ID: 903947953

View in Genome Browser
Species Human (GRCh38)
Location 1:26975858-26975880
Sequence TTGGGGCTCCAGCATTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903947953_903947961 15 Left 903947953 1:26975858-26975880 CCAACACAATGCTGGAGCCCCAA No data
Right 903947961 1:26975896-26975918 TGAATGCTTTCTGATTGCAATGG No data
903947953_903947962 29 Left 903947953 1:26975858-26975880 CCAACACAATGCTGGAGCCCCAA No data
Right 903947962 1:26975910-26975932 TTGCAATGGTGATTGCAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903947953 Original CRISPR TTGGGGCTCCAGCATTGTGT TGG (reversed) Intergenic
No off target data available for this crispr