ID: 903949466

View in Genome Browser
Species Human (GRCh38)
Location 1:26987157-26987179
Sequence TCTTCTGGCTGCTGTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903949458_903949466 8 Left 903949458 1:26987126-26987148 CCACAGTCACTGTCCCCTCCACA No data
Right 903949466 1:26987157-26987179 TCTTCTGGCTGCTGTCCTGGAGG No data
903949464_903949466 -10 Left 903949464 1:26987144-26987166 CCACAAGGCTGTCTCTTCTGGCT No data
Right 903949466 1:26987157-26987179 TCTTCTGGCTGCTGTCCTGGAGG No data
903949461_903949466 -6 Left 903949461 1:26987140-26987162 CCCTCCACAAGGCTGTCTCTTCT No data
Right 903949466 1:26987157-26987179 TCTTCTGGCTGCTGTCCTGGAGG No data
903949457_903949466 14 Left 903949457 1:26987120-26987142 CCACAGCCACAGTCACTGTCCCC No data
Right 903949466 1:26987157-26987179 TCTTCTGGCTGCTGTCCTGGAGG No data
903949456_903949466 25 Left 903949456 1:26987109-26987131 CCTGCTTGGGGCCACAGCCACAG No data
Right 903949466 1:26987157-26987179 TCTTCTGGCTGCTGTCCTGGAGG No data
903949460_903949466 -5 Left 903949460 1:26987139-26987161 CCCCTCCACAAGGCTGTCTCTTC No data
Right 903949466 1:26987157-26987179 TCTTCTGGCTGCTGTCCTGGAGG No data
903949462_903949466 -7 Left 903949462 1:26987141-26987163 CCTCCACAAGGCTGTCTCTTCTG No data
Right 903949466 1:26987157-26987179 TCTTCTGGCTGCTGTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903949466 Original CRISPR TCTTCTGGCTGCTGTCCTGG AGG Intergenic
No off target data available for this crispr