ID: 903951756

View in Genome Browser
Species Human (GRCh38)
Location 1:26999686-26999708
Sequence TGGGACTCCTGGGGAAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 457}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903951756 Original CRISPR TGGGACTCCTGGGGAAGCAG AGG (reversed) Intronic
900034182 1:393271-393293 TGGGTCTCCTGATGAAGCTGAGG - Intergenic
900055018 1:623161-623183 TGGGTCTCCTGATGAAGCTGAGG - Intergenic
900197092 1:1381949-1381971 TGGGGCTCCTGGGGAACCACTGG + Intergenic
900391745 1:2436656-2436678 TGGGAGGCCTGGAGAGGCAGGGG + Intronic
900431757 1:2606043-2606065 TGGGCCTCCTGGCCAAGCTGGGG - Intronic
900480978 1:2899206-2899228 TGGGACCCCTGAGCAAGCATGGG + Intergenic
900543989 1:3218386-3218408 GGGGATACCTGGGGAAGCTGGGG - Intronic
900673520 1:3870151-3870173 AGGGACACCTGGGAAGGCAGCGG - Intronic
900740592 1:4328574-4328596 GGGGACCACTGCGGAAGCAGAGG + Intergenic
901452959 1:9346987-9347009 TGAGAATCCTGGGGAAGCTTTGG - Intronic
901467373 1:9431032-9431054 TGGGATTCTTTGGGAAGCCGAGG + Intergenic
901501567 1:9655599-9655621 TGTGACTTCTGGGGAGGGAGGGG - Intronic
901641488 1:10695093-10695115 CGGGGCTCCTGGGGTAGCACAGG + Intronic
901838571 1:11939476-11939498 TGGGACTGCTTGGGGAGGAGGGG + Intronic
902194653 1:14789398-14789420 TGGGGCATGTGGGGAAGCAGAGG - Intronic
902362627 1:15950506-15950528 TGGGGCTCCTGGGTATGTAGGGG - Intronic
902801155 1:18831042-18831064 AGGGTCTCCTGGGGAAGCCCAGG + Intergenic
903009485 1:20319810-20319832 GGGCACCCCTGGGGATGCAGAGG - Intronic
903070973 1:20726878-20726900 GGGGACCCCAGGGGAAGCACGGG + Intronic
903183846 1:21618728-21618750 GGGGACGCCTGGAGAGGCAGGGG + Intronic
903256492 1:22105417-22105439 TGGGGCTCCGGAGGAGGCAGTGG + Intergenic
903299948 1:22371718-22371740 AGGGTCTCCTGGGAAGGCAGTGG - Intergenic
903341020 1:22654323-22654345 TGGGCTTCCTGGGGAAGCCAGGG - Intronic
903539757 1:24090270-24090292 TGGGACTCCTGAGAAAGCTGAGG - Intronic
903801558 1:25972522-25972544 TGGGGCTCTTGGGGCAGCTGTGG - Intronic
903951756 1:26999686-26999708 TGGGACTCCTGGGGAAGCAGAGG - Intronic
903996321 1:27307380-27307402 TGGGGCTGCTGGGGAGGGAGGGG - Exonic
904035434 1:27556241-27556263 TGGCTCCCCTGGGGAGGCAGTGG - Intronic
904422737 1:30404632-30404654 GGGGGCACATGGGGAAGCAGGGG - Intergenic
904466319 1:30710022-30710044 TGGGACTCCTGGAGCACCAATGG + Intergenic
904622399 1:31783197-31783219 CAGGAATCCTGGGGAAGCAGAGG + Intergenic
905107653 1:35573912-35573934 GGGCGCTCCTGGGGAAGGAGAGG - Exonic
905923457 1:41733885-41733907 TGGGACACCTGGAGGAGCTGAGG - Intronic
907312360 1:53546176-53546198 AGGGACGCCTGAGGAGGCAGGGG + Intronic
908678531 1:66632956-66632978 TGGGAATGCTGGGGAAGGGGAGG + Intronic
908710251 1:67006575-67006597 TAGGAATACTGGGGAAGCACAGG + Intronic
909609737 1:77539625-77539647 GGGGACTGCAGGAGAAGCAGGGG + Intronic
910369325 1:86499098-86499120 AGTGACTCCTGGGGAAGAACTGG + Intronic
912949829 1:114112960-114112982 TGAGTCTCCTGGGGCAGCTGAGG + Intronic
913268066 1:117064631-117064653 TGGGACTACTTGGGAGGCTGAGG - Intronic
915243283 1:154539218-154539240 TGGGATTCCTGGTGTAGAAGAGG + Intronic
915460242 1:156066138-156066160 TGGGAGTTCTGGGGAAGTCGAGG + Intronic
916816372 1:168357255-168357277 TGCAAATCCTGGGTAAGCAGAGG + Intergenic
917066533 1:171100744-171100766 TGTGAATCCTTGGGAACCAGAGG + Intronic
919902867 1:202056966-202056988 TGGGCCTCCTGGGGAACCATGGG + Intergenic
920045091 1:203127814-203127836 AGGGATTCCTGGGGAAGCCAAGG - Exonic
920081155 1:203373709-203373731 GGGGACCCCTGGGGAGGCTGAGG + Intergenic
920088366 1:203434432-203434454 TGGGTGCCCTGGGCAAGCAGGGG - Intergenic
920345805 1:205305024-205305046 TGAGACCTCTGGGGAAGGAGGGG - Intronic
920548721 1:206840162-206840184 AGGGAGCCCTGGGGAAGCAGTGG - Intronic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921655978 1:217737767-217737789 TGGGGCTCTTTGTGAAGCAGTGG - Intronic
921818887 1:219594164-219594186 TGGGACTGGTGCAGAAGCAGGGG - Intergenic
922120608 1:222664020-222664042 AGGGACTCCTGGGAAAGGAGGGG - Exonic
922256537 1:223897440-223897462 TGGGTCTCCTGATGAAGCTGAGG - Intergenic
922440911 1:225653861-225653883 TGGGATTCCTCGGGAAGAAAAGG - Intergenic
922919495 1:229290122-229290144 TGGGACTCCAGAGGAAGAAATGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1065756633 10:28936577-28936599 TGGGACTCCTTTGAGAGCAGAGG + Intergenic
1067085272 10:43234842-43234864 TCGGACCCCTGAGGAGGCAGGGG - Intronic
1067347704 10:45448570-45448592 TGAGACTACTCGGGAAGCTGAGG + Intergenic
1067723708 10:48750302-48750324 TGGGAATCATGGGAAAGCACTGG - Intronic
1070557500 10:77539820-77539842 TTGCATTGCTGGGGAAGCAGTGG + Intronic
1070791606 10:79192801-79192823 TGGGGCCCCTGGGTAGGCAGTGG - Intronic
1070891053 10:79942440-79942462 AAGGTCCCCTGGGGAAGCAGGGG - Exonic
1072058141 10:91781425-91781447 TGTGAGTTTTGGGGAAGCAGAGG - Intergenic
1072550552 10:96474118-96474140 TGGGAGTCCTGGGCAGGCATTGG - Intronic
1072766125 10:98096514-98096536 CGGGGCTCCTGGGGGACCAGTGG + Intergenic
1074424935 10:113342426-113342448 CTGGTCTCCTGGGGAAACAGTGG + Intergenic
1074588941 10:114794052-114794074 TGGGATCCATGGAGAAGCAGCGG - Intergenic
1074828131 10:117229153-117229175 AGGGAATGCTGGGGAAGGAGGGG + Intergenic
1074828587 10:117232281-117232303 AGGGAATGCTGGGGAAGGAGGGG + Intergenic
1075390501 10:122087597-122087619 AGGCGCTGCTGGGGAAGCAGAGG + Exonic
1075635433 10:124027247-124027269 TGGGACCCCTGGAGGAGCGGTGG + Intronic
1077498882 11:2900010-2900032 TGGGACTCCTGGGGGAGGATGGG - Intronic
1077752636 11:4989687-4989709 TGTGTCTCCTGGGTAAGGAGTGG - Exonic
1077920572 11:6639139-6639161 TAGGACTACTTGGGAAGCAAAGG - Intronic
1079143307 11:17828824-17828846 AGGGACTCTCGGGGAAGCAGGGG - Intronic
1079217665 11:18528214-18528236 AGGGACTCCTGGTTAAGCCGTGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1082203043 11:49396989-49397011 TGAGACTTCTGGGGAACCTGAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083267880 11:61555314-61555336 TGGGACTTTGGGGGCAGCAGGGG - Intronic
1083420763 11:62551798-62551820 TGTCACTTCTGGGGAAGCTGGGG - Intronic
1083619855 11:64043479-64043501 GGTGACTCCTGGGGGAGCTGGGG + Intronic
1083752002 11:64766064-64766086 AGGGGCTCCTGGAGAAGCTGCGG + Intronic
1084163313 11:67363114-67363136 CAGGAGTCCTGGGGAAGCTGGGG + Intronic
1084302115 11:68258687-68258709 TTGGACTCAGGGGGAAGCACAGG + Intergenic
1084363554 11:68684202-68684224 TGGGACCCCGGGGGGAGCAGTGG + Intronic
1084617544 11:70246472-70246494 TGGGAAAGCTGGGGAAGGAGGGG + Intergenic
1084708671 11:70830514-70830536 TTGGAGAGCTGGGGAAGCAGAGG + Intronic
1084954684 11:72685014-72685036 TGGGCGTCCTGGGGTAGGAGGGG - Intergenic
1085015348 11:73170161-73170183 TGGGAGTCCTGGGCAATGAGGGG + Intergenic
1085416210 11:76320745-76320767 TGGGTTTCCTTGGGAGGCAGAGG - Intergenic
1086786824 11:90979352-90979374 GGGGCCTGCTGGAGAAGCAGAGG - Intergenic
1088677250 11:112206294-112206316 AGGCACTCCTGGGGCGGCAGGGG + Intronic
1090242819 11:125196020-125196042 TGGGTCTGCTTGGGAAGCTGGGG + Intronic
1090265530 11:125350904-125350926 GGGTCCTCCTGGGGAAGGAGGGG + Intronic
1091582070 12:1796271-1796293 TGGGACTGCTGGGAAGGCCGTGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1096195735 12:49647797-49647819 TAGGCCTCCTGGGGAAGGGGTGG + Exonic
1096239844 12:49953947-49953969 TGGGCATCCTGGGGGATCAGGGG + Intronic
1096247834 12:50004171-50004193 AGATATTCCTGGGGAAGCAGAGG + Intronic
1096659857 12:53117672-53117694 TGGGAGGCCTGGGGAGGCAGTGG + Intronic
1096660122 12:53118996-53119018 TGGGAGGCCTGGGGAGGCAGTGG + Intronic
1097296007 12:57963757-57963779 GGGGACTTGTGGGGAAGAAGAGG + Intergenic
1097492454 12:60287254-60287276 TTGGACCCTTGGGGAAGCACAGG + Intergenic
1099346933 12:81512690-81512712 TGGGACTTGTGGGGAAGAATGGG - Intronic
1099980188 12:89591011-89591033 TGGGCTTCCTGGGGATGAAGAGG + Exonic
1100243147 12:92729870-92729892 TGAGACTCCTGGGGATGCCTTGG - Intronic
1101469877 12:104986402-104986424 TGGGACTCCTGAGGAATCCCGGG - Exonic
1101710028 12:107256640-107256662 AGGGACATCTGGGGCAGCAGGGG - Intergenic
1101826825 12:108226975-108226997 GGGTACTCCTGGGGATGGAGTGG - Exonic
1102258298 12:111428710-111428732 TGGGTCTGCAGGGGAGGCAGAGG + Intronic
1102899392 12:116624684-116624706 TGGGTATCCTGAGGAAGCTGCGG + Intergenic
1102993481 12:117330965-117330987 TGGGATTTCTGGTGAAGGAGCGG - Exonic
1103039598 12:117684291-117684313 TGGGAGTGCTGGGAAGGCAGGGG + Intronic
1103327169 12:120129403-120129425 TGGGGGTCCAGGGGAGGCAGTGG + Exonic
1103493786 12:121345059-121345081 TTAGACTCCAGGGGTAGCAGTGG + Intronic
1104418416 12:128614976-128614998 TGGTTCTCCTGGGGCAGCTGTGG - Intronic
1104987015 12:132603016-132603038 TGGGAAGCCTGGGGAGGCACAGG - Intergenic
1105327668 13:19384618-19384640 TGGGGCTCCTGGGGGAGGTGGGG + Intergenic
1105864233 13:24445060-24445082 TGGGGCTCCTGGGGGAGGTGGGG - Intronic
1106077674 13:26475376-26475398 GGGGCCCCCTGGGGAAGCAAGGG + Intergenic
1106101261 13:26696399-26696421 TGGCGGTCCTGGGGATGCAGTGG - Intergenic
1107645809 13:42493193-42493215 GGGGACTACTGGGGAGGCTGAGG + Intergenic
1108029226 13:46211775-46211797 TGGGGCTGCAGGGGAAGCTGCGG - Intronic
1108708003 13:53007289-53007311 TGGGACACCTTGGGAGGCACAGG - Intergenic
1110412741 13:75221636-75221658 GGGGACCACTGGGGAGGCAGGGG + Intergenic
1112256901 13:97842280-97842302 TGGGTTTGCTGGGGCAGCAGGGG + Intergenic
1112501699 13:99947884-99947906 TGTAATTCCTGGGGAAGCCGAGG - Intergenic
1112672743 13:101659839-101659861 TTGGACCTCTGGGGAAGGAGAGG + Intronic
1113471882 13:110552885-110552907 TGGGAATCCTGGGGTGCCAGGGG - Intronic
1113917288 13:113882035-113882057 TGGGCATCCTGGGGAAGCTCAGG + Intergenic
1113969712 13:114179487-114179509 CAGGACTCCAGGGAAAGCAGAGG - Intergenic
1117539569 14:56733471-56733493 TGGGACTCCTGGAGAGGCAGAGG - Intergenic
1118593479 14:67418950-67418972 TGGCACTGGTGGGGAAGCAATGG - Intergenic
1118772132 14:68949254-68949276 TGGGAGCCCTGGGGAGGCACGGG - Intronic
1118841862 14:69519524-69519546 GGGGACTACTGGGGAAGGAAGGG + Intronic
1119385491 14:74255700-74255722 TGGAACTCCTGGGGAAGCCAGGG + Intronic
1119395811 14:74325633-74325655 TGGGACTCCTGAGTAGACAGGGG - Intronic
1119733348 14:76965157-76965179 TGCGGCCCCTGGGGAAGCAAAGG - Intergenic
1120490831 14:85176758-85176780 TGTGAGTGCTGGGGAAACAGTGG - Intergenic
1121271282 14:92639705-92639727 TCGGACTAATGGGGAAACAGGGG - Intronic
1121957989 14:98231434-98231456 GGGGAGTCCTGGGGAGGCTGAGG + Intergenic
1122245914 14:100403417-100403439 TGGGACTCCTGGGAAGGAACTGG + Intronic
1122792662 14:104190879-104190901 TGGGAGTGCTGGGGAGGCCGGGG + Intergenic
1122977480 14:105176856-105176878 GGGGGCTCCAGGGGAAGCTGAGG - Intronic
1122978061 14:105179086-105179108 TGTTACTCGGGGGGAAGCAGTGG - Intronic
1123042606 14:105496513-105496535 TGGGTTCCCGGGGGAAGCAGGGG + Intronic
1123629345 15:22250505-22250527 GGGGATTCCTGAGGAAGCAGAGG - Intergenic
1123783070 15:23645836-23645858 TGGGCCTCCTGGGCAGGCAGGGG + Exonic
1123992986 15:25697053-25697075 GGGGATTCTTGGGGAACCAGAGG + Intronic
1125497203 15:40207952-40207974 TGGGACTACTTGGGAGGCTGAGG - Intronic
1125724780 15:41862656-41862678 AGGGACTGCGGGGGAAGCCGGGG + Exonic
1126105058 15:45141960-45141982 GGGGTCTCCTGGGAAGGCAGAGG - Exonic
1126745774 15:51824982-51825004 TAGGAATCCTATGGAAGCAGTGG - Intergenic
1127277376 15:57459132-57459154 TGGAACCCCTGGGTAATCAGAGG - Intronic
1128117977 15:65124129-65124151 TGGCACTCCTGGGGCGGGAGTGG + Intronic
1129228005 15:74180956-74180978 TGGCAATGCTGGGGGAGCAGGGG + Intronic
1129330183 15:74823160-74823182 GGGGAGTCCTGGGGATGCTGTGG + Intronic
1129605781 15:77024352-77024374 GTAGACACCTGGGGAAGCAGAGG - Intronic
1129710276 15:77817267-77817289 TGGGCCACCTGGGGAGGAAGTGG + Intronic
1130678758 15:85978015-85978037 TGGGAATGCTGGGGAATAAGTGG + Intergenic
1132727635 16:1345705-1345727 TGGGTTTGCTGGGGAGGCAGGGG - Intronic
1132761675 16:1511472-1511494 AGAGCCTCCTGGGGAGGCAGAGG + Intronic
1132764239 16:1526323-1526345 CGGGACTTCTGGGGAGGCTGTGG - Intronic
1132872419 16:2121823-2121845 GGTGACACCTGGGGAAGTAGAGG - Intronic
1133026033 16:2989376-2989398 TGGGGTTCAGGGGGAAGCAGGGG - Intergenic
1133125057 16:3641295-3641317 TGCGATTCCTGGGGAGGCTGAGG + Intronic
1133983101 16:10648147-10648169 TGGAATTCCTGTGTAAGCAGAGG + Intronic
1134271964 16:12740711-12740733 TGAGAATGCTGGGGGAGCAGGGG + Intronic
1134466556 16:14483993-14484015 TGGGACTCCAGGGGAAGGACAGG - Intronic
1134551475 16:15140905-15140927 GGTGACACCTGGGGAAGTAGAGG - Intergenic
1134842391 16:17412284-17412306 TAGCACTCCTGGGGGTGCAGAGG + Intronic
1136997948 16:35203585-35203607 GGGGACCCCTGGGCAGGCAGTGG + Intergenic
1137396022 16:48116719-48116741 TGGGGCTCCTGGGCAAGGTGAGG + Intronic
1138496466 16:57412055-57412077 TGGGACCCCCAGAGAAGCAGAGG + Intronic
1138584507 16:57961140-57961162 ATGGCCTCCTGGGGCAGCAGGGG + Intronic
1139488407 16:67272077-67272099 TGGGATGCCTGGCTAAGCAGGGG + Exonic
1139559820 16:67734889-67734911 GGGCACTGATGGGGAAGCAGTGG + Exonic
1140765651 16:78154380-78154402 TGGGACTCCTCTGTAGGCAGCGG - Intronic
1142233315 16:88909921-88909943 TTGGATTTCTGGGGAACCAGAGG + Intronic
1142567962 17:852854-852876 TAGGCATCCTGGGGAAACAGTGG - Intronic
1142753137 17:2000161-2000183 AGGGACACCTGGGGCAGCGGTGG - Intronic
1143653461 17:8278847-8278869 TGGGCCTCCTGCGGAGACAGAGG - Intergenic
1144670161 17:17128293-17128315 TGGGTCTCCAGGGCAAGCTGGGG + Intronic
1146372036 17:32270682-32270704 TGGGACCCATGGGGAAGAATCGG - Intronic
1146672872 17:34754061-34754083 TGAGTCTGGTGGGGAAGCAGGGG - Intergenic
1146684239 17:34829883-34829905 TGGGGAGCATGGGGAAGCAGAGG + Intergenic
1147560120 17:41503598-41503620 AGAGACTCCTGGGAAAGGAGAGG + Intronic
1148741678 17:49896897-49896919 AGGGCATCCTGGGGAAGAAGAGG - Intergenic
1148810527 17:50287769-50287791 TGGGACTACTTGGGAGGCTGAGG + Intergenic
1148871059 17:50659001-50659023 TGGGACACCTGGGGAGGAGGAGG + Intronic
1150776670 17:68086902-68086924 TGGGCCTCCCGGGAAAGGAGAGG - Intergenic
1150797296 17:68248293-68248315 CGAGGCTCCTGGGGAAGAAGAGG + Exonic
1151046870 17:70930588-70930610 TGGGACTACTTGGGAGGCCGAGG - Intergenic
1151541720 17:74768062-74768084 GGGAGCTCCTGGGGAAGTAGGGG - Intronic
1151944472 17:77312003-77312025 TGGGGGTGCTGGGGAGGCAGAGG - Intronic
1152280667 17:79383319-79383341 TGGGCCGCTTGGGGAGGCAGTGG - Intronic
1152319261 17:79599032-79599054 TGGGTCTCCTGGGGAGGGGGAGG - Intergenic
1152612584 17:81322951-81322973 TGGGACTCCGGTGTCAGCAGAGG - Intronic
1203171001 17_GL000205v2_random:147853-147875 TGGGGCTGCTGGGGAGGCTGAGG - Intergenic
1155240703 18:23861443-23861465 TGGGAGTTCTGGGAAGGCAGTGG - Intronic
1157372261 18:47125712-47125734 TGGTTATCCTGGGGAAGGAGTGG + Intronic
1158551458 18:58439580-58439602 TGAGGCTCCTGGGGAGGCTGGGG + Intergenic
1158580770 18:58680671-58680693 TGGGACACTTGGGGAGGCCGAGG + Intronic
1160527014 18:79544149-79544171 AAGGGCTCCTGGGGCAGCAGCGG - Intergenic
1160661905 19:305207-305229 TGGGTCTCCAGGAGAAGCTGAGG - Intergenic
1160811544 19:1015048-1015070 GGGGAGTGCTGGGGACGCAGCGG - Intronic
1160883173 19:1331771-1331793 TGGGTCCCCTGGGGCAGCTGTGG + Intergenic
1161039144 19:2100752-2100774 GGGGGCTCCTGGGGAAGGGGAGG + Intergenic
1161405587 19:4089604-4089626 TGGGCCTGCTGCGGACGCAGGGG + Intergenic
1161539015 19:4838458-4838480 TGGGCCTCCTGGGGATGGGGTGG - Exonic
1161579234 19:5071597-5071619 GGGGACTCTTGGGAAAGAAGGGG + Intronic
1161686659 19:5706071-5706093 TCTGAGTCCTGGGGGAGCAGAGG - Intronic
1161847025 19:6718059-6718081 GGGGGCCCCAGGGGAAGCAGGGG - Intronic
1163158546 19:15451931-15451953 CGGTGCTCCTGGGGAGGCAGTGG + Exonic
1163262540 19:16199804-16199826 TGGCACCTCTGGGGAGGCAGTGG - Intronic
1163703871 19:18801041-18801063 TGTGACTCCTGGCGATGGAGCGG - Intergenic
1163754905 19:19100917-19100939 TGGGACTCATTGAGAAGCAGGGG - Intronic
1164037294 19:21466281-21466303 TGGGGCTCCTGAGGATGCTGGGG + Intronic
1164599205 19:29549575-29549597 GGGGTCTCCTGGGGCAGCATTGG - Intronic
1164981351 19:32616805-32616827 TGGGACTCCTGGGCCACGAGAGG - Intronic
1165152757 19:33770633-33770655 TGGGCCTCCTTGGTAGGCAGAGG + Intronic
1165164214 19:33840153-33840175 TGGGACTCCTTAGGGAGAAGTGG + Intergenic
1165356868 19:35309879-35309901 TGGGACTCCAGGAGGAGCACAGG - Exonic
1165363367 19:35350244-35350266 TGGGGCTAGTGCGGAAGCAGAGG + Intergenic
1165397137 19:35570656-35570678 TGGGAGACCTTGGGAAGAAGTGG + Intergenic
1165685819 19:37818659-37818681 TGGGACTACTCGGGAGGCTGAGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166496098 19:43304395-43304417 TGGGTCTCCTGGGGAAAATGGGG - Intergenic
1166533022 19:43553676-43553698 GGGGAGTCCTGGGAAAGGAGGGG + Exonic
1166823292 19:45593765-45593787 TGGGATTCTTGGGTAAGGAGTGG - Intronic
1167537725 19:50065727-50065749 TGGGGGTACTGGGGAAGCAGGGG + Intergenic
1167605283 19:50478704-50478726 TGGGTCACCTGGTGAGGCAGAGG + Intronic
1167620711 19:50558852-50558874 TGGGACTCATGGAGAAGCCAGGG + Intronic
1167672046 19:50859089-50859111 TGCGGCACCTGGGGGAGCAGAGG + Intronic
1167674791 19:50877502-50877524 TGCGGCACCTGGGGGAGCAGAGG + Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925033631 2:670870-670892 TGGGCATCCTGGGGAAGCGTGGG - Intronic
925302321 2:2826215-2826237 TGGAGCTCCTGCGGAAGGAGAGG - Intergenic
925441423 2:3889832-3889854 GGGGACTCAGGGGGAAGCATAGG - Intergenic
927290739 2:21402560-21402582 CCTGACTCCTGTGGAAGCAGAGG + Intergenic
927705516 2:25294203-25294225 TGGGACTCCTAAGGATGCCGGGG - Intronic
927981239 2:27376464-27376486 GGTGACTCCTGGGGAAGAAGAGG - Exonic
928391352 2:30913271-30913293 TGGGTCCCCTGGGGAAGCTGCGG + Intronic
928425283 2:31172686-31172708 TGTCACTCCAGGGGAAGCAGGGG - Intergenic
928575822 2:32653999-32654021 TGGGACCCTTGGGGAAGAACTGG - Intronic
929832481 2:45358290-45358312 TGAGAATCATGGGGAACCAGGGG - Intergenic
929943342 2:46351889-46351911 TGGGACTTCCTGGGCAGCAGGGG - Intronic
931933696 2:67170903-67170925 TGGGGCTCCAGAGAAAGCAGAGG + Intergenic
933793504 2:85902395-85902417 CGGGAGTCCTGGGGAAGGGGAGG - Intergenic
933975296 2:87504580-87504602 TGGGACTTCAGGCCAAGCAGGGG + Intergenic
934036679 2:88094173-88094195 TGGGAATGCTGGGGTAGAAGTGG + Intronic
934664814 2:96163047-96163069 TGGGGCTGCTGGGGAAGTGGGGG + Intergenic
934704040 2:96463867-96463889 GGGGGCTCTGGGGGAAGCAGAGG + Intergenic
934847808 2:97673604-97673626 TCGGCCTGCTGGGGAAGAAGTGG - Intergenic
936318530 2:111446233-111446255 TGGGACTTCAGGCCAAGCAGGGG - Intergenic
936855929 2:116957310-116957332 TGTGACTCCTGGTGGAGCAAGGG - Intergenic
937071401 2:119066520-119066542 TGGCACCCCTGGTGAATCAGTGG - Intergenic
937855635 2:126670471-126670493 AGGCATTGCTGGGGAAGCAGAGG - Intronic
938278457 2:130048702-130048724 TGGGACTACTGTGGGAACAGGGG - Intergenic
938322266 2:130373114-130373136 TGGGTCTCATGGAGAAGCTGAGG - Intronic
938329432 2:130439561-130439583 TGGGACTACTGTGGGAACAGGGG - Intergenic
938360516 2:130681942-130681964 TGGGACTACTGTGGGAACAGGGG + Intergenic
938436919 2:131288650-131288672 TGGGACTACTGTGGGAACAGGGG + Intronic
941070408 2:160948420-160948442 TGGGACTTCTGTGCAAGCACTGG - Intergenic
941109674 2:161405289-161405311 TGGATCACCTGGGGAAACAGAGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942294187 2:174501692-174501714 AGGGATTACTGCGGAAGCAGTGG - Intergenic
942394479 2:175532908-175532930 GGGGACTACCGGGGAAGGAGGGG + Intergenic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
945460669 2:210104180-210104202 TGACACTCCTGGGGAACCTGAGG + Exonic
946024651 2:216664626-216664648 TGGGAGTCCTGGGGCTGCACTGG - Intergenic
946095468 2:217270681-217270703 TGTGACTCCTGGGAAACCTGGGG - Intergenic
946285180 2:218697389-218697411 TGGGAGCTGTGGGGAAGCAGGGG + Intronic
946331590 2:219012407-219012429 TGGGGCTGCTGGGAAGGCAGAGG + Intronic
946897377 2:224338364-224338386 TGGGAATCTCAGGGAAGCAGTGG - Intergenic
947822732 2:233083276-233083298 TGGGAGTGGTGGGGAAGGAGGGG + Intronic
948686632 2:239674512-239674534 TGGAACCCCTGGGGAAGGTGTGG + Intergenic
948822786 2:240558251-240558273 TGGGACACCTGAGGAAACTGAGG + Intronic
948859225 2:240744907-240744929 CTGGGCTCCTGGGGCAGCAGGGG - Intronic
948921553 2:241068296-241068318 TGGGACTCCTGGGAGAGCTCGGG - Intronic
948921570 2:241068368-241068390 TGGGACTCCTGGGAGAGCTCGGG - Intronic
1168841388 20:912187-912209 TGGGACACCTGGGGCAACTGGGG + Intronic
1169023296 20:2346648-2346670 TGGTACTGGTGGGGAAGCTGAGG + Intergenic
1169392736 20:5203461-5203483 TTGGTCTCCTGGGAAAGGAGAGG + Intergenic
1169949885 20:11032216-11032238 TCGTACTCCTGGGAAACCAGTGG + Intergenic
1170080683 20:12471048-12471070 GGGGAGTCATGGAGAAGCAGTGG - Intergenic
1170767731 20:19305198-19305220 GGGGACTCCTGGGGAGGCTGAGG - Intronic
1171372089 20:24668644-24668666 AGGGACGCCTGGGGAGGCGGGGG - Intergenic
1171486753 20:25491118-25491140 TGGGAGTGGTGGGGAAGGAGGGG + Intronic
1172183858 20:33019565-33019587 CGGGCCACCTGGGGAGGCAGAGG - Exonic
1172262631 20:33581538-33581560 TTTGAATCCTGGGGAACCAGAGG + Intronic
1173060053 20:39652044-39652066 TGGGTCTCCTGGGGAGGCGACGG + Intergenic
1173685162 20:44918430-44918452 TGGGTGCACTGGGGAAGCAGGGG - Intronic
1173926385 20:46784447-46784469 TGGGTCTCCCGGGGGGGCAGGGG - Intergenic
1174327539 20:49791265-49791287 TGGTCCTTCTGGGGAAGCATGGG - Intergenic
1175257475 20:57656056-57656078 GGGGACTCCAGGGGAAGAATGGG - Intronic
1175465044 20:59185126-59185148 TTGGACTGATGGGGAAGCTGGGG - Intergenic
1175551679 20:59821984-59822006 TGGGATTGCTGGGGAAGGGGTGG - Intronic
1175853682 20:62107415-62107437 AGGGGCTCCTGGGAAGGCAGGGG + Intergenic
1176084488 20:63289845-63289867 TGGGACCCCCGGGAAGGCAGGGG + Intergenic
1176326985 21:5509684-5509706 TGGGGCTGCTGGGGAGGCTGAGG - Intergenic
1176400772 21:6311267-6311289 TGGGGCTGCTGGGGAGGCTGAGG + Intergenic
1176436385 21:6677837-6677859 TGGGGCTGCTGGGGAGGCTGAGG - Intergenic
1176460647 21:7004907-7004929 TGGGGCTGCTGGGGAGGCTGAGG - Intergenic
1176484208 21:7386685-7386707 TGGGGCTGCTGGGGAGGCTGAGG - Intergenic
1177176600 21:17706124-17706146 TGGCATTCCTGAGGAAGAAGAGG + Intergenic
1179108987 21:38429039-38429061 GGGGACTCTGGGGGAAGCATGGG - Intronic
1179815525 21:43903724-43903746 TGGGCCTCCTGGCCAGGCAGTGG + Intronic
1180055936 21:45359245-45359267 AGGGACTCCTGGGGCTGCAATGG - Intergenic
1180998394 22:19976725-19976747 TGGGAGGCCGGAGGAAGCAGAGG + Intronic
1181287709 22:21766287-21766309 CTGGCCTCCTGGGGAAGCAAGGG + Intronic
1181917489 22:26292612-26292634 CGGGCCTCCTCTGGAAGCAGCGG - Exonic
1181957974 22:26602014-26602036 TGGGCATCCTGGGGAAAGAGAGG + Exonic
1182554147 22:31119995-31120017 TGGAGCTCCTGGAGAGGCAGTGG - Exonic
1183086573 22:35490686-35490708 CGGGACCCCTGGGAAAGGAGGGG - Intergenic
1184873446 22:47257373-47257395 TGGGACTTCTGGGGGAGATGGGG - Intergenic
1185032865 22:48453900-48453922 TGGGAGACATGGGGAGGCAGGGG - Intergenic
1185390455 22:50558313-50558335 TGGGATTACTGGGGAGGCTGAGG + Intronic
950778207 3:15368715-15368737 TGGGGCAACTGTGGAAGCAGGGG - Intergenic
952966275 3:38623023-38623045 TGCTACCCCTGGGGAGGCAGGGG + Intronic
953563388 3:44012088-44012110 GGGGACACCTGGGGAATGAGAGG - Intergenic
953568575 3:44053760-44053782 TGGCACTCCTGGAGAAGCTCTGG - Intergenic
953662990 3:44904519-44904541 TTGTACAGCTGGGGAAGCAGAGG + Intronic
953696407 3:45163481-45163503 TGGGACTCCTGGGGTCGGATGGG + Intergenic
954072692 3:48154517-48154539 TGGGGCTCCAGAGCAAGCAGTGG - Intergenic
954398008 3:50303235-50303257 AGTGGCTCATGGGGAAGCAGGGG - Exonic
954674172 3:52306610-52306632 TGGGACTCCTGGGGCTGGATAGG + Intergenic
954901154 3:54021207-54021229 TGGGCCTCGTGGTGAAGCAGGGG + Intergenic
954986867 3:54802272-54802294 TGGCACTCATGGGAAAGCTGGGG + Intronic
956001953 3:64739132-64739154 TGGGGCTCCAGGGTGAGCAGTGG - Intergenic
956978838 3:74614046-74614068 TGTGACTCCTAGGGATGCTGAGG - Intergenic
957015752 3:75062989-75063011 GGGGACTTCTGGGGAAGAATGGG - Intergenic
958482846 3:94666199-94666221 TGGGACTCTTTGGGAAGGACAGG - Intergenic
958708848 3:97692544-97692566 TAGGACTCCTGAGGTAGCTGAGG - Intronic
960136434 3:114110418-114110440 TTTTACTCCTGAGGAAGCAGAGG + Intergenic
960209092 3:114937981-114938003 TGGGACTACTTGGGAGGCTGAGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962389939 3:134962838-134962860 TGGGGCTGCTGGGGAAGGGGTGG - Intronic
962909320 3:139833436-139833458 TGGGAGAGCTGGGGAAGCAATGG - Intergenic
963082273 3:141404918-141404940 TGCAACTGCTGGAGAAGCAGGGG - Intronic
963160732 3:142149062-142149084 TGGGACTCGTGGGGGAACAAGGG + Intronic
964432662 3:156622832-156622854 TGGGGCTCCTGGGATATCAGCGG + Intergenic
966135343 3:176691895-176691917 TGGGACTTCTGGGGAAACTGAGG - Intergenic
966386258 3:179402527-179402549 TGGGGTTCCTGAGGGAGCAGAGG - Intronic
966907740 3:184539946-184539968 TGGGACGCCTGTGGCCGCAGGGG + Intronic
967839837 3:193996344-193996366 GGGGACACCTGGGAAATCAGAGG - Intergenic
968744712 4:2353704-2353726 CGGGACACTTGGGGGAGCAGAGG - Intronic
968812033 4:2804521-2804543 AGGAAGGCCTGGGGAAGCAGGGG - Intronic
968815764 4:2820890-2820912 TGGCACCCCTGGAGAAGCAGAGG + Intronic
968883630 4:3315278-3315300 TGGGAATCCTAGGGAATCACTGG + Intronic
969298687 4:6284633-6284655 GGGGTCTCCTGGGGAAGTGGGGG + Intronic
969673811 4:8603961-8603983 CAGGCCTCCTGGGGGAGCAGTGG - Exonic
969681972 4:8648229-8648251 TGGGACACCTGGGCCAGCTGAGG - Intergenic
969947392 4:10798618-10798640 TGGGACTTGTGGGGAAGTATGGG + Intergenic
971474440 4:27058915-27058937 TGGAAGGCCTGGGGAAGCAGAGG - Intergenic
972278875 4:37584540-37584562 TGGTTTTCCTGGGGAAGGAGGGG + Intronic
972878958 4:43399950-43399972 GGGAACTCCTGGGGAAGGATGGG - Intergenic
974653749 4:64790390-64790412 TGGGAATACTAGGGAAGCATTGG + Intergenic
974892253 4:67896607-67896629 TGGCACTCATGGGGAGGCTGGGG + Intergenic
976439056 4:85052860-85052882 TGGGACTCCTCTGAAAGGAGGGG + Intergenic
976841565 4:89438245-89438267 TGGCAGTGCTGGGGAAGCGGTGG + Intergenic
979239395 4:118435017-118435039 TGGGTCTCCTGATGAAGCTGAGG + Intergenic
982217742 4:153096697-153096719 TGAGAATCCTGGGGAAACAGAGG + Intergenic
983870045 4:172814790-172814812 ATGAACTCCTGGGGAAGCAAAGG + Intronic
984692255 4:182740281-182740303 TGGGACTCCTGACTAAGCAGGGG + Intronic
985274007 4:188219887-188219909 GGGGACTACTAGGGCAGCAGGGG - Intergenic
985322720 4:188732941-188732963 AGGCGCTACTGGGGAAGCAGAGG - Intergenic
985769354 5:1799413-1799435 CGGGGCGCGTGGGGAAGCAGGGG - Intronic
986434140 5:7711221-7711243 TGGGAGGCCTGGGGCAGCTGGGG + Intronic
987071071 5:14337603-14337625 TAGGACTACTGGGGAAAGAGGGG + Intronic
987160123 5:15133055-15133077 AGCGACTCCTGGGGAAGGGGTGG - Intergenic
990745057 5:58950632-58950654 TGGGACTACTTGGGTACCAGAGG + Intergenic
992762547 5:79963210-79963232 AGGGACTCCTGGGAAAACTGAGG + Intergenic
994186534 5:96821505-96821527 TGGGACCCAGGGGGAAGCACAGG + Intronic
994322145 5:98406168-98406190 TGGGACTCATGGGGAACATGGGG - Intergenic
994459140 5:100051529-100051551 TGGGACTTCTGGGGGTTCAGTGG + Intergenic
995527576 5:113062795-113062817 TGGGACACCTGGGCCAGTAGAGG + Intronic
996706878 5:126506797-126506819 TGGGACAGCTGGGGAAGCACAGG - Intergenic
997566126 5:134887876-134887898 TGTGATTCCTGGGGAAGCTGAGG + Exonic
998145680 5:139726788-139726810 TGCGACTCCAGGGAAGGCAGTGG - Intergenic
998349764 5:141492799-141492821 TGGGACTCCAGTGGCACCAGCGG + Intronic
1001136287 5:169105235-169105257 TGTGTCTCCAGGGGAAGGAGAGG - Intronic
1001157686 5:169287354-169287376 AGGGAATCATGTGGAAGCAGAGG - Intronic
1001434515 5:171688788-171688810 TTGGACTCCTGGAGAAGGACTGG + Intergenic
1002138143 5:177121241-177121263 TTGAACTCCTGGGGAGGCTGAGG - Intergenic
1002169243 5:177366238-177366260 TGGGACCACTGGGGAGGCTGTGG - Exonic
1002691447 5:181053284-181053306 TGGGCGTCCTCCGGAAGCAGCGG + Exonic
1002739638 5:181425597-181425619 TGGGTCTCCTGATGAAGCTGAGG + Intergenic
1003258832 6:4497647-4497669 TGGTACAGCTGGGGAAACAGAGG + Intergenic
1004087366 6:12463598-12463620 TGGCACTCATGGAGAAGAAGTGG - Intergenic
1006083580 6:31581213-31581235 TGGGACTTCTGGGGAAGTGGCGG + Intronic
1006388686 6:33746403-33746425 TGGGACTACAGAGGAAGCTGGGG - Intronic
1007412234 6:41671611-41671633 TGGGGCTCCTGGGAATGCAAAGG - Intergenic
1007697527 6:43743297-43743319 TGGGCCTGCTTGGGTAGCAGGGG - Intergenic
1009566783 6:65320455-65320477 TGGGACTGGTGCAGAAGCAGGGG + Intronic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010572434 6:77493774-77493796 TGGGACTTCTCCTGAAGCAGTGG + Intergenic
1011172570 6:84522202-84522224 TGGGCCCCTTGGGGAAGAAGGGG + Intergenic
1013400525 6:109791481-109791503 TGGGACTGATCGGGAAGAAGAGG + Exonic
1014223636 6:118823423-118823445 TGGGACTACTGGTTAGGCAGTGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015378403 6:132536655-132536677 TAGGAGACCTGGGGAAGAAGAGG + Intergenic
1015450962 6:133365556-133365578 TGGGGCGCATGGGGAAGCACTGG + Intronic
1015954993 6:138589828-138589850 AGGGAGTGCTGGGGATGCAGAGG - Intronic
1017666673 6:156725745-156725767 TTGGACTGATGGGGAAGTAGGGG + Intergenic
1017770771 6:157642900-157642922 CGCGAATCCTGGAGAAGCAGGGG + Intronic
1018422685 6:163652992-163653014 TGGGAGTCCTGAGATAGCAGGGG - Intergenic
1018628340 6:165801878-165801900 TGGGTCTCCTGTGGGAGCAGTGG - Intronic
1019031535 6:169018064-169018086 TGTGCTTCCTGGGGAAGCACAGG + Intergenic
1019244753 6:170701184-170701206 TGGGTCTCCTGATGAAGCTGAGG + Intergenic
1019354222 7:570521-570543 GGGGACTGCTGGGCAGGCAGTGG - Intronic
1019507412 7:1399273-1399295 CTGGAGACCTGGGGAAGCAGAGG - Intergenic
1019706091 7:2497948-2497970 AGGGTCTGCTGGGGAAGGAGGGG + Intergenic
1020866005 7:13563562-13563584 TGAGAGGCATGGGGAAGCAGAGG - Intergenic
1021611323 7:22460570-22460592 TGGGAGTCCAGGGCCAGCAGGGG + Intronic
1023189224 7:37561577-37561599 TGGGGCTCCTGTGGAGTCAGGGG - Intergenic
1023905842 7:44521179-44521201 TGGGATTGTTGGGGAAGGAGGGG - Intronic
1027948404 7:84780531-84780553 TGGGAATGCTGGCAAAGCAGTGG + Intergenic
1028305066 7:89252870-89252892 TGGAAATACTGGGGAAGGAGGGG + Intronic
1029117960 7:98247510-98247532 AAGGACCCCTGGGGAAGTAGTGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030363630 7:108622159-108622181 TGGAACTTCCAGGGAAGCAGAGG + Intergenic
1030673416 7:112362038-112362060 TGCGACTGCTCTGGAAGCAGTGG - Intergenic
1032205812 7:129864230-129864252 TGGAACTCCTGGACAAGGAGGGG + Intronic
1032803653 7:135335898-135335920 GGGGAATTCTGGTGAAGCAGGGG - Intergenic
1034426746 7:151018043-151018065 AGGGAGACCTGGGGAAGCAGCGG + Exonic
1035078960 7:156200463-156200485 TGGCACTCCTGGGCAAGCAATGG - Intergenic
1035249618 7:157588394-157588416 TAGGACTGCCGGGGAGGCAGGGG - Intronic
1035351193 7:158247464-158247486 TGGGCGTGGTGGGGAAGCAGGGG - Intronic
1035456792 7:159014063-159014085 TGGGACTCCTTGGGAGACCGAGG + Intergenic
1035503372 8:107004-107026 TGGGTCTCCTGATGAAGCTGAGG - Intergenic
1035859651 8:3013876-3013898 TGGGATTCCTGGGCGAACAGAGG + Intronic
1040284584 8:46093375-46093397 GGGGACTTCTGGGAAAGGAGAGG - Intergenic
1040287035 8:46105735-46105757 AGGGACTCAGGGGGAAGCTGAGG - Intergenic
1040336468 8:46418561-46418583 AGGGACTCAAGGGGACGCAGAGG + Intergenic
1043309843 8:78844408-78844430 CTGAACTCCTTGGGAAGCAGAGG - Intergenic
1044486186 8:92757158-92757180 TGTGCCTCCTGGGGAAGAGGTGG + Intergenic
1044790431 8:95841456-95841478 TGGGTCTCTTGGGGTACCAGGGG - Intergenic
1045676676 8:104615044-104615066 TGGGACTCCTGGGCCAGAACTGG + Intronic
1047260531 8:123254899-123254921 TTGGACTCCCGAGGAAGTAGAGG - Exonic
1047481959 8:125292265-125292287 TGGGAGGCCAGGGGGAGCAGTGG + Intronic
1047903020 8:129444163-129444185 AGTGAGTCCTGGGGAAGCTGGGG - Intergenic
1047996587 8:130342512-130342534 TTGGCCCCCTAGGGAAGCAGAGG + Intronic
1048348387 8:133595588-133595610 GGGGACTCCTGGGGGAAGAGGGG + Intergenic
1049150117 8:141029667-141029689 GGGGACACCTGGGGCAGCAGCGG - Intergenic
1049212303 8:141392320-141392342 TGGCTCGCCTGGGGAAACAGCGG - Intronic
1049779631 8:144423022-144423044 TGGGCCTGGTGGGGAGGCAGCGG - Intergenic
1049802030 8:144522319-144522341 CGGGAATCCTGGGGTAGCAATGG - Exonic
1050315513 9:4397483-4397505 GGGGAGTCAGGGGGAAGCAGTGG - Intergenic
1050587038 9:7123721-7123743 TGGGAGCCCTGGGGATGGAGAGG + Intergenic
1052104781 9:24499558-24499580 TGGGATTCCAGGCAAAGCAGAGG + Intergenic
1052982922 9:34461913-34461935 TGGGATCCCTGGGGATGAAGGGG + Intronic
1053067648 9:35079641-35079663 TGGGACCCCGAGAGAAGCAGGGG - Exonic
1053274144 9:36770672-36770694 TGGGTCTCCTGGGTGACCAGGGG + Intergenic
1053492892 9:38523905-38523927 TGGGCATGATGGGGAAGCAGAGG - Intergenic
1054773064 9:69101010-69101032 GACGACTCCTGGGGAAGAAGAGG + Intergenic
1054812422 9:69445558-69445580 TGATGCTCCTGGGGAAGCAAGGG + Intronic
1056117452 9:83454684-83454706 TGGGACCCCAGGAGAAGAAGGGG - Intronic
1056850843 9:90082395-90082417 TGGGAGTCCTGTGCAACCAGTGG + Intergenic
1058096146 9:100862486-100862508 TGGACCTCCTGGGAAGGCAGTGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059449185 9:114359658-114359680 TGCAACTCCAGGGAAAGCAGAGG - Exonic
1060773391 9:126349029-126349051 AGGGCCACCTGGGGAAGCACAGG + Intronic
1060783189 9:126428848-126428870 AGGGACCCCTGTGAAAGCAGAGG - Intronic
1061488715 9:130933699-130933721 TGGGGGTTCTGGGGAAGCGGCGG + Intronic
1061570210 9:131473519-131473541 AGGGACTCCTGGGGCATCATGGG - Exonic
1062129397 9:134884506-134884528 AGAGGTTCCTGGGGAAGCAGAGG - Intronic
1062443485 9:136583793-136583815 TGCAACCCCTGGGGAGGCAGGGG + Intergenic
1062453789 9:136626512-136626534 TGGGACTGCGGGGGTGGCAGGGG + Intergenic
1203604944 Un_KI270748v1:50404-50426 TGGGTCTCCTGATGAAGCTGAGG + Intergenic
1186157797 X:6743739-6743761 TGGCACACCTGGGGAAACTGTGG - Intergenic
1186886248 X:13916749-13916771 TGGGACTTCTGTGACAGCAGAGG + Intronic
1187701080 X:21964937-21964959 AGGGCCTTCTGGGGAAGCATGGG - Intronic
1189314147 X:40041906-40041928 TCTGACTCCTGTGGAAGGAGAGG + Intergenic
1190197197 X:48329566-48329588 TGGGGCTCCAGGAGAAACAGAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192705548 X:73526106-73526128 TGCGGCTCCGGGGGCAGCAGCGG - Intergenic
1194088332 X:89556012-89556034 TGGGACTCCAGGAGAAAGAGAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195998022 X:110750790-110750812 TGGGAGCTCTGGGAAAGCAGAGG + Intronic
1196037596 X:111163587-111163609 TGGTACTGCTGGTGAAGCAATGG - Exonic
1197441799 X:126500544-126500566 AGGGACTCGTGGGGAAGGATGGG - Intergenic
1197504469 X:127284436-127284458 GGGGACTCAGGGGGAAACAGTGG + Intergenic
1199219783 X:145304882-145304904 TGGCATTCCTGAGAAAGCAGAGG - Intergenic
1199427644 X:147721612-147721634 TGAGTCTTGTGGGGAAGCAGGGG + Intergenic
1200441004 Y:3212054-3212076 TGGGACTCCAGGAGAAAGAGAGG - Intergenic
1201511050 Y:14763451-14763473 TGAGACTCCAAGGGAAGCAAGGG - Intronic
1202387129 Y:24336800-24336822 TGGGTCTCCTGATGAAGCTGAGG + Intergenic
1202483657 Y:25333328-25333350 TGGGTCTCCTGATGAAGCTGAGG - Intergenic