ID: 903943264

View in Genome Browser
Species Human (GRCh38)
Location 1:26946115-26946137
Sequence CTTCCGTTTCTCCAGGTTCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903943264 Original CRISPR CTTCCGTTTCTCCAGGTTCA TGG Exonic
903943264 1:26946115-26946137 CTTCCGTTTCTCCAGGTTCATGG + Exonic
904472672 1:30745704-30745726 CCTCCCTTTCTCCTGGGTCAGGG - Intronic
908166355 1:61463139-61463161 CTTCGGTTTCCCCAGCTCCAGGG - Intergenic
909555186 1:76945720-76945742 CCTCCGGTTCTCCAGGCTTATGG + Intronic
909685201 1:78340033-78340055 CTTCAGTTTTTCCAGGTTGTAGG - Intronic
911302585 1:96193055-96193077 CTGCCATTTTTCCAGGTGCATGG - Intergenic
912572252 1:110633260-110633282 CTTCCTTTTCACCAGGATCTGGG - Intergenic
912604613 1:110976412-110976434 TTTCCTTTTCTCAAGGATCATGG + Intergenic
913348610 1:117832682-117832704 CTGCAGCTTCTCCAGGTACAAGG - Intergenic
913383648 1:118236275-118236297 TTTCTGTTTCTCCAGTTCCATGG - Intergenic
914356098 1:146885838-146885860 CTTGCGGTTCTCCAAGTTCATGG - Intergenic
915380241 1:155433542-155433564 CTTCTCCTTCTCCAGTTTCACGG - Intronic
917047058 1:170872565-170872587 CTTGTGTTTCTCCATCTTCAAGG - Intergenic
918245366 1:182654859-182654881 CTTGCTATTCTCCAGGTTCAAGG - Intronic
920450957 1:206060804-206060826 CCTCCATTTCTTCAGGGTCATGG - Intronic
920707500 1:208265105-208265127 CTTAAGTTTCTCTAGGTTCTTGG - Intergenic
920919925 1:210290315-210290337 CTTCAGTTTCTCCACTTTTAAGG - Intergenic
921432356 1:215080142-215080164 CTTCTGTTTTTCCAGACTCATGG - Intronic
921544176 1:216454496-216454518 CTTCTGTTGCTCCAAGTTAATGG - Intergenic
921716319 1:218420473-218420495 AATCCATTTCTCCAGGTTGAAGG - Intronic
922494005 1:226041872-226041894 CTGCTGTTTCTCCAGGTGCTCGG + Intergenic
924308078 1:242712448-242712470 CTTCTGTTTCTCTAGGTACCTGG - Intergenic
1065279614 10:24121371-24121393 CTTCAGTTTCTGCAGGGTTATGG + Intronic
1066449097 10:35511840-35511862 TCTCCATCTCTCCAGGTTCACGG - Intronic
1067264052 10:44721753-44721775 TTTCCGTTTCTCCAGGCTGTTGG + Intergenic
1069687316 10:70326528-70326550 CTTCCATTTTTCCATCTTCAGGG + Intronic
1072203382 10:93180864-93180886 CTTCCCTTGCTCCAGGCACATGG + Intergenic
1073662480 10:105491889-105491911 ATTCTGTTTCTGCAGGTTCTGGG + Intergenic
1073926155 10:108518990-108519012 CTTCAGCTTTTCCAGGTGCATGG - Intergenic
1074069905 10:110056836-110056858 TTTCCTTTGCTCCAGGTGCATGG - Intronic
1076600914 10:131656427-131656449 TTTCCTGTTCTCCAGGCTCAGGG - Intergenic
1076748677 10:132528475-132528497 GCTCCGTTTCTGCAGGTTCTAGG + Intergenic
1077543540 11:3158978-3159000 CTTCAGTTTCTCCATCTTTAAGG - Intronic
1077726499 11:4680321-4680343 CTTGCTTTTTTCCAGATTCAGGG - Exonic
1077919283 11:6630988-6631010 CTTCAGTAGCTCCAGCTTCACGG - Intronic
1078292358 11:10025528-10025550 CTTCATTTTCTCCTGGATCATGG + Intronic
1078844360 11:15108068-15108090 CTTGGGATTCTCCAGGTACATGG + Intergenic
1079386042 11:19980557-19980579 CTTGTGTTTCTGAAGGTTCAGGG - Intronic
1083768040 11:64851517-64851539 CTTCCCTTCCTCCTAGTTCAGGG + Intergenic
1084081495 11:66828797-66828819 ATTCTGTTTCTCCAGATTCCAGG - Intronic
1088216959 11:107521547-107521569 CTTCCGTTTCTCTAGATTAGGGG - Intronic
1089479732 11:118794354-118794376 CCTCCGCCTCCCCAGGTTCAAGG - Intergenic
1089812812 11:121145580-121145602 CTTCCCTTGCCCCAGCTTCAGGG - Exonic
1090139580 11:124241101-124241123 TTTTTGTTTCTCCAGCTTCAGGG - Intergenic
1090480804 11:127066661-127066683 CTTCTGTTTCTCATGGGTCAGGG + Intergenic
1090704512 11:129324448-129324470 TTTCCTTTTCTCCAGAATCAAGG + Intergenic
1091091298 11:132773491-132773513 CTTCTGTCTCTGCAGGTTCCTGG + Intronic
1092396822 12:8134468-8134490 CTTCTCCTTCTCCAGCTTCACGG + Intronic
1092665396 12:10791481-10791503 CTGCAGTTTTTCCAGGTACATGG + Intergenic
1094282436 12:28754764-28754786 CTGCAGCTTTTCCAGGTTCATGG + Intergenic
1094762615 12:33551647-33551669 CTGCAGTTTTTCCAGGTACATGG - Intergenic
1100437096 12:94581732-94581754 CCTCAGTTCCTCCAGGATCACGG + Exonic
1101866598 12:108524926-108524948 CTCCCCTTTATCCAGGTTAATGG - Intronic
1102786950 12:115612754-115612776 TTTTCTTTGCTCCAGGTTCAGGG + Intergenic
1103028685 12:117594678-117594700 CTTCCTTATCTCCAAGTTCTTGG - Intronic
1103258115 12:119560958-119560980 CTTCCCTTCCTCCAGCTTCCTGG + Intergenic
1103562481 12:121799949-121799971 CTTCCTCTCCTCCAGGTTCTGGG - Intronic
1104374507 12:128251976-128251998 CTTCCCATTCTCCAGCTTCCCGG - Intergenic
1104948130 12:132426378-132426400 CTGCGGTTTCGTCAGGTTCATGG + Intergenic
1107956852 13:45522478-45522500 CTTCTCTTACTCCAGGTTCCAGG - Intronic
1108066824 13:46586497-46586519 CTTCCACTTCCCCAGGCTCAAGG + Intronic
1108979460 13:56492182-56492204 CTGCAGCTTTTCCAGGTTCATGG + Intergenic
1110868969 13:80428446-80428468 GTTCCTTTTCTCCAGGTCTAGGG - Intergenic
1111485909 13:88897650-88897672 CTCCTGTTTCTCCAGTTTTAGGG + Intergenic
1112392626 13:98998948-98998970 CTTCCCTTTCTCCAGCCCCAAGG - Intronic
1113154031 13:107297440-107297462 CTTCCATTTCTACAAGTTAAAGG + Intronic
1114567717 14:23644812-23644834 CTTCCCTTTGCCCAGTTTCATGG + Exonic
1116257164 14:42571132-42571154 CTTCCATCCCTGCAGGTTCAGGG + Intergenic
1116762139 14:49027349-49027371 CTGCAGTTTTTCCAGGTGCATGG - Intergenic
1117326967 14:54678284-54678306 GTTCCTTTCCTCCAGGTACAGGG + Intronic
1119574755 14:75709510-75709532 CTTCCCTTTCTCAATTTTCAAGG - Intronic
1120356787 14:83444300-83444322 ACTCTGTTTCTCCAGGTACAGGG - Intergenic
1121137806 14:91514013-91514035 CCTCTGTCTCCCCAGGTTCAAGG + Intergenic
1121301821 14:92877966-92877988 CTTCGCTTTCTCCAGGTCAAGGG - Intergenic
1121454734 14:94030850-94030872 CTTCCGTTTCTAGAGGCTCCCGG - Intronic
1122792098 14:104188328-104188350 CTGCCGTTTCTCCAGCCCCAGGG + Intergenic
1124809771 15:32923925-32923947 CTTGAGTTTCACCAGGCTCATGG + Intronic
1125087523 15:35747883-35747905 CTTTGGTTTCTCCAGCCTCAAGG + Intergenic
1127065041 15:55228380-55228402 CTTCCTGTGCTCCAGGTGCAAGG - Intronic
1128197367 15:65771872-65771894 CATCTGTTGCTCCAGGTGCATGG + Intronic
1128568858 15:68718877-68718899 CCTGGGTTTCTCCAGGGTCATGG - Intronic
1131868683 15:96738904-96738926 CTTCCATGTCCACAGGTTCAGGG + Intergenic
1131890814 15:96969718-96969740 CTTCCGCCTCTGCAGGCTCAGGG + Intergenic
1132894936 16:2224173-2224195 CCTCGGTTTCTCCAGGATCTGGG + Intronic
1133876821 16:9742821-9742843 CTTCAGTTTCTCCAGCTCCTGGG - Intergenic
1136642418 16:31578037-31578059 CTGCGGTTTTTCCAGGTGCAGGG - Intergenic
1138080134 16:54082752-54082774 ATTCAGTTCATCCAGGTTCAAGG + Intronic
1139546480 16:67652276-67652298 CTTCCAATTCCCCAGGCTCAAGG - Exonic
1139977917 16:70829624-70829646 CTTGCGGTTCTCCAAGTTCATGG + Exonic
1140628085 16:76818790-76818812 TTTCCTTCTCTCCAGGTTCTTGG + Intergenic
1142377124 16:89711927-89711949 CTCCCGTTCCTCCGGGGTCAGGG + Exonic
1144132961 17:12265830-12265852 CCTCCATTTCTTCAGGTCCATGG - Intergenic
1147336340 17:39728784-39728806 CATCCAGTTCTCCAGCTTCAGGG + Intronic
1147969945 17:44213873-44213895 CTTCTCTTTCTCCAGGATCCTGG + Intronic
1149057962 17:52387895-52387917 CTGCAGTTTTTCCAGGTTCAGGG - Intergenic
1149131270 17:53304968-53304990 CTGCAGTTTTTCCAGGTGCATGG + Intergenic
1149386291 17:56146270-56146292 CTGCAGTTTTTCCAGGTGCATGG + Intronic
1150581372 17:66476846-66476868 CTTCTCTTTCTCCAGATTGAAGG - Intronic
1151507860 17:74541285-74541307 CTTCCATTTCTCCAGGAGCCTGG - Exonic
1153388872 18:4532648-4532670 CTGCAGTTTTTCCAGGTGCACGG + Intergenic
1153694550 18:7627069-7627091 CTTCCTCTTCTCGAGGTTCTGGG + Intronic
1155618642 18:27750198-27750220 CGTCTGTTTCCTCAGGTTCACGG + Intergenic
1157214552 18:45771756-45771778 CTTCCGTTCCTCCAGGCACGTGG - Intergenic
1157701180 18:49762345-49762367 CTTCCGGGTCTCCAGGTACCTGG - Intergenic
1159962368 18:74565738-74565760 CTGCGGTTTTTCCAGGTGCACGG + Intronic
1161266927 19:3368401-3368423 CCTCAGTTTCTCCAGGAACAGGG + Intronic
1162000307 19:7740518-7740540 CTTTCGTTTCTCCTTCTTCAGGG - Exonic
1162045618 19:7998293-7998315 CTTCTGTCTCTCGAGGTGCAAGG + Intronic
1165042137 19:33076162-33076184 CCTCAACTTCTCCAGGTTCAGGG - Intergenic
1167503203 19:49858601-49858623 CTTCAGTGTCTCCAGGTCCTTGG - Exonic
1167686065 19:50957622-50957644 CTTCCTTTTCTCCAGGCCCTCGG + Intergenic
1167844334 19:52148774-52148796 CAACCTTGTCTCCAGGTTCAAGG + Intergenic
925326211 2:3023925-3023947 CTTCCCTCTCTCCATCTTCAAGG - Intergenic
926158371 2:10470718-10470740 CTTCAGTGTCTCCAGGTCAAGGG + Intergenic
927554825 2:24024080-24024102 CTGATGTTTCTCCAGGTTCTCGG + Exonic
930524782 2:52514446-52514468 ATTCCTTTTCTCCAGGTATAGGG - Intergenic
932305100 2:70696329-70696351 CTCCCCTTTGGCCAGGTTCAGGG + Exonic
935075515 2:99739402-99739424 TTTCCATTTCTACAGCTTCATGG + Intronic
936375360 2:111936775-111936797 TATCCGTTTGTCCAGGTTCCAGG + Intronic
937042613 2:118833949-118833971 CTTCCTTTTCTCCGGGACCACGG - Intergenic
937208837 2:120254034-120254056 CTTCTATTGCTCCAGGTTTAAGG - Intronic
937885201 2:126894847-126894869 TTTCCATTTCTCCAGGGCCATGG + Intergenic
939835613 2:147125831-147125853 CTACAGTTTTTCCAGGCTCACGG - Intergenic
941496572 2:166212132-166212154 CTTCAGTATCTACAGGGTCATGG + Intronic
943603049 2:189943640-189943662 CTGCAGCTTTTCCAGGTTCAGGG - Intronic
945981596 2:216316744-216316766 CTTCTGATTCTGCAGGTCCAAGG + Intronic
946535044 2:220618256-220618278 CTTCCTTTTCTCCAGGTATCAGG - Intergenic
947008401 2:225538134-225538156 CTGCAGTTTTTCCAGGTGCATGG + Intronic
948360111 2:237413915-237413937 CTTCTGTTTTTCCAGGTTTGGGG - Intronic
1169921194 20:10735811-10735833 CTTCCCTTTCTCTAGGCACATGG - Intergenic
1173151255 20:40568176-40568198 CTTGCTTTTCTCCAGGTCCTTGG - Intergenic
1173622506 20:44447612-44447634 CTTCTGTTTCACCAAGTCCATGG + Intergenic
1174466992 20:50725279-50725301 CTTGTGTTTCTGCAGGTTTAGGG - Intergenic
1174787152 20:53443835-53443857 CTTCTGGGTCTCCAGCTTCATGG - Intronic
1175162965 20:57022386-57022408 CTCCCTTCTCTCCAGCTTCAGGG + Intergenic
1175333048 20:58177759-58177781 CTTTGGTTTCTCCAGGTGTAGGG - Intergenic
1175364861 20:58446009-58446031 CTTCCACTTCTCCAGTTTCAAGG - Exonic
1175410237 20:58762960-58762982 CTTCCTTCTCTTCGGGTTCATGG + Intergenic
1175411061 20:58769360-58769382 CTGCCGTGTCTCCATGCTCAGGG + Intergenic
1175695186 20:61097905-61097927 CCTCTGTTTCTCCAGGGTGAAGG - Intergenic
1176358662 21:5974058-5974080 CTTCGGCTTTTCCAGGTGCACGG - Intergenic
1177656236 21:24020534-24020556 CTGCAGCTTCTCCAGGTTCACGG - Intergenic
1177839330 21:26218524-26218546 CTGCGGTTTTTCCAGGTGCATGG - Intergenic
1177977635 21:27871387-27871409 CTGCAGTTTTTCCAGGTGCATGG - Intergenic
1179764856 21:43564492-43564514 CTTCGGCTTTTCCAGGTGCACGG + Intronic
1181493436 22:23274944-23274966 CTTCTCTTTCTTCTGGTTCATGG + Intronic
1181802575 22:25357291-25357313 CTTCCCTTCCTGCAGGTCCAGGG + Exonic
1184762266 22:46551334-46551356 CTGCCGTCTCTCCAGTTTCTGGG + Intergenic
949500883 3:4679059-4679081 CTGCCGTTTCTCCCTGCTCAAGG - Intronic
952129987 3:30350318-30350340 CTTCAGTTTCTCCAGCTCCTGGG + Intergenic
953734091 3:45476453-45476475 CTTTCCTATCACCAGGTTCATGG + Exonic
954576892 3:51681230-51681252 CTGCCTTTTCTCCAGGTGGAGGG + Intronic
955294423 3:57722166-57722188 ATTCCTTTTCCCCAGTTTCAAGG + Intergenic
957041269 3:75337239-75337261 CTTCCCCTCCTCCTGGTTCAGGG - Intergenic
957597176 3:82281963-82281985 CTTCCTATGCTCCAGGTTTAGGG - Intergenic
960893920 3:122481008-122481030 CTTCAGTTTCTCCACCTTCTTGG - Intronic
961046077 3:123708894-123708916 CTTCCCCTCCTCCTGGTTCAGGG - Exonic
962007290 3:131361616-131361638 CTAGCCTTTCTCCAGGTTCAGGG + Intergenic
962009657 3:131381332-131381354 CCAGCCTTTCTCCAGGTTCAGGG + Intergenic
968050093 3:195648264-195648286 CTGCCGGGTCTCCAGGTGCACGG - Intergenic
968304014 3:197637577-197637599 CTGCCGGGTCTCCAGGTGCACGG + Intergenic
970377040 4:15469182-15469204 AATCAGTTTCTCCAGGATCAAGG + Intergenic
970547830 4:17147755-17147777 CCTCCGTTCCTCCAGGGCCATGG - Intergenic
971192336 4:24439479-24439501 CTTCACTTCTTCCAGGTTCAAGG + Intergenic
971673739 4:29596663-29596685 AATCCATTTCTCCAGGTTAAGGG + Intergenic
974468241 4:62285804-62285826 CTCCCTTTTCTCCAGGCTCAAGG + Intergenic
976042681 4:80906369-80906391 CTGCAGTTTTTCCAGGTGCATGG + Intronic
977692008 4:99923049-99923071 CATCTGTTGCTCCAGGTGCATGG + Exonic
979303818 4:119119399-119119421 ATTCAGTTTCCCCAAGTTCAGGG + Intergenic
980324518 4:131324317-131324339 CTACAGCTTCTCCAGGTGCACGG - Intergenic
982112944 4:152072820-152072842 CTTCCTTTTCTGCAGGGTCACGG - Intergenic
987354880 5:17054756-17054778 CTTTAGTTTCTCCAGAGTCAAGG + Intergenic
988668896 5:33360090-33360112 CTGCAGCTTTTCCAGGTTCATGG + Intergenic
989622306 5:43396850-43396872 CTTCAGTCTCTCCTGGTCCACGG - Intronic
990526122 5:56629268-56629290 CTGCAGCTTTTCCAGGTTCACGG - Intergenic
991025999 5:62030472-62030494 ATTCAGTTTCTCCAGGTTATTGG + Intergenic
991670404 5:69041571-69041593 CTTTCTTCTCTCCATGTTCAAGG - Intergenic
993946563 5:94122758-94122780 CTGCAGTTTATCCAGGTGCAAGG + Intergenic
995011342 5:107260025-107260047 CTGCAGCTTTTCCAGGTTCATGG + Intergenic
995509243 5:112891719-112891741 CTTTCGTTTCTCCTTCTTCAGGG - Exonic
995590941 5:113699154-113699176 CTGCAGTTTTTCCAGGTGCATGG + Intergenic
997071125 5:130623376-130623398 CTACGGTATCTCCATGTTCAGGG - Intergenic
997775656 5:136602030-136602052 CTGCAGTTTTTCCAGGTGCATGG - Intergenic
998278664 5:140783435-140783457 CTGCAGCTTCTCCAGGCTCAGGG - Intergenic
998859263 5:146426737-146426759 CTTCTGATTACCCAGGTTCAGGG + Intergenic
1000787638 5:165565761-165565783 CTTCATTTTCTCCAGCTTCAGGG + Intergenic
1002358532 5:178650896-178650918 CTGCTGCTGCTCCAGGTTCAAGG + Intergenic
1002963130 6:1936371-1936393 CTTCACTTTCCCTAGGTTCATGG - Intronic
1004348770 6:14872597-14872619 ATTCCCTTCCTCCAGGTACAAGG + Intergenic
1004937709 6:20524385-20524407 CTGCCTTTTCTGTAGGTTCAGGG + Intergenic
1004946517 6:20619671-20619693 CTTAATTTTCTCCAGTTTCATGG + Intronic
1005579668 6:27221718-27221740 CTTTCTTTTCTCCACTTTCATGG + Intergenic
1006029701 6:31170237-31170259 CTTCTCCTTCTCCAGCTTCACGG + Exonic
1007373810 6:41443215-41443237 CTCCTGTTTCTCCAGGTGCTGGG - Intergenic
1007934531 6:45721299-45721321 GTTCCCTTTCTCCATTTTCAAGG - Intergenic
1008215767 6:48786612-48786634 CATCTGTTTCTCCAGGTTTGGGG - Intergenic
1008536193 6:52508135-52508157 CTTCCTTTTCTCCAGAAGCATGG - Intronic
1009040542 6:58171051-58171073 TTTCCTTCTCTCCAGGATCATGG - Intergenic
1009216399 6:60925581-60925603 TTTCCTTCTCTCCAGGATCATGG - Intergenic
1011902790 6:92321341-92321363 GTTCCTTTCCTCCAGGTACAGGG - Intergenic
1013449590 6:110266535-110266557 CCTCCTTTCCTCCAGGATCATGG + Intronic
1016646623 6:146416979-146417001 CTTCCCTCTCTCCAGGATCTCGG + Intronic
1016662789 6:146600318-146600340 CTTCCATTCCTCTAGGTCCAAGG + Intronic
1016964411 6:149705393-149705415 CTACCATTTCTCCATGATCAAGG + Intronic
1017175617 6:151501815-151501837 CTTACTTTTTTCCATGTTCAAGG + Intronic
1018489745 6:164279803-164279825 CTGCAGCTTTTCCAGGTTCATGG - Intergenic
1019319055 7:406948-406970 CTACCGTCTCTCCAAGATCAGGG - Intergenic
1019790100 7:3006378-3006400 CATCAGCTTCTCCAGGTTGATGG - Intronic
1020062242 7:5161111-5161133 TTTCCTTTTCTCCAGGTGGAAGG - Intergenic
1020165903 7:5807566-5807588 TTTCCTTTTCTCCAGGTGGAAGG + Intergenic
1020439081 7:8198229-8198251 ATTCTCTTTCTCCAGGTTGAAGG + Intronic
1021911726 7:25392166-25392188 ATTCCCCTTCTCCAGGGTCACGG - Intergenic
1022088103 7:27088243-27088265 GTTCCGTTTCTCCTGCTTCCTGG - Intergenic
1022394453 7:29973472-29973494 GTTCCTTTTCTCCAGTTGCAGGG - Intronic
1022542856 7:31154322-31154344 CTGCAGCTTTTCCAGGTTCACGG + Intergenic
1025186142 7:56860411-56860433 CTTCCTTTTCTCCATGCCCACGG - Intergenic
1025685779 7:63716499-63716521 CTTCCTTTTCTCCATGCCCACGG + Intergenic
1026424062 7:70271988-70272010 CGTCCTAGTCTCCAGGTTCAAGG - Intronic
1027413203 7:77944445-77944467 CTTCCCTTACTACAGGTTTAGGG + Intronic
1028949799 7:96621534-96621556 CTTGTGTTTCTCCAACTTCAGGG + Intronic
1031774797 7:125894562-125894584 ATTCCTTTTCTCCAGGTACAGGG - Intergenic
1035180365 7:157085004-157085026 CTACTGTTTTTCCAGGTACATGG - Intergenic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1038143868 8:24875710-24875732 CTTCCTCCTCTCCAGGCTCAGGG - Intergenic
1038803407 8:30769447-30769469 CTTCCCTTTCTCCAGCTCCCGGG - Intergenic
1039815684 8:41092603-41092625 CTTGCCTTCCTCTAGGTTCAGGG + Intergenic
1044320551 8:90796139-90796161 CTTCCCCTTATCCAGTTTCAGGG + Intronic
1044725944 8:95194397-95194419 CTTCAGGCTCTCCAGGTTCAGGG - Intergenic
1044887398 8:96794005-96794027 CTGCAGTTTTTCCAGGTGCACGG + Intronic
1045993675 8:108339010-108339032 CTGCAGCTTTTCCAGGTTCATGG + Intronic
1047697318 8:127416228-127416250 CTTCTCCTTCTCCAGCTTCACGG - Exonic
1049259199 8:141629699-141629721 CTGCCCTGTCTCCAGGTTGAGGG + Intergenic
1050071201 9:1816336-1816358 GTTTCTTTTCTCCAGTTTCATGG - Intergenic
1052442733 9:28518563-28518585 GTTTCTTTTCTCCTGGTTCAAGG - Intronic
1053121008 9:35547538-35547560 CTTCCCTTCCTCCACTTTCAGGG - Exonic
1055080620 9:72264986-72265008 TTTCCTTTTCTCCAGGTATAGGG + Intergenic
1056508438 9:87280018-87280040 CTGCCCTCTCTCCAGGTTCTGGG - Intergenic
1057033300 9:91795751-91795773 CTCCTGTTTCTCCAGGCTAAAGG + Intronic
1058309773 9:103485753-103485775 CTGCAGCTTTTCCAGGTTCATGG - Intergenic
1187061493 X:15790954-15790976 CTTTCGTTTCTCCTTCTTCAGGG - Exonic
1188457244 X:30380413-30380435 CTTTCGATTTTACAGGTTCATGG + Intergenic
1191760932 X:64647406-64647428 CTGCAGCTTTTCCAGGTTCATGG - Intergenic
1193850535 X:86531824-86531846 CTGCGGCTTTTCCAGGTTCATGG - Intronic
1194578438 X:95641714-95641736 CTTCAGCTTTTCCAGGTGCACGG + Intergenic
1195171542 X:102273391-102273413 GGACCGTTTCTCCAGGTTCATGG + Intergenic
1195187318 X:102413708-102413730 GGACCGTTTCTCCAGGTTCATGG - Intronic
1196278603 X:113797010-113797032 CTTCAGCTTTTCCAGGTGCATGG - Intergenic
1196641151 X:118062857-118062879 TTTCCTTTTCACCAGATTCAGGG - Intronic
1199020367 X:142870847-142870869 CTGCAGCTTTTCCAGGTTCAGGG - Intergenic
1199112858 X:143955556-143955578 CTTCAGCTTTTCCAGGTGCATGG - Intergenic
1200252630 X:154561840-154561862 CTACCCATTCTCAAGGTTCAGGG - Intronic
1200265137 X:154642576-154642598 CTACCCATTCTCAAGGTTCAGGG + Intergenic
1200445449 Y:3256007-3256029 CTGCAGCTTTTCCAGGTTCATGG + Intergenic