGATTTAGTATGTGGATGG - Intergenic
1179051444 21:37891898-37891920 TCTCAAGTGTGGGATGGGGAAGG + Intronic
1180258737 21:46651539-46651561 TCTCCAGTGCAGGCAGTGGAGGG + Intronic
1183463339 22:37966410-37966432 CCTCAGGTGAAGGGTGGGGAGGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1185280624 22:49968417-49968439 TCTCAGGTCCAGGATGGGGCTGG - Intergenic
1185418911 22:50724369-50724391 TCTCAGATGTGGGATGGGGAAGG + Intergenic
950356566 3:12415222-12415244 TCTCAGAAGCAGGATGTGTGTGG - Intronic
950437427 3:12988667-12988689 TCTGAGGAGCAGGCTGGGGAGGG + Intronic
950787971 3:15451411-15451433 TCTCAGGTTGGGCATGTGGAAGG + Exonic
952220584 3:31320287-31320309 TCTCAGGTGCAGAAGTTGAAAGG - Intergenic
952352684 3:32555649-32555671 ACTCAGCTGCAGGATGGGAATGG - Intronic
952387247 3:32850924-32850946 CCTGAGGTGCAGGTTGGGGAGGG + Intronic
952881087 3:37986778-37986800 CCTGGGCTGCAGGATGTGGAAGG - Intergenic
953238508 3:41127143-41127165 TCCCAGGTGAGGGATGTGGTTGG - Intergenic
953858999 3:46526385-46526407 TTCCAGGGGCTGGATGTGGAAGG + Intronic
957387986 3:79521782-79521804 TCTCAGGAGCAGACCGTGGATGG - Intronic
957990467 3:87620589-87620611 TCTCAGGTGCAGTTTCTGGTTGG + Intergenic
959100067 3:102000329-102000351 TTTCATGTGCATGATTTGGAAGG + Intergenic
959167914 3:102803627-102803649 TCCCAGGTGCAGGAAGAGTAAGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962140039 3:132780630-132780652 TCTCAGGCTCAGCATCTGGAGGG - Intergenic
963785613 3:149531550-149531572 GCGCAGGTGCAGGAGGTGGGAGG - Intronic
964626157 3:158762049-158762071 TGGCAGGAGCAGGATGGGGAAGG + Intronic
965505938 3:169515036-169515058 TCTCAGTTGTTGGATGTGGGTGG - Intronic
966863348 3:184242611-184242633 GCAGAGCTGCAGGATGTGGAAGG + Exonic
968496932 4:923671-923693 TCTCAAGGGCAGGGAGTGGAGGG + Intronic
970221142 4:13812325-13812347 TCTCAGTTGCAGGATGAGATAGG + Intergenic
970477941 4:16443074-16443096 TCTCAGGTGTTTGATGTGGAAGG - Intergenic
975896187 4:79093771-79093793 TGCCAGGGGCAGGATGTGGGGGG - Intergenic
976239742 4:82942644-82942666 TCCCAGGAGCAGGTGGTGGAGGG - Intronic
977418332 4:96764034-96764056 ACACAGGTGCAGGCTGTGGTGGG + Intergenic
978385277 4:108171583-108171605 TCCCAGGTCCGGGATGTGGTGGG + Intergenic
979789399 4:124759701-124759723 ACACTGGTGCAGAATGTGGATGG - Intergenic
984814642 4:183825184-183825206 TCTCAGGTCCACCATGAGGACGG + Intergenic
985073265 4:186189825-186189847 TGACAGGTGCAGGATGAGGTGGG - Intergenic
985675633 5:1230028-1230050 TCTCAGGTGCAGGCTGGAGGTGG + Intronic
985687236 5:1289130-1289152 TCTCAGGTGCAGGGTGAGTGAGG - Intronic
987876213 5:23684893-23684915 GTACAGGTGCAGGATGTGCAGGG + Intergenic
992175105 5:74142303-74142325 GCTCAGCTTTAGGATGTGGATGG + Intergenic
992255525 5:74917202-74917224 TCTCATTGGCAGGAAGTGGAAGG - Intergenic
993298354 5:86173770-86173792 TCCCAGGTGAAGGATGTGCAAGG + Intergenic
994355673 5:98791791-98791813 TCTCTGGTACAGGTGGTGGAGGG - Intronic
996213974 5:120845318-120845340 TCTCATTTGCAGGATGAAGAGGG + Intergenic
997431671 5:133845124-133845146 TCACAGAGGCAGGGTGTGGATGG + Intergenic
997836158 5:137195007-137195029 ACTCACGTGTTGGATGTGGAGGG - Intronic
997958556 5:138300089-138300111 TCTCAGGAGGCGGAGGTGGAAGG + Intronic
998390288 5:141783087-141783109 CCACAGGGGCAGGAGGTGGAGGG - Intergenic
998401235 5:141850128-141850150 ACTCAGGTGCAGGATGGGGTGGG - Intergenic
998849588 5:146340312-146340334 TCTCAGATGAAGGACGTGGCTGG - Exonic
999066518 5:148692720-148692742 TCTCAGGGGGATGAAGTGGAAGG + Intergenic
999682771 5:154075395-154075417 TCTGACGTGGAGGATGGGGAAGG - Intronic
1001086728 5:168705569-168705591 TCTAGGGTGCATGATGTTGATGG - Intronic
1001103901 5:168836501-168836523 TTTCAAGGGCAAGATGTGGAGGG - Intronic
1001398603 5:171433556-171433578 CCTGAGCAGCAGGATGTGGAAGG + Intronic
1001921706 5:175605776-175605798 GCTCAGGTCCACGATTTGGAGGG - Intergenic
1002087876 5:176787001-176787023 TCTCATGTTCAGGCTGTAGATGG + Intergenic
1002097680 5:176840998-176841020 TCTCCGGTGAAGGAGGTGGATGG - Intronic
1002123010 5:177020369-177020391 TCTCAGGTGAATGATGTGTTAGG - Intronic
1002349571 5:178574426-178574448 AGTAAGTTGCAGGATGTGGAGGG + Intronic
1002390473 5:178907919-178907941 TGACAGGTGCAGCATGTTGATGG + Intronic
1004015645 6:11729483-11729505 TCTCAGGGACAGGAGGGGGAAGG - Intronic
1005087894 6:22025610-22025632 TCCCAAGTGCAGGGGGTGGAGGG - Intergenic
1008534375 6:52496081-52496103 TGTCAGGTTCAGGTGGTGGAAGG + Intergenic
1011314475 6:86016436-86016458 AGGCTGGTGCAGGATGTGGAAGG + Intergenic
1012866754 6:104627149-104627171 TCTCAGTTGCAGTATGTCGGAGG - Intergenic
1015234620 6:130956323-130956345 TTTCAGCTGCAGGAGGTGGCTGG + Exonic
1015487262 6:133787117-133787139 CCTCAAGTGCAGGACGGGGAGGG - Intergenic
1016221339 6:141674003-141674025 TCTCTGGTGTGGGATGTTGATGG + Intergenic
1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG + Exonic
1018854244 6:167664029-167664051 TGACAGGTGCAGGATGCTGAGGG + Intergenic
1021061503 7:16118234-16118256 TCTGAGGTACAGACTGTGGAAGG + Intronic
1023029411 7:36079496-36079518 CAGCAGGTGCAGGCTGTGGAAGG + Intronic
1023976194 7:45031987-45032009 TCTCAGCTGCAGGGGGTGGTAGG - Intronic
1024476819 7:49820838-49820860 GCCCAGGTGCAGGCTGAGGAAGG + Intronic
1024674970 7:51630124-51630146 TCTGAGGTGCAGGATGTATTGGG + Intergenic
1025927693 7:65972691-65972713 TTTCTGGGGCAGGATTTGGAGGG - Intronic
1027220969 7:76213706-76213728 TCTAAGGTGCTTGGTGTGGATGG + Intronic
1032476330 7:132213889-132213911 TCTCAGTGGCAACATGTGGATGG - Intronic
1034330037 7:150274626-150274648 CCTCAGGTGCAGGATGGGCCAGG - Intronic
1034488510 7:151380935-151380957 TCACTGGTGCAGGAAGTGGATGG - Intronic
1034668018 7:152835235-152835257 CCTCAGGTGCAGGATGGGCCAGG + Intronic
1035446367 7:158945664-158945686 CTTCAGGTGCTGGATGTCGATGG - Exonic
1035551407 8:530169-530191 TCTCAGATGCAGAATTTGTATGG + Intronic
1036568665 8:9960362-9960384 CCTCAAGTGCTGGATGGGGAAGG + Intergenic
1036979913 8:13459287-13459309 TCTCTGGGACAGGAAGTGGAGGG + Intronic
1037333741 8:17771262-17771284 TCTCAGGTCAATGATGAGGAAGG + Intronic
1037674051 8:21039327-21039349 TCTCAGGTCCAGGCCGTGCACGG - Intergenic
1037746142 8:21646494-21646516 CATTAAGTGCAGGATGTGGACGG - Intergenic
1038260042 8:25984889-25984911 TCTCAGTTTCAGGAGGTGGGTGG - Intronic
1038919782 8:32069787-32069809 TCTCAGGTGAAGGATGTCCCTGG - Intronic
1039213849 8:35245717-35245739 TCTCCGCTGCAGAATGTGGTAGG - Intronic
1041353474 8:56973952-56973974 TCTCGGGTGGAGGAGGTGGAAGG - Intronic
1041545228 8:59034941-59034963 TCTCAAGGTCAGGAAGTGGAAGG + Intronic
1046299565 8:112269396-112269418 TCCCAGATGCAGGATGTTGGGGG + Intronic
1046852155 8:118986869-118986891 TTTCAGGTATAGGATGTGGAAGG + Intergenic
1048525141 8:135195778-135195800 TCACAGATGGTGGATGTGGACGG - Intergenic
1050217719 9:3346697-3346719 GCTCAGGTGCAGTATGTGGAAGG - Exonic
1053606823 9:39668382-39668404 TGTAAGGTAGAGGATGTGGAGGG + Intergenic
1053864740 9:42425012-42425034 TGTAAGGTAGAGGATGTGGAGGG + Intergenic
1054246713 9:62674020-62674042 TGTAAGGTAGAGGATGTGGAGGG - Intergenic
1054560834 9:66708554-66708576 TGTAAGGTAGAGGATGTGGAGGG - Intergenic
1055036835 9:71826588-71826610 TGTCATGTCCAGGATGGGGAGGG + Intergenic
1056594078 9:87991070-87991092 ACTCCAGTGCAGGATATGGATGG - Intergenic
1057225138 9:93289176-93289198 GCTCAGGTGCAGGAGGTGGCAGG - Exonic
1058079903 9:100690593-100690615 TCTGGGGTTTAGGATGTGGATGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1060552829 9:124493682-124493704 TCTCAGGCTCAGGAGGAGGAGGG + Intronic
1061218256 9:129234553-129234575 GCACAGGTGGAGGATGTGGACGG - Intergenic
1062239014 9:135526071-135526093 TCTCAGGGGCATGGTGTGGGGGG - Intronic
1062239053 9:135526210-135526232 TCTCAGGGGCATGGTGTGGGGGG - Intronic
1203532186 Un_GL000213v1:156420-156442 CCTCAGTTGTAGGATGTTGACGG - Intergenic
1186289940 X:8086254-8086276 TCTCAAGTACAAGTTGTGGAAGG + Intergenic
1186683315 X:11898350-11898372 TCTCAGGTGCTGCTTGTAGATGG + Intergenic
1187707545 X:22023311-22023333 TCTTAGTTGCTGGATCTGGAGGG - Intergenic
1188107183 X:26159643-26159665 TCTTAGGGGCAGGATGGGGCAGG - Intergenic
1190084312 X:47382215-47382237 TCACAGGTGCAGGATGACAAAGG - Intronic
1190128242 X:47724403-47724425 GGTCAGGGGCAGGATGTGGGTGG + Intergenic
1190497895 X:51044265-51044287 TCTTAGGTGCAGGAGTGGGAGGG + Intergenic
1192316160 X:70053344-70053366 TCTCAGGGGCAGGAATTGGGTGG + Intergenic
1193715136 X:84928056-84928078 TGTCAGCTGCAGGATATGGGTGG + Intergenic
1194479825 X:94407243-94407265 TGTCAGGTGCAGGATGGGAGTGG + Intergenic
1195107697 X:101616687-101616709 TCTCAGGTCCAGGGTGAGTAAGG + Exonic
1196578530 X:117351134-117351156 CCTCAGGTGCAGGTTGTTGGGGG + Intergenic
1196817366 X:119676038-119676060 TCTCAGATGGCAGATGTGGAAGG - Intronic
1197179282 X:123517031-123517053 TCTGGAGTGTAGGATGTGGAAGG + Intergenic
1198774230 X:140162594-140162616 TGTCAACTGCTGGATGTGGAGGG - Intergenic
1201473330 Y:14356529-14356551 TTTGTGGTGCAGGATATGGAAGG + Intergenic