ID: 903945884

View in Genome Browser
Species Human (GRCh38)
Location 1:26962146-26962168
Sequence AACACGGAAATGCTACTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903945884 Original CRISPR AACACGGAAATGCTACTGAC AGG Intergenic
903945884 1:26962146-26962168 AACACGGAAATGCTACTGACAGG + Intergenic
906792076 1:48667950-48667972 AAGAAGGAAATGCTACTGGGAGG + Intronic
916705373 1:167343924-167343946 AACAGGGAAATGCTACGGGGAGG + Intronic
919235526 1:194837462-194837484 AACACAGAAATTCTACTTCCAGG - Intergenic
921303197 1:213770101-213770123 AACACGGAAGTGCTGCTAAATGG + Intergenic
1076026454 10:127118752-127118774 AACACGTAAAAGGTACTGTCGGG + Intronic
1080605150 11:33859440-33859462 TACACAGAAATGCTTCTGACAGG + Exonic
1081552336 11:44125469-44125491 ATAAAGGACATGCTACTGACAGG - Intronic
1084631690 11:70355997-70356019 AAGACGGAAATGCTCAAGACAGG - Intronic
1085377918 11:76083888-76083910 AACACGTAAATGTTACTTTCAGG + Intronic
1086572307 11:88299489-88299511 AAAACAGAAATGTTGCTGACTGG + Intronic
1091139617 11:133223868-133223890 AACACTCAGATGCTAATGACAGG - Intronic
1095513803 12:42983620-42983642 AAACTGGAAATGCTACTGTCTGG + Intergenic
1102418632 12:112786506-112786528 TCCAGGGAAATGCTACTGTCAGG - Intronic
1106649462 13:31674276-31674298 GCCACTGAAATGCTTCTGACTGG + Intergenic
1108875682 13:55046770-55046792 AAAACTGAAATCCAACTGACTGG - Intergenic
1121981772 14:98460782-98460804 AGCACGGACATGCTAATGATGGG - Intergenic
1124009707 15:25828695-25828717 TACATGGAAATGCTTATGACTGG - Intronic
1127838987 15:62813631-62813653 ATCACGGTAATGCTATTGACAGG + Intronic
1128856147 15:71018215-71018237 AACACAGAAAGGGAACTGACAGG + Intronic
1132787704 16:1667160-1667182 AACACTGAAAGGCTACTTTCAGG - Intronic
1134479892 16:14609797-14609819 AACATGGACATGCTACAGGCTGG + Intronic
1139182727 16:64767058-64767080 TACAAGGAAATGCTAGAGACTGG + Intergenic
1140439787 16:74978793-74978815 AAGAAGGAAATGCTACTGTGAGG + Intronic
1141048638 16:80740062-80740084 AAGACAGAAAAGCTACTTACAGG + Intronic
1144817436 17:18045596-18045618 AACAATGAAAAGTTACTGACTGG + Intronic
1151034434 17:70781911-70781933 AACAAGGAAACACTACTGAGAGG + Intergenic
1155163203 18:23212036-23212058 TACACAGAGATGCTACTGAAGGG - Intronic
1158414234 18:57235351-57235373 AACACAGAAATGCTATTAAGTGG + Intergenic
1167003659 19:46761091-46761113 AATACTGAAATACTTCTGACTGG - Intronic
929905787 2:46045504-46045526 AACATGCAGATCCTACTGACTGG - Intronic
931186817 2:59960442-59960464 AACAGGGAATTTATACTGACTGG + Intergenic
931278417 2:60764962-60764984 CAGATGGAAATGCTAGTGACAGG + Intronic
939624709 2:144462479-144462501 AGCACGGAAGTGCCACTCACGGG + Intronic
939799808 2:146695483-146695505 AAAATGGAATTGCTACTGCCAGG - Intergenic
948992260 2:241561163-241561185 AACAGGGTAATGCTGCTGACCGG - Intronic
1171465108 20:25322105-25322127 AAAACGGAAATGCTACAGTGAGG + Intronic
1171939836 20:31316043-31316065 GACACTGAAATGGTACTGACAGG - Intergenic
1174344076 20:49916615-49916637 AACACAGTAATGCTACTGTTTGG - Intergenic
1174603986 20:51747198-51747220 GCCACAGAAATGCTACTGTCTGG + Intronic
1178972833 21:37196007-37196029 AACATGGGAATACCACTGACAGG - Exonic
1183355727 22:37358268-37358290 AACACGGAACTCCTACTTCCTGG - Intergenic
956018528 3:64909727-64909749 AAGAGGGAAATGCAGCTGACAGG + Intergenic
959148127 3:102574386-102574408 GATAGGGGAATGCTACTGACAGG - Intergenic
960507109 3:118507127-118507149 AACACACCAATACTACTGACTGG + Intergenic
961047753 3:123721206-123721228 AACACGGAGATGTTCCTGACAGG + Intronic
961270201 3:125682358-125682380 AACACGGAGATGTTCCTGACAGG - Intergenic
961769764 3:129240477-129240499 AACAAGGAAGTGCCACTGAGGGG + Intergenic
962154444 3:132930682-132930704 AACACAGAAGTGCTGCTGAGCGG + Intergenic
967362186 3:188643922-188643944 AAGACAGAAATACTGCTGACTGG + Intronic
968537579 4:1144285-1144307 ATCATGGAAATGGCACTGACAGG + Intergenic
968537724 4:1145162-1145184 ATCATGGAAATGGCACTGACAGG + Intergenic
968537745 4:1145297-1145319 ATCATGGAAATGGCACTGACAGG + Intergenic
968537918 4:1146305-1146327 ATCATGGAAATGGCACTGACAGG + Intergenic
968537962 4:1146614-1146636 ATCATGGAAATGGCACTGACAGG + Intergenic
968538056 4:1147199-1147221 ATCATGGAAATGGCACTGACAGG + Intergenic
968538168 4:1148054-1148076 ATCATGGAAATGGCACTGACAGG + Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
979229064 4:118325569-118325591 TACCAGGAAATGCTAGTGACTGG - Intronic
981092277 4:140744180-140744202 AATAGGAAAATGCTGCTGACAGG - Intronic
981431597 4:144667696-144667718 AGCAAGGAAATGCTGCTGAAAGG - Intronic
982600523 4:157443570-157443592 AACACAGAACTGCCACTGACTGG + Intergenic
984126245 4:175814776-175814798 AATACTGAAAGCCTACTGACAGG - Intronic
990527205 5:56639662-56639684 AACAGGGAAATGATAGTGCCAGG - Intergenic
994427961 5:99618744-99618766 AACCAGGAAATTCTACTGAAAGG - Intergenic
998234127 5:140383208-140383230 AACACTGAATTCCTACTGCCTGG - Intergenic
1000303479 5:159975476-159975498 AACACCGAAATGCAAATCACTGG + Intergenic
1005040204 6:21594562-21594584 AACACGGAAGCGCTGCTGGCCGG + Exonic
1011725513 6:90206447-90206469 AACTCTGAAATGCTTCTGGCAGG + Intronic
1012293237 6:97484988-97485010 AACACTGAAATGATACTCAAAGG - Intergenic
1013934821 6:115581768-115581790 AACATGGAAATGGTAGTGAAGGG + Intergenic
1018639094 6:165890328-165890350 AAAAAGTAAATGCTATTGACAGG - Intronic
1029216121 7:98951317-98951339 AACACAGAAACTCTGCTGACCGG - Intronic
1031942209 7:127801113-127801135 AACTACGAAATGCTACTTACAGG - Intronic
1034454584 7:151160459-151160481 AACAGGAAAATACTTCTGACTGG - Intronic
1042724793 8:71861792-71861814 AAAAGGGAAATGTTACTCACAGG - Intronic
1047243972 8:123121799-123121821 AACACGGTAGTGCTATTGGCAGG - Intronic
1047818047 8:128486764-128486786 AAAACTGAAATGCCACTGTCAGG - Intergenic
1052123647 9:24749863-24749885 AAAATAGAAATGCTACTGTCTGG + Intergenic
1056618085 9:88185892-88185914 AACAAGGAAAGGATACTGGCTGG + Intergenic
1057303571 9:93899989-93900011 AGCACCCAAATGCTTCTGACTGG + Intergenic
1057991499 9:99775643-99775665 AATACTGAAAGGCTACTGACTGG + Intergenic
1060630543 9:125153948-125153970 AATATGGAAATGCTAATGCCTGG - Exonic
1189001909 X:36957376-36957398 AAAACGGAAATGCTCCTGACGGG + Intergenic
1190581170 X:51894086-51894108 AACCCCGAGAAGCTACTGACAGG - Intronic
1192924501 X:75741343-75741365 AACATGGGAATACCACTGACAGG + Intergenic
1194326960 X:92531282-92531304 AACACTGACATTCTACTGAAAGG - Intronic
1195789599 X:108568671-108568693 AAAAGTGAAATGCTACTTACAGG - Exonic
1200635681 Y:5650490-5650512 AACACTGACATTCTACTGAAAGG - Intronic