ID: 903945400

View in Genome Browser
Species Human (GRCh38)
Location 1:26959710-26959732
Sequence CCTGGGGACCCTCGGAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 377}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903945400_903945419 27 Left 903945400 1:26959710-26959732 CCCCTCCTCCGAGGGTCCCCAGG 0: 1
1: 0
2: 3
3: 31
4: 377
Right 903945419 1:26959760-26959782 CCCAGCCCAGTGCCAAGCCTCGG 0: 1
1: 0
2: 3
3: 49
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903945400 Original CRISPR CCTGGGGACCCTCGGAGGAG GGG (reversed) Intronic
900130224 1:1084223-1084245 CCTGGGGACCCGGGCAGGGGTGG + Intronic
900174686 1:1286509-1286531 CCTCGGGAGCCTGGGAGGAGAGG + Intronic
900437762 1:2639679-2639701 GCTGGGGAACCCCGGAAGAGGGG + Intronic
900507045 1:3034907-3034929 CCTGGAGATCCTGGGAGGGGAGG + Intergenic
900552574 1:3264211-3264233 CCTGGGGCCTCTCTGCGGAGGGG + Intronic
900614955 1:3561294-3561316 CCTGGGGACCCAAGCTGGAGAGG + Intronic
900670520 1:3851009-3851031 CATGGGGAGTCTGGGAGGAGAGG + Intronic
900945788 1:5830726-5830748 CCTGGAGACCCTCAGGGGAGAGG - Intergenic
901119422 1:6878663-6878685 GCTGGGGATCCTTGGGGGAGCGG - Intronic
901528149 1:9836858-9836880 CCGGGGGAGGCTCAGAGGAGGGG - Intergenic
901762519 1:11479948-11479970 CCTGGGGACCCTCGCGCGCGCGG - Intronic
901851732 1:12020043-12020065 CCTGAGGATCCTTGGAGGTGGGG + Intronic
901941648 1:12666743-12666765 CCTGGGGCCCCGAGGAGGAAGGG + Exonic
902640712 1:17764514-17764536 CCTGGGTACCCTTGGAGGTGGGG + Intronic
903229194 1:21911583-21911605 CCTGGGAAGCCTGGGTGGAGAGG + Intronic
903762913 1:25711714-25711736 GCTGCGCACCCACGGAGGAGGGG - Intronic
903829832 1:26168201-26168223 CTTAGGGACCATGGGAGGAGTGG - Intergenic
903945400 1:26959710-26959732 CCTGGGGACCCTCGGAGGAGGGG - Intronic
904207612 1:28864988-28865010 CCTGGGGAGCCTGGGGGGAAAGG - Intergenic
904469665 1:30728563-30728585 GCTGGGGACCTTCTGAGGAACGG - Intergenic
904620604 1:31772896-31772918 CCCGGGGTCCCTGGGAGGAAAGG - Intergenic
905289347 1:36910958-36910980 ACTGGGGAGACTCAGAGGAGAGG + Intronic
905295056 1:36948960-36948982 CCTGGGGACTCCCTGAGCAGGGG + Intronic
905797942 1:40826013-40826035 CCTGGGGTCCCTGGGAGAAAGGG - Intronic
905897908 1:41560710-41560732 CCTGGAGTCTCTTGGAGGAGGGG - Intronic
911696392 1:100895049-100895071 CCTGGGCACCCGCGGTGGATGGG - Exonic
912717141 1:111990468-111990490 GCTGGGGACCCACGGAGAGGTGG + Intergenic
913528122 1:119712837-119712859 CCTGGGAGCCTTCGGAGGAAAGG + Intronic
915363549 1:155300777-155300799 CCTGGGGAGACTCAGAGGATGGG - Intronic
915516470 1:156415708-156415730 CCTGGGGACCCTCTGGGTAAAGG - Intronic
915899226 1:159834422-159834444 CCTGGGGACTCTTGGGGCAGGGG - Intronic
919878901 1:201889357-201889379 GCTGGGGACCGCCGGGGGAGTGG + Intronic
920200907 1:204259252-204259274 CCTGAAGACCTTCGGAGGTGAGG - Exonic
920526669 1:206672127-206672149 CCTGGGGACCTGAGGAGAAGCGG - Intronic
920541570 1:206782724-206782746 CCTGGGGCCCCTTGGAGAAGGGG - Intergenic
920551555 1:206865762-206865784 CCCGTGGACACTTGGAGGAGGGG + Intronic
921055000 1:211536858-211536880 CCTGCAGCCCATCGGAGGAGGGG - Intergenic
922535049 1:226373432-226373454 CCTGGGGGCCTTCAGAGCAGAGG - Intronic
1063452782 10:6162825-6162847 CCCAGGGATCCTTGGAGGAGTGG - Intronic
1065502000 10:26391960-26391982 CCTGGGGACCCCGGGAGGCCGGG + Intergenic
1067082470 10:43219362-43219384 CCTAGGGTGCCACGGAGGAGGGG + Intronic
1067655499 10:48188544-48188566 GCTGGGGACTCTCAGAGGACAGG - Intronic
1069770970 10:70899686-70899708 GCTGGGGACCCTCGGAGCGACGG - Intergenic
1070057551 10:72950236-72950258 GCTGGGGACTCAAGGAGGAGGGG - Intronic
1070569608 10:77631234-77631256 CCCAGGGACCCTCGGAGGCAAGG - Intronic
1070798488 10:79230959-79230981 CATGAGTGCCCTCGGAGGAGGGG - Intronic
1071690821 10:87818068-87818090 CCTGGGAACCCCCGGAGGAAAGG - Exonic
1073184483 10:101607512-101607534 AGTGGGGAACCTGGGAGGAGAGG + Intronic
1074192223 10:111148001-111148023 CCTGGGGACAGGAGGAGGAGGGG + Intergenic
1075287840 10:121202535-121202557 CCTGGGGCCCCTCTGGGGAGCGG - Intergenic
1075463085 10:122631733-122631755 CCTGGGGACCCTCGCCGAGGGGG + Intronic
1075587504 10:123668141-123668163 CCAGGGGAGCCTCGGGGCAGAGG + Intronic
1076062964 10:127427837-127427859 CCTGGTGTCCCTCAGATGAGAGG + Intronic
1076855514 10:133113851-133113873 CCTGTGGACCCTCGGACGTCAGG + Intronic
1076882816 10:133247836-133247858 CCTCGTGAGCCTGGGAGGAGCGG + Intergenic
1076907838 10:133372426-133372448 CCTTAGGACCCTCTGAGGGGTGG + Intronic
1077053793 11:580189-580211 CCAGGCGACTCTCGGAGGAAAGG - Intronic
1077089650 11:772630-772652 CCAGGGAAACCTGGGAGGAGGGG - Intronic
1079169706 11:18081151-18081173 ACTGGGGACCACAGGAGGAGGGG - Intronic
1079404436 11:20132254-20132276 CCAGGGGACCCGCGAAGGTGGGG - Intergenic
1081305773 11:41510278-41510300 CCTAGGGACCCTCGCGGGAGTGG + Intergenic
1081775214 11:45671665-45671687 CCTGGGTTCCCTGGGAGGGGAGG + Intergenic
1083274096 11:61587276-61587298 CCTGGGCTCCCTGAGAGGAGCGG - Intergenic
1083876446 11:65526493-65526515 CCTGAGGACCCTGGGGGCAGAGG - Intronic
1083995319 11:66268846-66268868 CCTGGGGCCCCTGGGGGGAGGGG - Intronic
1084117636 11:67051297-67051319 CCTTGGGAAGCTCAGAGGAGGGG + Intergenic
1084488875 11:69467327-69467349 GCTGGGGACCTGGGGAGGAGTGG + Intergenic
1084517053 11:69642857-69642879 ACTGGGGACGCGCGGGGGAGGGG + Intronic
1084518489 11:69648955-69648977 CCCGGGGACACTGGGAGTAGCGG + Intronic
1084648349 11:70473786-70473808 CCGGGGGACCCTCGGGAGGGTGG + Intronic
1084742933 11:71150752-71150774 CCTGGGGACTCTCGGCTGCGTGG + Intronic
1084945896 11:72638280-72638302 ACTGGGGTCCATCGGATGAGGGG - Intronic
1085316022 11:75545338-75545360 CCTGGGGACCCTCTGAGACATGG - Intergenic
1085504419 11:77048935-77048957 CCTGTGGACTCTGGGAGTAGTGG - Intergenic
1088933998 11:114380123-114380145 CGTGGAGCCCCTGGGAGGAGGGG + Intergenic
1091037549 11:132247115-132247137 CATGGGGAGCCCAGGAGGAGGGG - Intronic
1092391562 12:8084549-8084571 ACTGGGGCCTCTCGGGGGAGGGG - Intronic
1093094076 12:14952708-14952730 CCTGGTGATCCCCGGAGGATGGG + Intronic
1094536022 12:31323914-31323936 CCCGAGGGCCCTGGGAGGAGCGG - Intronic
1094872421 12:34605757-34605779 CCCTGGGACCCTCGCATGAGTGG - Intergenic
1095829696 12:46570731-46570753 ACTGGGGCCTGTCGGAGGAGCGG - Intergenic
1095986225 12:48001535-48001557 CATGAGGACCCAGGGAGGAGAGG + Intronic
1096539483 12:52297023-52297045 CCTGTGGGCCCTTGCAGGAGTGG - Intronic
1096581988 12:52591628-52591650 CCTGGGGACGGTTGGGGGAGGGG + Exonic
1097598529 12:61664212-61664234 CCTGGGGAGGGTTGGAGGAGGGG - Intergenic
1097794203 12:63844554-63844576 CCAGGGGATCCCCGGGGGAGAGG - Exonic
1101679944 12:106955579-106955601 CGGGGAGACCCCCGGAGGAGGGG + Intergenic
1102370802 12:112381594-112381616 CCTGGGGGCCCGTGGGGGAGGGG + Intronic
1103261791 12:119594577-119594599 CCTGGGGACCCCCCGGAGAGTGG - Intronic
1104399007 12:128460343-128460365 CCTGGCTACCCTGTGAGGAGAGG - Intronic
1105067170 12:133210696-133210718 CCTGGGGACCCTTGGCAGGGGGG - Exonic
1106101646 13:26698543-26698565 CCTTGGCCCCCTCGAAGGAGTGG + Intergenic
1107950168 13:45454300-45454322 CCTGGGCAGCCTCGGAGGAGGGG + Intergenic
1109745250 13:66616167-66616189 TCTTGGGACCCTAAGAGGAGAGG + Intronic
1110278428 13:73664216-73664238 CCTGGGGAGCCCCTGAGCAGAGG - Intergenic
1111429911 13:88136587-88136609 CTTGGGGACCCTCCGGGGTGTGG + Intergenic
1112602297 13:100868665-100868687 CCTGAGGTCCCTCGGGGGTGGGG + Intergenic
1113082434 13:106534027-106534049 CCTCGGGACCCTGGTAGGAATGG - Intronic
1113776197 13:112946924-112946946 CCTGAGGACCCAGGGAGCAGTGG + Intronic
1113841262 13:113363086-113363108 CCTGGGGCGCCCCGGAGGAGGGG + Intronic
1114674722 14:24432316-24432338 GCTGGGCACCCTCGGAGGAGAGG - Exonic
1119175653 14:72566076-72566098 CCATGGGACCCTCTGAAGAGAGG + Intronic
1119182675 14:72615086-72615108 CATGGGGACCCCCTGAAGAGGGG + Intergenic
1119259293 14:73228109-73228131 CCAGGGGGCCCTCCGCGGAGTGG - Intergenic
1119379483 14:74219492-74219514 CCTGGGGATGCTGGGAGGATTGG - Intergenic
1119787000 14:77321225-77321247 CCTGGAGACCCTGGGGGGCGGGG + Intronic
1122278504 14:100607839-100607861 GCTGGGGACCCTCCAAGCAGTGG - Intergenic
1122386418 14:101351277-101351299 CCTGGAGACACTCGGAGGGCAGG + Intergenic
1122718924 14:103711558-103711580 CCTGGGGACTCTGGAAAGAGTGG + Exonic
1122776645 14:104119813-104119835 CCTGGGGACACCAGGAGGACAGG + Intergenic
1122794811 14:104200856-104200878 CCTGGGCACCCTCTGTGGATGGG + Intergenic
1123766097 15:23479796-23479818 TCTTGGGACCCTAAGAGGAGAGG + Intergenic
1124713009 15:32030674-32030696 CCCGGGATCCCACGGAGGAGTGG - Exonic
1128313529 15:66646268-66646290 TTTGGGGACCCTCTGAGGAATGG - Intronic
1129188282 15:73923521-73923543 TCAAGGGACCCTCGGAGGGGTGG - Intergenic
1129753079 15:78079499-78079521 CCTGGGGCCCATCAGAGGTGTGG + Intronic
1130697469 15:86144998-86145020 TCTGGCAACCCTCAGAGGAGAGG - Intronic
1130999563 15:88928726-88928748 CCTTGGGACCCCAAGAGGAGAGG + Intergenic
1131442999 15:92472801-92472823 CCTGGAGAACCTGGGAGCAGGGG - Intronic
1132299198 15:100766032-100766054 CAAGGGGACTCTCGGAGGAGAGG + Intergenic
1132571796 16:647474-647496 CCTGGGTCCCCTCGAAGGATGGG - Exonic
1134638264 16:15809099-15809121 CCTGGGGACCTTGGGAGGACAGG - Intronic
1136366780 16:29812586-29812608 CCTGGGAGCCCAGGGAGGAGGGG + Intronic
1136455877 16:30379316-30379338 CCAGGGGATCCTAGGAGGAAAGG - Intronic
1136517736 16:30778000-30778022 CTTGGGGACCCTGGGAGAGGTGG - Intergenic
1137018052 16:35395198-35395220 CAGGGAGACCCTCAGAGGAGGGG + Intergenic
1137432148 16:48427138-48427160 CCTGTGGACCCTCAGAGGCCTGG + Intronic
1137895164 16:52204330-52204352 CCTGGGGATCCTGAAAGGAGTGG + Intergenic
1140035766 16:71370226-71370248 TCAGGGGGCCCTAGGAGGAGAGG + Intronic
1140470055 16:75208914-75208936 CCAGAGCACCCTCGGAGGAGAGG + Intergenic
1141225142 16:82107857-82107879 CCTGGGGTCCAGTGGAGGAGAGG - Intergenic
1141750266 16:85953674-85953696 TCTGGGGACCCAGTGAGGAGCGG - Intergenic
1142396117 16:89832621-89832643 CCTGGGCACCCTCGGAGCTCAGG + Intronic
1142638563 17:1272014-1272036 CCAGGGGACTCAGGGAGGAGGGG - Intergenic
1142856640 17:2734263-2734285 TCTGGGGAGCCTCGGAGGCTGGG + Intergenic
1143558054 17:7674824-7674846 ACTGGGGTCTCTGGGAGGAGGGG - Intronic
1144676666 17:17166496-17166518 CTTGGGGACACTGGGAGGAGAGG + Intronic
1145157092 17:20550810-20550832 CCTGGGTTCCCTCGGAGCACAGG - Intergenic
1146576256 17:33994449-33994471 CTTAGGGACCCACAGAGGAGTGG - Intronic
1147324400 17:39663410-39663432 CCAGGAGGCCCTGGGAGGAGGGG - Exonic
1147686557 17:42289559-42289581 GGTAGGGACCCTCTGAGGAGGGG - Intronic
1147741643 17:42673802-42673824 CCGGGAGCCCCGCGGAGGAGGGG - Exonic
1148152705 17:45405668-45405690 CCAGGGGACCCGCGGGTGAGGGG - Exonic
1149932347 17:60769067-60769089 ACTGGAGACCCCAGGAGGAGTGG + Intronic
1151841776 17:76624020-76624042 CCTGGGGTGCCGCGGAGGACAGG + Intergenic
1152614178 17:81330341-81330363 CCTGGGTAGCCTGGGAGGAATGG - Exonic
1152704213 17:81834438-81834460 CCTGGGGACCCACTGAGGCCCGG + Intronic
1152875201 17:82782468-82782490 CCTGTGGTCCCTCTGAGGAGCGG + Intronic
1153424005 18:4943383-4943405 CCTGGGGAGCCTGGGAGAAATGG - Intergenic
1153489028 18:5629599-5629621 CCTGGGGAAACGCGGGGGAGGGG - Intronic
1156468701 18:37363999-37364021 CCCAGGGGCCCTCTGAGGAGAGG + Intronic
1157977137 18:52340258-52340280 CGAGGGGACCCAGGGAGGAGAGG - Exonic
1158682973 18:59585232-59585254 CCTGGGTACCTTGGGAGTAGAGG - Intronic
1160317076 18:77858432-77858454 CCTGGGGACCCTCTGGGATGGGG + Intergenic
1160844896 19:1161894-1161916 CCTGGGGAGCCGCGGGGGGGGGG + Intronic
1160978465 19:1805847-1805869 GCTGGGGACCCTGGGGGGTGGGG - Intronic
1161412286 19:4123539-4123561 GCAGGGGGCCCTCGGAGGACGGG - Intronic
1161439131 19:4280377-4280399 CCTGGGGAGACTGGGTGGAGGGG + Intronic
1162328096 19:10010477-10010499 CCCGCGGACCCTGAGAGGAGCGG - Intergenic
1163606800 19:18280262-18280284 CCTGGGCACCCTCGGGGGGGGGG + Exonic
1164146052 19:22513227-22513249 GCTGGGGAGCCTCGGGGAAGGGG - Intronic
1164615323 19:29664067-29664089 CCTGGGCACCCTGAGAGGGGTGG - Intergenic
1165136604 19:33673673-33673695 CCTGGGCATGCTGGGAGGAGGGG + Intronic
1165316539 19:35059805-35059827 ACTGGGGGCCCTCGGAGGGGTGG + Intronic
1166720170 19:44991989-44992011 CCGGGGGCCCCTCTGAGGACAGG + Intronic
1166794802 19:45419916-45419938 CCTGGGGTCTCAGGGAGGAGGGG - Intronic
1166794818 19:45419954-45419976 CCTGGGGTCTCAGGGAGGAGGGG - Intronic
1167306572 19:48713405-48713427 CGTGGGGTCCCTGGGAGAAGGGG + Exonic
1167456686 19:49599894-49599916 ACTGGGGAGCCCCGGAAGAGGGG - Exonic
1167509165 19:49887341-49887363 GCTGGGGAACCTCGGAGGTGAGG - Intronic
1167658313 19:50780674-50780696 TCTGGGGACCCACAGAGGACAGG + Intergenic
1168277063 19:55284308-55284330 CCTGGGGACCCCCGGAGAGGTGG + Exonic
1168292908 19:55365781-55365803 CCTGGGTCCCCGAGGAGGAGGGG - Exonic
1168720376 19:58551502-58551524 ACTGGGGTCCCTGGGAGGATGGG - Intergenic
925287804 2:2727252-2727274 CCTGGAGACCCTCGGATGGGAGG + Intergenic
926152817 2:10434343-10434365 CCTGGGGACCTCCGAAGGTGGGG + Intergenic
926585033 2:14676069-14676091 CCTGGGGAAACTGGGAGGAGTGG + Intergenic
927209157 2:20628076-20628098 CCAGGAGATCTTCGGAGGAGGGG - Intronic
927784003 2:25959812-25959834 TCTGGGGAACCTGGCAGGAGGGG + Intronic
931180807 2:59898739-59898761 CCTGAGGGGCCTAGGAGGAGGGG - Intergenic
931323284 2:61193699-61193721 CCTGGGGACCCTAGGGGATGTGG - Intronic
932135240 2:69223121-69223143 TCTGGGGACCTTCTGAGTAGAGG - Intronic
932767096 2:74477616-74477638 GCTGGGAAGCCTCAGAGGAGTGG - Intronic
932770653 2:74499153-74499175 CCTAGGGACTAACGGAGGAGAGG + Intronic
934953134 2:98592929-98592951 CCTGGGGCCCCTGGCAGGGGAGG - Intronic
936515406 2:113178336-113178358 CCTGAGGAGCCTGGGAGGGGTGG - Intronic
937241345 2:120464547-120464569 CCTGCGAAGCCTCGGAGGAAAGG + Intergenic
937357419 2:121206843-121206865 AATGGGGACCCTGGGAGGAGAGG - Intergenic
937707934 2:124942826-124942848 CCTGGGGACCCCCATAGCAGAGG + Intergenic
938383434 2:130849060-130849082 GATGGGGACCCAAGGAGGAGGGG - Intronic
938465385 2:131521671-131521693 CCTGTGGACACTGGGGGGAGGGG - Intergenic
938618610 2:133025980-133026002 CTTGGGGCCTGTCGGAGGAGAGG - Intronic
946027311 2:216679633-216679655 CCTGGGGAACCTAGGAGGAGGGG + Intronic
948853995 2:240721611-240721633 CCTGGGGTCCATGGGAGGTGGGG - Intronic
1168976039 20:1966529-1966551 CCTGGGGAGCCCTGGAAGAGAGG - Intergenic
1169119122 20:3084794-3084816 CCTGGGGAGCCACTGGGGAGGGG - Intergenic
1171426241 20:25050542-25050564 CCTGGAGCCCCCCGGAAGAGTGG + Intronic
1171464757 20:25319709-25319731 TTTGGGGTCCCTCCGAGGAGGGG - Intronic
1172393145 20:34580239-34580261 CTTGGGGCCCCTCGGCAGAGTGG - Intronic
1172672222 20:36642405-36642427 CCTGGGGAGGCTCCCAGGAGAGG - Intronic
1172778069 20:37419762-37419784 GCTGGGGGCCCTGGGAGGGGGGG + Intergenic
1173021816 20:39273676-39273698 GCTGGGGAACCTCTGGGGAGTGG + Intergenic
1174070275 20:47894818-47894840 GCTGGCGACCCAGGGAGGAGAGG + Intergenic
1174070294 20:47894916-47894938 GCTGGCGACCCAGGGAGGAGAGG + Intergenic
1174070348 20:47895207-47895229 GCTGGCGACCCAGGGAGGAGAGG + Intergenic
1174070368 20:47895305-47895327 GCTGGCGACCCAGGGAGGAGAGG + Intergenic
1174070405 20:47895501-47895523 ACTGGCGACCCAGGGAGGAGAGG + Intergenic
1174070423 20:47895599-47895621 GCTGGCGACCCAGGGAGGAGAGG + Intergenic
1174070475 20:47895893-47895915 GCTGGCGACCCAGGGAGGAGAGG + Intergenic
1174148939 20:48472564-48472586 GCTGGAGACCCGGGGAGGAGCGG - Intergenic
1174148948 20:48472617-48472639 GCTGGAGACGCTGGGAGGAGCGG - Intergenic
1174148958 20:48472670-48472692 GCTGGAGACCCGGGGAGGAGCGG - Intergenic
1174153728 20:48503662-48503684 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174153804 20:48504055-48504077 ACTGGCGACCCAGGGAGGAGAGG - Intergenic
1174153825 20:48504153-48504175 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174153845 20:48504251-48504273 GCTGGTGACCCAGGGAGGAGAGG - Intergenic
1174153917 20:48504643-48504665 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174153934 20:48504741-48504763 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174153951 20:48504839-48504861 GCTGGTGACCCAGGGAGGAGAGG - Intergenic
1174153970 20:48504937-48504959 TCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174154042 20:48505328-48505350 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174154062 20:48505426-48505448 GCTGGTGACCCAGGGAGGAGAGG - Intergenic
1174154095 20:48505621-48505643 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174154151 20:48505915-48505937 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174154191 20:48506111-48506133 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174154212 20:48506209-48506231 GCTGGTGACCCAGGGAGGAGAGG - Intergenic
1174154316 20:48506797-48506819 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174154395 20:48507192-48507214 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174154413 20:48507290-48507312 GCTGGAGACCCCGGGAGGAGAGG - Intergenic
1174154431 20:48507388-48507410 TCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174154465 20:48507583-48507605 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174154525 20:48507879-48507901 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174154544 20:48507977-48507999 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174154634 20:48508467-48508489 TCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174154653 20:48508565-48508587 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174154686 20:48508761-48508783 TCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174154776 20:48509250-48509272 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174154794 20:48509348-48509370 GCTGGTGACCCAGGGAGGAGAGG - Intergenic
1174154816 20:48509446-48509468 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174154836 20:48509544-48509566 GCTGGTGACCCAGGGAGGAGAGG - Intergenic
1174154908 20:48509936-48509958 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174154943 20:48510132-48510154 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174154963 20:48510230-48510252 GCTGGTGACCCAGGGAGGAGAGG - Intergenic
1174154981 20:48510328-48510350 TCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174155033 20:48510621-48510643 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174155053 20:48510719-48510741 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174155071 20:48510817-48510839 GCTGGTGACCCAGGGAGGAGAGG - Intergenic
1174155144 20:48511209-48511231 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174155163 20:48511307-48511329 GCTGGAGACCCCGGGAGGAGAGG - Intergenic
1174155181 20:48511405-48511427 TCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174155215 20:48511600-48511622 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174155312 20:48512093-48512115 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174155331 20:48512191-48512213 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174155348 20:48512289-48512311 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174155370 20:48512387-48512409 GCTGGTGACCCAGGGAGGAGAGG - Intergenic
1174155388 20:48512485-48512507 TCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174155459 20:48512876-48512898 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174155549 20:48513366-48513388 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174155586 20:48513562-48513584 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174155606 20:48513660-48513682 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174155623 20:48513758-48513780 GCTGGTGACCCAGGGAGGAGAGG - Intergenic
1174155645 20:48513856-48513878 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174155665 20:48513954-48513976 GCTGGTGACCCAGGGAGGAGAGG - Intergenic
1174155736 20:48514346-48514368 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174155771 20:48514542-48514564 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174155791 20:48514640-48514662 GCTGGTGACCCAGGGAGGAGAGG - Intergenic
1174155809 20:48514734-48514756 TCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174155871 20:48515076-48515098 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174155891 20:48515174-48515196 GCTGGTGACCCAGGGAGGAGAGG - Intergenic
1174155964 20:48515566-48515588 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174155984 20:48515664-48515686 GCTGGAGACCCAGGGAGGAGAGG - Intergenic
1174156001 20:48515762-48515784 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174156053 20:48516056-48516078 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1174156108 20:48516352-48516374 GCTGGCGACCCAGGGAGGAGAGG - Intergenic
1175741129 20:61420430-61420452 CCTGGGGACCCTGTGGGGAGGGG - Intronic
1175919085 20:62441672-62441694 GCTGGTGACCCTGGGAGCAGAGG - Intergenic
1175919165 20:62441972-62441994 CCTTGTGACCCTGAGAGGAGGGG + Intergenic
1176024541 20:62978936-62978958 CGGGGGGACCCTCGGAGGCCGGG + Intergenic
1176048450 20:63104500-63104522 CATGGGGAGCCTCAGAGCAGGGG - Intergenic
1176625588 21:9088472-9088494 TCTGGGCACCCTCAGAGCAGCGG + Intergenic
1179876724 21:44272506-44272528 CCTGGGGCCCCTCTGAGCACAGG + Intergenic
1180592789 22:16955370-16955392 CCTGGGGAACCACGGAGAAAGGG + Intergenic
1180997569 22:19973073-19973095 CTTGGGGAGCCGCGGAGGTGGGG - Intronic
1181310116 22:21939986-21940008 GCTGGGGACCCTGGGGGGTGGGG + Intronic
1181556457 22:23674446-23674468 CCTGGGGAGGCGGGGAGGAGAGG - Intergenic
1182279035 22:29207593-29207615 CCAGGAGACCCTGGGAGGTGAGG - Intronic
1182887349 22:33786609-33786631 CCAGGGGACCCCCTCAGGAGGGG - Intronic
1183195711 22:36352129-36352151 CCTGGGGTCCCTCGGAAGCCAGG + Intronic
1183373233 22:37447566-37447588 CCTGGGGACCCACTGGAGAGAGG + Intergenic
1183427360 22:37746788-37746810 CCAGGGGCCCCAGGGAGGAGCGG + Intronic
1185087911 22:48750482-48750504 CCCGCGCACCCTCGGAGGACGGG + Exonic
1185228475 22:49667428-49667450 CCTGGGGAGCCGGGGTGGAGGGG - Intergenic
949159248 3:860287-860309 CCTGGAGACCTGAGGAGGAGCGG - Intergenic
949946024 3:9190849-9190871 GCTGGGGACCCTTAGGGGAGGGG + Intronic
952251959 3:31664232-31664254 CCTGGGGATGCGTGGAGGAGAGG + Exonic
952700134 3:36318975-36318997 CCTGGGGAGATTCAGAGGAGAGG + Intergenic
953352136 3:42223489-42223511 CCCGGGGGCCCACAGAGGAGGGG - Exonic
953958409 3:47248364-47248386 CCTGGGGCCCCTGGGAGTTGGGG - Intronic
954391202 3:50269023-50269045 GCGGGGCACCCTCGGAGGGGAGG + Intronic
954404511 3:50337917-50337939 GCTGGGAACCCGCGGTGGAGCGG - Exonic
954706190 3:52481802-52481824 CCTGGGGACACTCTGCAGAGGGG + Intronic
955937177 3:64113088-64113110 CTTGGGAACCCTAGAAGGAGGGG + Intronic
961202456 3:125055740-125055762 CCTGGCGCCCCTCGCGGGAGCGG - Exonic
962403426 3:135080486-135080508 CCTGGGGACACTTGGGGGTGGGG + Intronic
962978563 3:140467563-140467585 CCTGGGGCCCCAGGGAGGAAGGG - Intronic
964658407 3:159093540-159093562 CCTGGGGAGCCTGGCAGGACAGG + Intronic
965000483 3:162946761-162946783 CCTGGGGAGTCTTGGAGAAGGGG + Intergenic
967457236 3:189702541-189702563 CCTTGGGACCCAGGCAGGAGAGG - Intronic
967877784 3:194278524-194278546 CCTGGGCAACCTCAGAGAAGGGG + Intergenic
967982417 3:195073580-195073602 CCTGGAGACCCACGGTAGAGGGG + Intronic
968090511 3:195895805-195895827 CCCGGGATGCCTCGGAGGAGGGG - Intronic
968744848 4:2354271-2354293 CCTGGGGACCCTTGAATCAGGGG - Intronic
968959950 4:3738370-3738392 CCTCGCCACCCACGGAGGAGTGG + Intergenic
969492844 4:7509793-7509815 CTTGGGGACCCACTGAGGATAGG + Intronic
972260037 4:37398436-37398458 ACTGGGGCCTGTCGGAGGAGTGG + Intronic
975410469 4:74043032-74043054 ACTGGGGACCCTCTGAGAAATGG - Intergenic
975489874 4:74976457-74976479 GATGGAGACCCTGGGAGGAGGGG + Intronic
983923513 4:173371528-173371550 CCTGGGGCCCCACCGAGGGGCGG - Intronic
985390799 4:189490550-189490572 CCTGCTGACCCTCGGTGGTGTGG + Intergenic
985622261 5:961835-961857 TCTGGGGGCCTTGGGAGGAGTGG - Intergenic
985783517 5:1882602-1882624 CCTGGGGAGCCGAGGAGTAGGGG + Exonic
985790391 5:1923821-1923843 CCTGGGGACCCAGGGAGTGGGGG - Intergenic
986545686 5:8894231-8894253 CCTGGGAACACTTGGAGGATGGG - Intergenic
986728458 5:10617666-10617688 CCTGGGGACCCCCTGAGTAGGGG - Intronic
989771987 5:45156001-45156023 ACTGGGGCCTGTCGGAGGAGTGG - Intergenic
990376113 5:55172956-55172978 CGTGCGGACCCTCCGAGGCGCGG + Exonic
992911719 5:81401550-81401572 CGTCGGGACGCTCTGAGGAGGGG - Intergenic
993749181 5:91645539-91645561 CCTGGGGTCCCTCAGACTAGTGG - Intergenic
997260783 5:132464267-132464289 CCTGGGCACCCTCAGAGGGCAGG - Exonic
997815167 5:137010057-137010079 CCTGGGGACACCCCAAGGAGGGG - Intronic
999246937 5:150160103-150160125 CCTGGGGAGCCTGGGAGTGGGGG - Intergenic
1000161107 5:158598538-158598560 GCTGGGGACACTCAGAGGGGAGG - Intergenic
1001043026 5:168350461-168350483 CCTGGGGACCAGCAGAGGAAGGG - Intronic
1001070354 5:168579761-168579783 GCTGAGGGGCCTCGGAGGAGGGG - Intergenic
1001536546 5:172502182-172502204 CCTGGGGGACCTGGGAGGAAGGG + Intergenic
1001602794 5:172939892-172939914 CCTGGGAGCCCTCGGAGGGCGGG + Intronic
1002455801 5:179344969-179344991 CCGGGGGAGCCTCGGAGCACTGG - Intronic
1003155067 6:3586408-3586430 CATGGGGAGCCTTGGAGAAGTGG - Intergenic
1005841844 6:29748865-29748887 CCTGGCGGTCCTCGGCGGAGCGG - Intergenic
1005959879 6:30687117-30687139 CCGCGGGACCCCCGGGGGAGGGG + Exonic
1006058634 6:31403715-31403737 CCTGGCGGTCCTCGGCGGAGCGG + Intronic
1006185863 6:32181415-32181437 CCTGGGGATCCTGGGAGGCCTGG - Exonic
1009437540 6:63635714-63635736 CCCGGGGCCCCACGGAGGCGCGG + Intergenic
1016447677 6:144150237-144150259 CCTGGGGACCAGAGGACGAGCGG + Intergenic
1017674375 6:156798021-156798043 ACTGGTGACCTTCAGAGGAGTGG + Intronic
1018262649 6:161985804-161985826 CATGGAGACCCTTTGAGGAGGGG + Intronic
1018358226 6:163040092-163040114 CCTGGGGCCGCTCAGAGCAGTGG - Intronic
1018908280 6:168087798-168087820 CTTGGGGACCCTGGGAACAGCGG - Intergenic
1018977946 6:168579769-168579791 GCTGGGGACCCAGGGATGAGGGG + Intronic
1019652796 7:2169764-2169786 ACTGGGGGCACTCGGAGCAGGGG + Intronic
1019652818 7:2169840-2169862 ACTGGGGGCACTCGGAGCAGGGG + Intronic
1020076208 7:5260631-5260653 CCTGGGAACCCCCCGAGGACAGG + Intergenic
1020111819 7:5451886-5451908 CCTGCAGACCCTGGGAGGAGGGG - Intronic
1022396116 7:29989451-29989473 CCTGGGGGCGGTCAGAGGAGAGG - Intronic
1022440114 7:30426275-30426297 CCAGGGGACCCTAGGAGGTGTGG - Intronic
1022624942 7:32025544-32025566 CCTGAGGAGGCTGGGAGGAGTGG + Intronic
1022963689 7:35454156-35454178 CCTGGGGACCCTGGTAGGGGTGG - Intergenic
1023882201 7:44326722-44326744 CCTGGGCAGGCTCTGAGGAGGGG + Intronic
1024219673 7:47277796-47277818 CATGGGGACCCTAGGGGGTGGGG + Exonic
1024577970 7:50780366-50780388 CCTGTGGACCCTAGGAGGTCTGG - Intronic
1025233209 7:57216767-57216789 GCTGGCGACCCAGGGAGGAGAGG + Intergenic
1025233254 7:57217055-57217077 GCTGGCGACCCAGGGAGGAGAGG + Intergenic
1025233272 7:57217153-57217175 GCTGGAGACCCAGGGAGGAGAGG + Intergenic
1025233288 7:57217251-57217273 GCTGGAGACCCAGGGAGGAGAGG + Intergenic
1025233306 7:57217349-57217371 GCTGGAGACCCAGGGAGGAGAGG + Intergenic
1025257605 7:57395778-57395800 CCTGGAGCCCCTGGGAGGGGCGG + Intergenic
1025669067 7:63603986-63604008 CCTGGGAACCCCCCGAGGACAGG + Intergenic
1026776510 7:73234555-73234577 CCTGGGGGCGCCCAGAGGAGAGG - Intergenic
1026853065 7:73736854-73736876 CCTGGGGACCCTACCAGGGGAGG - Intronic
1027017361 7:74787925-74787947 CCTGGGGGCGCCCAGAGGAGAGG - Intronic
1027070661 7:75158007-75158029 CCTGGGGGCGCCCAGAGGAGAGG + Intergenic
1027233983 7:76287099-76287121 CCTGAGGGCCCCAGGAGGAGGGG - Exonic
1029710467 7:102296352-102296374 TGTGGGGACCCTGGGAGGACAGG + Intronic
1032089416 7:128903885-128903907 GTTGGGCACCCTCGGAGGAGGGG + Intronic
1033360429 7:140635469-140635491 CCTGGGGATCCCGGGAGGAGGGG + Intronic
1036756925 8:11477070-11477092 CCTGGGGAGGCCCTGAGGAGAGG + Intergenic
1037355338 8:18013376-18013398 CCTGGGGCCACTGGGAGTAGAGG - Intronic
1037887659 8:22603321-22603343 CCTGGTGACCCTGGGTGGAGGGG + Exonic
1038019537 8:23541339-23541361 TCTGGGGACGCTGTGAGGAGGGG + Intronic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1040595285 8:48832294-48832316 CAGGAGGACCCTGGGAGGAGGGG - Intergenic
1042155666 8:65841817-65841839 CCTGGGGCTCCTCGGCCGAGAGG + Exonic
1046981897 8:120345452-120345474 CCTGGGGAGCCTGGGAGGCCAGG + Exonic
1047208244 8:122820314-122820336 CCTTGGGCCCCTCAGAGGCGAGG + Intronic
1047344008 8:124009796-124009818 GCTGGAGACCCAGGGAGGAGAGG + Intronic
1047344040 8:124009992-124010014 GCTGGCGACCCGGGGAGGAGAGG + Intronic
1053007952 9:34616456-34616478 CCTGGGGACCCTTGGGTGTGGGG - Intronic
1053072200 9:35108043-35108065 CCCGGGGACCCTCAGTGGATGGG + Exonic
1053503173 9:38619966-38619988 GCCGGGCACCCTCGGAGCAGCGG - Intergenic
1053907144 9:42852960-42852982 GCTGGGCACCCTCGGAGGGGCGG + Intergenic
1057152963 9:92809952-92809974 CCCGGGCACCCTCGGAGCCGCGG + Intergenic
1059446634 9:114342217-114342239 CCTCGGGACCCACTGCGGAGGGG + Intronic
1059791582 9:117646403-117646425 CCTGGGGACCCTCCCTGGTGTGG - Intergenic
1060191950 9:121599260-121599282 CCTGGGGACTCCGGGAGGGGAGG + Intronic
1060204391 9:121674084-121674106 CCTGAGGCCCCATGGAGGAGGGG + Intronic
1060599523 9:124868908-124868930 CCAGGGGCTCCTCGGAGGCGCGG + Exonic
1060962069 9:127688109-127688131 CCTGTGGCCCCTGGGAGGGGAGG - Intronic
1060980808 9:127790565-127790587 CCTTGGGAACCTTTGAGGAGCGG + Exonic
1061153973 9:128846037-128846059 CCCCGGGACCCTCCGAGGAGCGG - Intronic
1061233457 9:129328403-129328425 TCTGGAGTCCCTCTGAGGAGTGG + Intergenic
1062014701 9:134285206-134285228 CCTGGGGACACGCAGAGGTGAGG - Intergenic
1062136297 9:134930144-134930166 CCTGGAGACCCGAGGAGGACTGG - Intergenic
1062146448 9:134992280-134992302 CCTGGAGACCCTCCGCGGGGAGG - Intergenic
1062555675 9:137112545-137112567 CCTGGGGACCCTCTCAGCACTGG - Intronic
1062634811 9:137485134-137485156 CCTGGGGACGCTTGCAGGTGTGG - Intronic
1203748757 Un_GL000218v1:58933-58955 TCTGGGCACCCTCAGAGCAGCGG + Intergenic
1187041355 X:15599401-15599423 CCTAGGGACCCTGGCAGCAGGGG + Intronic
1192194348 X:69018561-69018583 GCTAGGGAACCTAGGAGGAGGGG - Intergenic
1195038585 X:100992818-100992840 CCTGGGGACCCTGGGACAGGAGG + Intergenic
1195108645 X:101623903-101623925 TCTGGGGACCCTAGGAGGGACGG + Intronic
1201781610 Y:17729343-17729365 CCTCAGGACCCTCCCAGGAGAGG - Intergenic
1201819943 Y:18176647-18176669 CCTCAGGACCCTCCCAGGAGAGG + Intergenic