ID: 903948967

View in Genome Browser
Species Human (GRCh38)
Location 1:26982992-26983014
Sequence GCCACTGTGCAAGGTGCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903948967_903948970 -9 Left 903948967 1:26982992-26983014 CCTCTAGCACCTTGCACAGTGGC No data
Right 903948970 1:26983006-26983028 CACAGTGGCTGGTGCATAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903948967 Original CRISPR GCCACTGTGCAAGGTGCTAG AGG (reversed) Intergenic
No off target data available for this crispr