ID: 903950545

View in Genome Browser
Species Human (GRCh38)
Location 1:26993811-26993833
Sequence TGCGGCCCGGGGGCCCAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 326}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903950531_903950545 21 Left 903950531 1:26993767-26993789 CCGCCGGTGGGGGGCGGGGGATG 0: 1
1: 0
2: 4
3: 30
4: 308
Right 903950545 1:26993811-26993833 TGCGGCCCGGGGGCCCAGGAGGG 0: 1
1: 0
2: 2
3: 35
4: 326
903950526_903950545 28 Left 903950526 1:26993760-26993782 CCGCAGACCGCCGGTGGGGGGCG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 903950545 1:26993811-26993833 TGCGGCCCGGGGGCCCAGGAGGG 0: 1
1: 0
2: 2
3: 35
4: 326
903950535_903950545 -2 Left 903950535 1:26993790-26993812 CCGGGCTGCCGCATCAGCGCCTG 0: 1
1: 0
2: 0
3: 16
4: 178
Right 903950545 1:26993811-26993833 TGCGGCCCGGGGGCCCAGGAGGG 0: 1
1: 0
2: 2
3: 35
4: 326
903950537_903950545 -10 Left 903950537 1:26993798-26993820 CCGCATCAGCGCCTGCGGCCCGG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 903950545 1:26993811-26993833 TGCGGCCCGGGGGCCCAGGAGGG 0: 1
1: 0
2: 2
3: 35
4: 326
903950532_903950545 18 Left 903950532 1:26993770-26993792 CCGGTGGGGGGCGGGGGATGCCG 0: 1
1: 0
2: 0
3: 13
4: 286
Right 903950545 1:26993811-26993833 TGCGGCCCGGGGGCCCAGGAGGG 0: 1
1: 0
2: 2
3: 35
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903950545 Original CRISPR TGCGGCCCGGGGGCCCAGGA GGG Exonic
900102033 1:966075-966097 TGTGGCGAGGGGGCCCAGGCAGG + Intergenic
900639412 1:3681616-3681638 TGTGGCCCTGGGGTGCAGGAAGG + Intronic
900644655 1:3703406-3703428 TGTGGCCCAGGGCCCCAGGCAGG - Intronic
900726306 1:4218601-4218623 TGCGTCCCGTGGGCTCAGGGAGG - Intergenic
901676448 1:10888690-10888712 CGCGGCCCGGGGGTCCCAGACGG + Intergenic
902918927 1:19655228-19655250 TGCGGACAGGGGTCCAAGGAGGG + Intronic
903251016 1:22053061-22053083 GGGAGCCCGGGCGCCCAGGATGG - Intronic
903857068 1:26343828-26343850 TGGGGCACCGGGGCTCAGGAAGG - Exonic
903950545 1:26993811-26993833 TGCGGCCCGGGGGCCCAGGAGGG + Exonic
904037929 1:27568702-27568724 CGCGGCGCGGGTGCCCGGGAGGG + Intronic
905028989 1:34868920-34868942 TGGGGGCCCGGGGCCCAGGCTGG + Exonic
905890125 1:41513512-41513534 TGGGGGCTGAGGGCCCAGGATGG + Exonic
906191752 1:43903524-43903546 TGGGGCCCTGGGGCCTAGGCTGG + Intronic
906296973 1:44654892-44654914 GGCGGCCCGGCGCTCCAGGATGG + Exonic
906534494 1:46544096-46544118 AGGGGCGGGGGGGCCCAGGACGG - Intergenic
907359943 1:53906304-53906326 TGGGGACAGGGGGCCCAGGGAGG + Intronic
907740544 1:57161390-57161412 TGCAGCCCAGCTGCCCAGGATGG - Intronic
912257177 1:108072113-108072135 TGCGACACAGGTGCCCAGGAGGG - Intergenic
912568558 1:110606231-110606253 TGCGGCCCAGGGATCCCGGAGGG - Intronic
912568904 1:110607528-110607550 TGAGGCCCGGGGGCCCAACGAGG - Intronic
913209544 1:116571188-116571210 GGCGCCCCGGGGACACAGGAAGG - Intergenic
913698389 1:121350124-121350146 TAAGGCCCAGAGGCCCAGGATGG + Intronic
914139161 1:144929918-144929940 TAAGGCCCAGGGGCCCAGGATGG - Intronic
914490003 1:148146131-148146153 TGGGGCCCGGGGGCGCGGGCCGG + Intronic
914902014 1:151716104-151716126 TGGGGCCCGGGGGCCCAGCTGGG + Exonic
915895661 1:159809137-159809159 TGCATCCCGGGAGCCAAGGAGGG + Exonic
916084554 1:161259036-161259058 TGCGGCTCGGGATCCCAGGGAGG + Intronic
918218714 1:182416028-182416050 TGCTCCCCCGGGGCCCAGGGAGG - Intergenic
919749174 1:201025910-201025932 TGCTCCCTGGTGGCCCAGGAGGG - Intergenic
920250052 1:204617511-204617533 TGCAGCCCGGGGACACAGGTAGG + Exonic
920485791 1:206368780-206368802 TAAGGCCCAGGGGCCCAGGATGG + Intronic
921080572 1:211735825-211735847 TGCCTCCCGGGTTCCCAGGAGGG - Intergenic
922335682 1:224616698-224616720 TGCGCCCCGGTGGCGCGGGAGGG + Exonic
923171484 1:231421603-231421625 CGGGGCCCGGGAGCCCAGGAAGG - Exonic
1065464181 10:26001569-26001591 TACGGCCTGGGAGCCCAGTAGGG + Intronic
1065614327 10:27504562-27504584 CGCGGCCCAGAGGCCGAGGAGGG - Intronic
1065794366 10:29292361-29292383 TGCGCCCAGGGGGCACACGAGGG - Intronic
1065807667 10:29409825-29409847 CGCGGCCCAGAGGCCGAGGAGGG - Intergenic
1066086342 10:31975335-31975357 TGGAGCCTGGGGGCCCAGGCAGG + Intergenic
1067431581 10:46249275-46249297 TTAGGCCTGGGGGCCCAGCATGG + Intergenic
1067441839 10:46312899-46312921 TTAGGCCTGGGGGCCCAGCATGG - Intronic
1067755719 10:49002736-49002758 TGCAGCCAGCAGGCCCAGGAAGG + Intergenic
1069474627 10:68721589-68721611 CCCGGGCCGGGGGGCCAGGAGGG - Intronic
1070800827 10:79243547-79243569 GGCGGCGCGGGGGCCCGGGCGGG - Intronic
1071601963 10:86962751-86962773 TGGGCCCTGGGAGCCCAGGAGGG - Intronic
1072387520 10:94946359-94946381 TGGGGCACGGGGGGCCAGCAGGG + Intronic
1073136510 10:101223398-101223420 CGCGGCCCGGGGACCTCGGATGG - Intergenic
1073290073 10:102409136-102409158 GGCGGCCCGGGGGCCGAGGGCGG - Intronic
1073578082 10:104641563-104641585 TCCGGCCCGGCGCCCCAGCACGG - Exonic
1075428457 10:122361133-122361155 TGAGGCCCAGAGCCCCAGGAGGG + Intergenic
1076358585 10:129870490-129870512 GGCAGCTCGGGGCCCCAGGAGGG - Intronic
1076371724 10:129959721-129959743 GGCGGCCTGGGAGCCCAGGCGGG + Intronic
1076821492 10:132942191-132942213 TGTGGCCCGGGGGCCCAAGGCGG - Intronic
1076874193 10:133207935-133207957 TGCAGCCCAGGGGCCCATGCAGG - Intronic
1076883340 10:133250067-133250089 TGCTGGGCGGAGGCCCAGGATGG - Intergenic
1076896029 10:133312641-133312663 AGCTGCCCCAGGGCCCAGGAGGG + Intronic
1077139918 11:1019765-1019787 TGCTGCCCAGGGACCCTGGAGGG - Intronic
1077208090 11:1353632-1353654 GGAGGCCCGGGGGCCAAGCAAGG - Intergenic
1077328411 11:1973482-1973504 TGCACCCCGGAGGCCCAGGAAGG + Intronic
1077467097 11:2738600-2738622 GGTGACTCGGGGGCCCAGGAGGG - Intronic
1078097730 11:8310958-8310980 TGAGAGCTGGGGGCCCAGGAGGG - Intergenic
1080386272 11:31812930-31812952 TGTGGCCCGGCGGCCCAGGGCGG - Intronic
1081793392 11:45804440-45804462 CGCGGCCCGGGGACACAGGCAGG + Exonic
1082634842 11:55583453-55583475 TGCGGCCCGGTGGACCTGCAGGG - Intergenic
1083198734 11:61106526-61106548 AGGGACCTGGGGGCCCAGGAAGG + Intronic
1083669082 11:64290573-64290595 TGAGGGCCTGGTGCCCAGGATGG - Intergenic
1084125229 11:67094972-67094994 TGCAGCCCAGAGACCCAGGACGG - Intergenic
1084151401 11:67289442-67289464 TGCGGCGCTGAGGCCCAGCATGG + Exonic
1084290603 11:68163567-68163589 TGCGGCCTGAGTGCTCAGGAAGG - Intronic
1085037686 11:73309689-73309711 TGCGTCCCAGGTCCCCAGGAGGG + Exonic
1087618123 11:100511803-100511825 TGCAGCCTGGAGACCCAGGAAGG - Intergenic
1089650150 11:119907629-119907651 TGAGCCCCCTGGGCCCAGGATGG + Intergenic
1090332565 11:125943202-125943224 TGAGCCCTGGGGGCCCAGGCAGG + Intergenic
1202811389 11_KI270721v1_random:28661-28683 TGCACCCCGGAGGCCCAGGAAGG + Intergenic
1091591754 12:1846641-1846663 GCCAGCCCGGGTGCCCAGGAAGG + Exonic
1091907035 12:4197261-4197283 TGCTGGCCAGGGCCCCAGGAAGG - Intergenic
1093096809 12:14981244-14981266 CGTGGCCCTGTGGCCCAGGAAGG - Intronic
1096156637 12:49345071-49345093 TGCGGCCCGGGGGCCCCGCCCGG + Intergenic
1096345525 12:50842901-50842923 TGCGCCCCGCGTGCCCAGGGCGG + Intronic
1096622683 12:52874322-52874344 GGCGGCCGGGGGCCCCAGGGCGG + Intergenic
1096827687 12:54292388-54292410 TGTGCCCCGGGGGACCAAGATGG - Exonic
1097053341 12:56236637-56236659 TGTGGCCTTGGTGCCCAGGAGGG - Exonic
1099958362 12:89373139-89373161 TGAGGCCCCAGGGCCAAGGAGGG - Intergenic
1101371815 12:104137829-104137851 TCCGGGCCCGGGGCCGAGGAGGG - Intronic
1103796100 12:123504224-123504246 TGAGTCCCGGGGGCTAAGGAGGG - Intronic
1103902204 12:124309137-124309159 TGTGGCCCTGGGGCCCAGTGGGG + Intronic
1104635719 12:130436956-130436978 AGCCGCCCGTGGGCCCCGGAAGG - Exonic
1104867548 12:131967042-131967064 TGTGGCCCTGTGGCCCAGGATGG - Intronic
1105017830 12:132796834-132796856 TGCAGACTGAGGGCCCAGGATGG + Intronic
1105474886 13:20721032-20721054 TGAGGTTCGGGGGCTCAGGAAGG - Intronic
1106132342 13:26950852-26950874 TACGTCCTGGGAGCCCAGGAGGG + Intergenic
1106208656 13:27621486-27621508 GGAGGGCCGGGGTCCCAGGAAGG + Exonic
1109284795 13:60397442-60397464 TGCGGGCCGGGGCCCCAGGGAGG + Intronic
1110046821 13:70842132-70842154 TGCTGCCCGTGGGCCAAGAAGGG + Intergenic
1113480462 13:110616188-110616210 CGCGTCCCTGGGCCCCAGGAGGG - Intronic
1113522471 13:110950554-110950576 TGTGGCCCCAGGGCCCTGGAGGG + Intergenic
1113841423 13:113363738-113363760 TGGGTCCCGGGGGCGCAGGTGGG - Intronic
1118298998 14:64597963-64597985 TGGGGCACGGGGGCCCCGGAGGG - Intergenic
1118749062 14:68793569-68793591 CGCGGCCCGGGCGCTAAGGACGG - Intronic
1122354094 14:101113003-101113025 TGGGGCCTGCGGGCCCAGGCGGG + Intergenic
1122402374 14:101475043-101475065 TGGGGACCGGGGGGTCAGGAGGG + Intergenic
1122470894 14:101965105-101965127 TGCGGCCCTGGGGACCCGGCCGG - Intronic
1122660361 14:103290798-103290820 TGCTGCCCGGGGGCCGGGGTGGG + Intergenic
1122784282 14:104156701-104156723 AGCCGCCCCGGGACCCAGGAGGG - Intronic
1202893720 14_KI270722v1_random:183524-183546 TGCGGGCCGCGGACCCAGGCTGG + Intergenic
1123919762 15:25062067-25062089 TGCTGGCGGGTGGCCCAGGACGG + Intergenic
1124129542 15:26971693-26971715 TGCGGCACGGCGGGCCGGGAGGG + Intronic
1124416238 15:29475166-29475188 TGAGGACTGGGGGCCCAGAAAGG - Intronic
1124765364 15:32483575-32483597 GACGGCAGGGGGGCCCAGGATGG - Intergenic
1126190588 15:45873893-45873915 TGTGGCCCAGAGGCCTAGGAGGG - Intergenic
1127145043 15:56014896-56014918 ACAGGCCCGGAGGCCCAGGAGGG - Intergenic
1127791036 15:62398933-62398955 TCAGGCCCGGAGGCCTAGGAGGG + Intronic
1127858370 15:62971853-62971875 TGCGGCCCGGTTGCTGAGGAGGG - Intergenic
1128028650 15:64460784-64460806 TACGGCCCGGGGCCCCGGGCGGG + Intronic
1128075670 15:64823939-64823961 TGCGGCCCCGGGTCCCGGGCCGG - Exonic
1128147140 15:65337945-65337967 TGCCTCCAGGGAGCCCAGGATGG - Intronic
1130988440 15:88860163-88860185 TGTGGGCCAGGTGCCCAGGAGGG + Intronic
1131367551 15:91853390-91853412 GGCGGCCCGGCGGCCGAGGCTGG - Intergenic
1132011514 15:98280610-98280632 TTCGGCCCGGCCTCCCAGGACGG - Intergenic
1132462949 16:64380-64402 GGCAGCCCGGGGACCCAAGAGGG + Intronic
1132498941 16:276162-276184 TGTGGGCCGGGGGCCGAGGGGGG + Intronic
1132675314 16:1118934-1118956 TGGGGCCCAGGAGGCCAGGAAGG + Intergenic
1132725821 16:1337975-1337997 TGTGGCCAGGAGGCCCTGGAGGG - Intronic
1132959520 16:2614157-2614179 TGCAGCCTGGGGCCCCAGGGAGG + Intergenic
1132972581 16:2696132-2696154 TGCAGCCTGGGGCCCCAGGGAGG + Intronic
1132974509 16:2704736-2704758 TGGGGCCCTGGGTCACAGGAGGG - Intronic
1133175545 16:4011355-4011377 TGCTGCCCGTGGCCCCAGAATGG - Intronic
1133666099 16:7969338-7969360 TGAGGCCCAGGGACACAGGATGG - Intergenic
1135410420 16:22230029-22230051 TGGGGTCCGGGGGCCCCTGAAGG + Intronic
1135778773 16:25280294-25280316 AGCGGCCCGGCAGGCCAGGAAGG + Intergenic
1136008628 16:27348032-27348054 TGCATCCCAGGGGCCCAGGCTGG + Intronic
1137555002 16:49464993-49465015 AGAGGCCCCGGGGCCCAGTAGGG + Intergenic
1138106020 16:54287416-54287438 GGCAGCCCGGGGGCACTGGAAGG + Intergenic
1139391456 16:66608466-66608488 TGAGGACAGGGGCCCCAGGAGGG + Intronic
1139466161 16:67155212-67155234 TGCGGCTCGGGGGCCCGGGGTGG - Exonic
1139476096 16:67203268-67203290 GGCAGCCCCGGGGCCCAGGGCGG - Intronic
1139576632 16:67846531-67846553 AACGGCCCAGGGGCCCAGGGAGG + Intronic
1141445950 16:84058441-84058463 GGCGGCCAGGGGGCCTCGGAGGG + Intronic
1141694588 16:85613573-85613595 TGCGACCCGCGGGCGGAGGAAGG - Intronic
1142230562 16:88898283-88898305 GGCGGCCCGGGTGCCCCTGAGGG - Intronic
1142247498 16:88976666-88976688 CGCACCCCGGGGTCCCAGGAAGG - Exonic
1142249794 16:88986044-88986066 GGCGGCTCAGGGGCCCAGCATGG - Intergenic
1142342421 16:89532258-89532280 TGTGGCCTGGGGGGCCAGCACGG + Intronic
1142349415 16:89573146-89573168 TGTGGGCCGGGAGCCCAGGGAGG + Intergenic
1142741581 17:1934805-1934827 TGCTGGCCGGGGGCCCAGGTGGG - Exonic
1143247816 17:5500830-5500852 CGCTGCCCGCGGGCCCAGGTCGG - Intronic
1144373754 17:14618680-14618702 TGTGGAGCTGGGGCCCAGGATGG + Intergenic
1144777367 17:17791588-17791610 TGTGGCCCAGGCCCCCAGGAGGG - Intronic
1144840742 17:18184154-18184176 CGCGCCCCGGGGCCCCCGGAGGG - Intronic
1145190609 17:20840782-20840804 TGGGGCCCGGGGGCGCGGGCCGG + Intronic
1145977700 17:28993747-28993769 TGCTGGCCTGGGGCCCAGGAAGG - Intronic
1146941291 17:36846055-36846077 TGAGGCCCTGGGCCCCAGGGAGG + Intergenic
1147139570 17:38453763-38453785 CGGGGCCCGGGGGCCCCGAAGGG - Intronic
1148324248 17:46773958-46773980 AGCGGCCATGGTGCCCAGGATGG - Intronic
1148440563 17:47709570-47709592 TGTGGCCCGGGGTCCAAGGAGGG - Intronic
1148608005 17:48944737-48944759 GGCGGCCCGCGGGCCCAGGGTGG - Exonic
1151365389 17:73613366-73613388 TGGGGCCAGGGGGACCTGGAGGG - Intronic
1151529748 17:74696645-74696667 TGCCCCCCGGGGGCCCGGGAGGG - Intronic
1151664042 17:75535388-75535410 TGCGGCCCGGGGGCCCTCTCTGG + Intronic
1151675236 17:75594230-75594252 TGAGGCCGTGGGGCGCAGGAAGG + Intergenic
1152040303 17:77898633-77898655 TGCGGTCCGGGGGCTCTAGAAGG - Intergenic
1152207243 17:78980752-78980774 TGTGGCCCGGGGCCCCCGCAGGG - Intergenic
1152644860 17:81464048-81464070 GGCGGGCCGGGGACCCATGAGGG - Exonic
1154305702 18:13229259-13229281 GGCAGCACAGGGGCCCAGGAGGG - Intronic
1155007500 18:21741513-21741535 TGCCGCCGGGGGGCCCGTGAGGG - Exonic
1155193713 18:23453481-23453503 AGCGGCCTGGGGACCCAGCAAGG + Exonic
1157285616 18:46375169-46375191 TGCGGCCAGGGCGGCCTGGAAGG - Intronic
1157359558 18:46964763-46964785 GGCAGCCCAGGGGCCCAGGGGGG - Intronic
1157361152 18:47024282-47024304 GGCAGCCCAGGGGCCCAGGGGGG - Intronic
1157362142 18:47030197-47030219 GGCAGCCCAGGGGCCCAGGGGGG - Intronic
1157464210 18:47930542-47930564 GGCGGCCCGGGCGCGCGGGAGGG + Exonic
1160406470 18:78649725-78649747 TGCTGCCAGAGTGCCCAGGATGG + Intergenic
1160453649 18:78980820-78980842 GGCGGTGCGGGGGCCCGGGAGGG - Intronic
1160701839 19:511280-511302 AGCCGCCCGGGAGCCCAGGAGGG + Intronic
1160788723 19:913111-913133 TGCGGCCCGGAGGCGGCGGAGGG - Exonic
1160804483 19:986059-986081 TGCGGCCTGGGGCCCTGGGATGG + Intronic
1160897060 19:1407949-1407971 TTCGCGCCGGGGGCCCTGGACGG + Intronic
1160996706 19:1885356-1885378 TGGGGCCCGGGGGCGCGGGCCGG - Exonic
1161704891 19:5815034-5815056 TGGGGCCGGGGGACTCAGGAGGG - Intergenic
1162416963 19:10544054-10544076 GGCGGACCGAGGGCCCAGGTGGG - Exonic
1163263220 19:16203834-16203856 TTCAGCCCAGGGGCCCAGGAAGG + Intronic
1163263627 19:16205657-16205679 GGCGGCCCGGGGACCCATTAGGG + Intronic
1164507926 19:28874721-28874743 TGAGGCCCCAGGCCCCAGGAGGG + Intergenic
1165745745 19:38228890-38228912 TGGGGACCGGCTGCCCAGGAGGG - Intronic
1165903907 19:39181802-39181824 AGGGGCCCGGAGGCCCAGGAGGG + Intronic
1166759998 19:45218261-45218283 AGCAGCCCGGAGGCCCTGGATGG - Exonic
1167258260 19:48443560-48443582 AGGGGCCCGGCGGCCCAGGGTGG - Exonic
1168288831 19:55347314-55347336 TGGGGCCTGGGGTCCCAGCAGGG - Exonic
1202647158 1_KI270706v1_random:153011-153033 TGCAGCTCGGGTGCCCAGGCAGG + Intergenic
925407022 2:3612661-3612683 TGAGGCCAGGGGCCTCAGGAAGG - Intronic
926212401 2:10880519-10880541 GGCAGCCCCTGGGCCCAGGACGG - Intergenic
926755111 2:16228205-16228227 GGCGGGGCGGGGTCCCAGGAAGG - Intergenic
927783001 2:25954445-25954467 TGCAGCCCTGCGGCCCAGGCTGG - Intronic
932197524 2:69797286-69797308 TGGGACCCGGGGACCAAGGAGGG - Intronic
933168196 2:79097283-79097305 TGCGGCCCTGGGGGCCTGCAGGG + Intergenic
933354179 2:81194269-81194291 TGAGCCCCAGGGGCCGAGGAGGG - Intergenic
933796552 2:85924586-85924608 TGAGGCCCCGAGGCCCAGGATGG - Intergenic
934518948 2:95007307-95007329 GGCTGCCCAGGGGCCGAGGAAGG - Intergenic
934850873 2:97700349-97700371 TGAGGCCAGGGGGCAGAGGAGGG + Intergenic
936047221 2:109197159-109197181 TGCAGCCCTGCGGCCCAGGAAGG + Intronic
937210793 2:120268546-120268568 TGGGGGCAGAGGGCCCAGGACGG + Intronic
937865886 2:126751647-126751669 TGAGGCAGTGGGGCCCAGGAAGG - Intergenic
937886325 2:126901979-126902001 TGGGGCCCCAGGACCCAGGATGG - Exonic
937912300 2:127081569-127081591 ACCAGCCCAGGGGCCCAGGAGGG + Intronic
938081579 2:128373121-128373143 TGGGGACTGGGGGCCCAGGAAGG + Intergenic
938392283 2:130915735-130915757 TGCGGCCCCGGGGCTGAGGAGGG + Intronic
946070832 2:217033160-217033182 TGGGGCCCTGGAGCCCAGAAGGG + Intergenic
946402800 2:219477349-219477371 CTCAGCACGGGGGCCCAGGATGG + Exonic
947327366 2:228992871-228992893 TGCACTCTGGGGGCCCAGGAAGG - Intronic
947526513 2:230879764-230879786 TCCTGCCCTGGGGACCAGGATGG + Intergenic
947551662 2:231050898-231050920 TGGGGCTGGGGAGCCCAGGAAGG - Intergenic
947827958 2:233118871-233118893 GGCTGCCCGGGTTCCCAGGAAGG - Intronic
948653648 2:239464056-239464078 TGAGGGCCGGGGCCCCTGGAGGG + Intergenic
948711409 2:239827798-239827820 GGTGGCCCGGGGCCCCAGGGTGG - Intergenic
948826578 2:240575982-240576004 TGAGGGCTTGGGGCCCAGGAAGG + Intronic
949041584 2:241852202-241852224 TGCGGCCCGGGAGCAGATGACGG + Exonic
1171228840 20:23465780-23465802 TTCAGCCTGGGGGCCCAGCATGG + Intergenic
1171385477 20:24766940-24766962 AGTCGGCCGGGGGCCCAGGAGGG + Intergenic
1172441840 20:34971535-34971557 AGCTGCCCAGGGCCCCAGGAGGG + Intergenic
1172714217 20:36951225-36951247 TGCGGCGGGGGTTCCCAGGAGGG - Intronic
1173548097 20:43914679-43914701 GGGGGCCCGGGGGCCCGGGCCGG - Intergenic
1173748831 20:45459848-45459870 TGAGGCCCAGTGGCCCAGCAGGG - Intergenic
1173880299 20:46406622-46406644 TGCGGGGCGGGGTCCCAAGAAGG - Intronic
1174273138 20:49384093-49384115 TGCAGACCGGGGGCCCAGAGAGG - Intronic
1175129210 20:56776532-56776554 GGCGGGCCTGAGGCCCAGGAGGG - Intergenic
1175316968 20:58055215-58055237 TGCAGCCTGGGGGCTGAGGAAGG + Intergenic
1175429583 20:58891891-58891913 CCCGGCCCGGGGGCCCTCGAAGG + Intronic
1175831015 20:61965655-61965677 GGCGGCCGGGGGGGCCAGGGAGG - Intronic
1176092722 20:63326125-63326147 TGGGGCCAGGGGGTCCAGGCAGG - Exonic
1176604712 21:8819763-8819785 TGCAGCTCGGGTGCCCAGGCAGG - Intergenic
1178581886 21:33844967-33844989 TGTGGCCCATGAGCCCAGGAGGG + Intronic
1179226157 21:39455365-39455387 TGCAGCCTGGGGGGCCAGCATGG + Intronic
1179916315 21:44480434-44480456 TGGGGCCTGCGGGGCCAGGAAGG - Intergenic
1179995665 21:44972938-44972960 TGGGGCCCGCGGTCACAGGACGG + Intronic
1180347002 22:11711368-11711390 TGCAGCTCGGGTGCCCAGGCAGG - Intergenic
1180354748 22:11829458-11829480 TGCAGCTCGGGTGCCCAGGCGGG - Intergenic
1180383504 22:12162874-12162896 TGCAGCTCGGGTGCCCAGGCGGG + Intergenic
1180921261 22:19522774-19522796 TGGGGCCCTGGGGCCCGGGATGG - Intergenic
1181121674 22:20671208-20671230 TGGGGCCCGGGGGCGCGGGCCGG - Intergenic
1181334642 22:22118248-22118270 TGGGGCCCGGGGGCGCGGGCCGG - Intergenic
1183393644 22:37560128-37560150 CGCGGCTGGAGGGCCCAGGAGGG + Intergenic
1183427358 22:37746783-37746805 GGCGGCCAGGGGCCCCAGGGAGG + Intronic
1183444424 22:37843876-37843898 AGCGGCGCGGGGGCCCGGGGCGG - Intronic
1183687026 22:39367089-39367111 GGCGGACTGGGGGCCCAGGGAGG - Intronic
1183978390 22:41526161-41526183 GCAGGCCCCGGGGCCCAGGAGGG - Exonic
1184427818 22:44423499-44423521 TCCCACCCGTGGGCCCAGGATGG + Intergenic
1184443581 22:44534219-44534241 TGGGGCCAGGGGGCCCAGCCAGG + Intergenic
1184548106 22:45186910-45186932 TGGGGCACGGGGCCCCTGGAGGG + Exonic
1184679225 22:46061470-46061492 CGCGCCCCGGAGGCCCAGGCGGG - Intronic
1185044849 22:48523680-48523702 GGCATCCCGGGGGCCCAGGAAGG + Intronic
1185269523 22:49922714-49922736 AGCGGCCCGGGGGTGGAGGAGGG + Intronic
1185297631 22:50062141-50062163 TGGGGCCCAGGGGCTCAGGGTGG - Intronic
1185334700 22:50266345-50266367 TTGGGTCTGGGGGCCCAGGAGGG - Intronic
949318843 3:2786334-2786356 TGTGGCCCCGGAGCCCCGGAAGG - Intronic
950316345 3:12004741-12004763 TGCGGCGCGGGCGCCGAGGCGGG - Exonic
950790298 3:15466350-15466372 GGGGGCCTGGGGGCCCCGGACGG + Exonic
952274469 3:31864186-31864208 TGCTGCCTGGGGGGTCAGGAAGG + Intronic
952451795 3:33440161-33440183 TGCGACCGGGGGGCCCCGGGCGG - Exonic
952919418 3:38274795-38274817 TGAGGCCCAGGGGCCTGGGAGGG + Intronic
953183255 3:40615828-40615850 TGCGGCCGGCCGGCCGAGGAGGG - Intergenic
953917782 3:46931595-46931617 TGCTGCCCTGGGCCCCTGGAGGG + Intronic
957145092 3:76413209-76413231 ACAGGCCCGGAGGCCCAGGAGGG - Intronic
960058212 3:113291719-113291741 TGCTTCCCGAGGGCCCTGGAAGG + Exonic
961331740 3:126146706-126146728 TGTGGGCCAGGGACCCAGGAAGG - Intronic
962350224 3:134650976-134650998 TGCGGCCGCGGCGCCCAGGTCGG - Exonic
962923505 3:139971849-139971871 TGGAGCCCAGGGGACCAGGAAGG - Intronic
966722686 3:183080043-183080065 ACAGGCCCGGAGGCCCAGGAGGG - Intronic
967718395 3:192789318-192789340 GGCGGCACAGGAGCCCAGGAGGG - Intergenic
968448731 4:665238-665260 TGCGACCTGGAGGCACAGGAAGG - Exonic
968452566 4:682179-682201 TGGGGTCCTGGGGCCCAGCACGG - Exonic
968659633 4:1793697-1793719 GGCGGCCCGGGAGCCCTGGGCGG + Intronic
968757874 4:2426202-2426224 TGCGGCTCAGGGGCCCAGGCTGG - Intronic
968917660 4:3503896-3503918 AGGGACCCAGGGGCCCAGGAAGG + Intergenic
968956011 4:3719976-3719998 GGCGGCCTGGGAGCTCAGGAAGG - Intergenic
969114455 4:4862369-4862391 TGCTGCCCGGCGGCTTAGGAAGG - Intronic
969115025 4:4866004-4866026 CGCGGGCCGGGGTCCCAGGGAGG - Intergenic
971177001 4:24291714-24291736 AGCGGCTCTGGGGCCCAGAATGG + Intergenic
973373413 4:49271174-49271196 TGCAGCTCGGGTGCCCAGGCGGG + Intergenic
975044273 4:69783116-69783138 TGCTCCCAGGTGGCCCAGGATGG - Intronic
975632986 4:76420930-76420952 CGCGGCCCGGGAGACGAGGATGG - Intronic
980793069 4:137644885-137644907 TGCAGCCCACAGGCCCAGGATGG + Intergenic
981391503 4:144196700-144196722 AGAGGGCCGGGGGCCTAGGAGGG + Intergenic
981708323 4:147684157-147684179 CGCCGCCCGCGGGGCCAGGACGG - Exonic
984639257 4:182144521-182144543 CGCGGCCCGGGGACGCGGGAGGG - Intronic
985622250 5:961781-961803 TGGGGCCTGAGGGCCCGGGACGG - Intergenic
985894200 5:2739370-2739392 TGCGGCCCCAGCGCCCAGGCGGG - Intergenic
988509726 5:31855005-31855027 GGCGGCCCGGGGGCCTGGGGCGG - Intronic
990008591 5:50969447-50969469 TCCCGCCCAGGGGCCCAGGGTGG + Intergenic
990529195 5:56656974-56656996 TGTGGCCTGGGGGCAGAGGAGGG + Intergenic
991090537 5:62689981-62690003 TGCTGCCAGGGGGCCCCGGGAGG + Intergenic
992636003 5:78726575-78726597 TGTAGCCACGGGGCCCAGGACGG + Intronic
998165006 5:139837809-139837831 TGTGGCCCTGGGCCCCAGGTGGG - Intronic
999288248 5:150406986-150407008 TGTGGCCCCGGTGCCCAGGGAGG + Intronic
1000226481 5:159266651-159266673 ACAGGCCCGGAGGCCCAGGAAGG + Intronic
1001641881 5:173250170-173250192 TGCCAGCCTGGGGCCCAGGATGG - Intergenic
1002106107 5:176880099-176880121 CTCGGCCCCAGGGCCCAGGAGGG + Exonic
1002441496 5:179266759-179266781 GGGGGCTGGGGGGCCCAGGATGG - Intronic
1002925634 6:1604544-1604566 CGCGGTGCGGGCGCCCAGGACGG + Intergenic
1006091598 6:31631898-31631920 TGCGGCCTCGGGGAGCAGGAGGG - Exonic
1006296205 6:33171143-33171165 TGGGTCCAGGGGGTCCAGGAGGG + Exonic
1006447011 6:34085263-34085285 TGCTGCCCTGGGGGACAGGAAGG - Intronic
1006644415 6:35506092-35506114 TGCGGCCCTGGGGGGCAGGCCGG + Exonic
1006782756 6:36643326-36643348 TGCTCCCCGTGGGCCCAGGGTGG - Intergenic
1007626843 6:43251555-43251577 AGAGGCCCGGGGGTCCTGGAGGG - Intronic
1007628553 6:43259961-43259983 TGGGGCGCCTGGGCCCAGGAAGG + Intronic
1009437538 6:63635709-63635731 TGCAGCCCGGGGCCCCACGGAGG + Intergenic
1013099586 6:106975218-106975240 TGCGCCCCGGGGACCCGAGAGGG + Intronic
1013289565 6:108708677-108708699 TGAGGATGGGGGGCCCAGGAGGG - Intergenic
1015866284 6:137729988-137730010 TGGGGCCCTGGGGACCAGCATGG - Intergenic
1017819355 6:158038444-158038466 TGCGTAGCGGGGCCCCAGGAAGG + Intronic
1019357079 7:586090-586112 TGCTCCTCAGGGGCCCAGGATGG - Intronic
1019563085 7:1667511-1667533 CGCGCCTCGAGGGCCCAGGAGGG + Intergenic
1019645167 7:2125033-2125055 TGTGGGCCGGGAGCCCAGCAGGG - Intronic
1019921567 7:4166692-4166714 TCCGGCCCGGGGGACCACGGTGG + Intronic
1022095611 7:27139404-27139426 TGCAACCCGGGGGCCCAGCCTGG + Intronic
1022423552 7:30246411-30246433 TGTGCCTTGGGGGCCCAGGAAGG - Intergenic
1022528515 7:31053037-31053059 TGCGGCCGGAGGGACCCGGAGGG + Intronic
1023138124 7:37074521-37074543 TGTGGCCTGGGTTCCCAGGAGGG + Intronic
1023991782 7:45132977-45132999 TGGGGCCCGGGGGGCCAGGAGGG + Intergenic
1024263887 7:47592130-47592152 TGCGGAGCAGGGGCCCAGGCTGG - Intergenic
1024676967 7:51645882-51645904 TGGGGCCCGCGGGGCCAGGACGG - Intergenic
1024965697 7:55020236-55020258 TTCGGCGCGGGCGCCCAGGAGGG - Intronic
1025035506 7:55590657-55590679 TGAGTCCAGGGGGTCCAGGAGGG - Intergenic
1026877258 7:73886821-73886843 TGGGGCCAGGGCCCCCAGGAAGG - Intergenic
1027138033 7:75638685-75638707 TGCGGGCAGGGGGCTCCGGAGGG + Intronic
1029151956 7:98486589-98486611 TGAGGAACTGGGGCCCAGGATGG + Intergenic
1029494647 7:100890337-100890359 TGCGGCCAGGGCGCCCAGCGAGG + Exonic
1032298933 7:130668819-130668841 TGCGTCCCGGGGGCCGAGGGCGG - Exonic
1033173948 7:139108555-139108577 GACGGACCGGGGGCCCAGGGCGG + Intronic
1033218162 7:139509208-139509230 TGGGGCCCGGGTACCAAGGAAGG + Intergenic
1034424613 7:151007904-151007926 TGCTGTCCCGGGGCCCAGGCTGG + Intronic
1035203113 7:157279286-157279308 CGCGGCCCGGGGACGCGGGAGGG + Intergenic
1035315767 7:157997047-157997069 GCCGGCACGGGGGCCCAGGGAGG + Intronic
1035338262 7:158143899-158143921 TGCTGCCTGGGAGCTCAGGAAGG - Intronic
1035589473 8:802065-802087 TGAGGACGGAGGGCCCAGGAGGG - Intergenic
1036033250 8:4994127-4994149 GGTGGGGCGGGGGCCCAGGAGGG + Intronic
1036133745 8:6140124-6140146 TGCCGCTAGGGGGCCCAGGAGGG - Intergenic
1036823088 8:11955411-11955433 AGCAGCCTGGGGGCTCAGGACGG + Intergenic
1038052560 8:23827450-23827472 CCTGGCCCAGGGGCCCAGGATGG + Intergenic
1038632944 8:29262945-29262967 TCCGCCCCGGCGGCCCAGGAGGG + Intronic
1048790057 8:138093546-138093568 AGAGGCCCAGGGGCCTAGGAGGG - Intergenic
1048851518 8:138649739-138649761 GGAGGCCTGGGGGGCCAGGAGGG + Exonic
1049451423 8:142664187-142664209 TGTGGCTCGGGTGCCCAGGACGG - Intronic
1049454459 8:142680083-142680105 TGCGGGCCGTGGGCCCCAGAGGG + Intronic
1049619092 8:143589755-143589777 TTCGGCCGAGAGGCCCAGGAGGG + Exonic
1049671888 8:143873633-143873655 TGGGACCAGGGTGCCCAGGAAGG - Intronic
1049694707 8:143977498-143977520 AGCGGCCCGGGAGCCCAGAGGGG + Exonic
1050173248 9:2844111-2844133 AGCGGCCCGGGGGCGGAGCAAGG - Exonic
1053010005 9:34627765-34627787 TGGGGCCCTGGGCCCCTGGACGG + Exonic
1053167313 9:35853788-35853810 TGGGCCTCGTGGGCCCAGGAGGG + Exonic
1055508329 9:76970589-76970611 AGCTGCCAAGGGGCCCAGGAAGG - Intergenic
1057187148 9:93063242-93063264 TGAGGCCCAGGGCCCCAGTAGGG + Intronic
1058429258 9:104903705-104903727 TGTGGCTCGGGAGCCCTGGAAGG + Exonic
1060917387 9:127399093-127399115 GGTGGCCTGTGGGCCCAGGAGGG + Intronic
1060979769 9:127785552-127785574 GACGGCCCGAGAGCCCAGGAGGG - Intergenic
1061391696 9:130320501-130320523 TGCTCCCCGGGGGCACAGCAAGG + Intronic
1061538821 9:131266378-131266400 TGGGGCCCTGGAGCCCAGGGAGG - Intronic
1061897254 9:133654930-133654952 CGCGGCCCCGGGGCCAGGGATGG + Intronic
1062193672 9:135260757-135260779 TGGGGGCCAGGGGCCAAGGAGGG + Intergenic
1062525045 9:136974805-136974827 TGCTGGCCGGGGCCCCAGGGTGG + Intergenic
1203697122 Un_GL000214v1:109177-109199 TGCAGCTCGGGTGCCCAGGCGGG + Intergenic
1203552090 Un_KI270743v1:171852-171874 TGCAGCTCGGGTGCCCAGGCGGG - Intergenic
1192244612 X:69362209-69362231 TGGGGCCCAGGGACCCAGGGTGG - Intergenic
1194787747 X:98107034-98107056 TGCTGCCAGGGGGCCCAGGAGGG + Intergenic