ID: 903953182

View in Genome Browser
Species Human (GRCh38)
Location 1:27008239-27008261
Sequence CTCAGGACAGGAATGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903953182_903953189 29 Left 903953182 1:27008239-27008261 CCAGGCAGCATTCCTGTCCTGAG 0: 1
1: 0
2: 0
3: 11
4: 233
Right 903953189 1:27008291-27008313 TCAGCACCCAGCTCCAGACCAGG 0: 1
1: 0
2: 3
3: 40
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903953182 Original CRISPR CTCAGGACAGGAATGCTGCC TGG (reversed) Intronic
900719597 1:4166730-4166752 CTCAGGAAAGGGAAGGTGCCTGG - Intergenic
900939330 1:5787621-5787643 CTCTGGACTGGAATGCCCCCAGG + Intergenic
901701168 1:11045390-11045412 CTCAGGTGAGGGAGGCTGCCTGG - Exonic
902374221 1:16022758-16022780 CTCAGGACATCATTCCTGCCTGG + Intronic
902546424 1:17193390-17193412 CTCAGGACAGGGATGGGACCGGG + Intergenic
903953182 1:27008239-27008261 CTCAGGACAGGAATGCTGCCTGG - Intronic
904701317 1:32360049-32360071 CCCATGACAGGAAGCCTGCCTGG - Intronic
905226631 1:36483059-36483081 CCCAAGGCAGGAAGGCTGCCCGG - Exonic
905402445 1:37713563-37713585 CCCAGGAGAGGCATGCAGCCAGG - Intergenic
906238570 1:44227445-44227467 CTCAGGGCATTACTGCTGCCAGG - Intronic
910716321 1:90235559-90235581 CTCTGGACATGAATGGGGCCTGG - Intergenic
911044079 1:93614518-93614540 GTGAGGACAGGGATCCTGCCTGG - Intronic
912166582 1:107048549-107048571 CTCCAGAAAGGAAGGCTGCCAGG + Intergenic
912624210 1:111194374-111194396 CTCCACACAGGACTGCTGCCTGG - Intronic
914753350 1:150550016-150550038 CTCAGGACAGGGATTCTCCATGG + Intronic
915262662 1:154689242-154689264 CTCCAGACAAGAATGCAGCCTGG - Intergenic
915693049 1:157709882-157709904 CTCAGGAAAGGATTGATGCCTGG + Intergenic
917061730 1:171048856-171048878 ATCAGGTAATGAATGCTGCCAGG + Intronic
919797903 1:201332304-201332326 CTGAGGTCTGGAAGGCTGCCTGG - Exonic
919879922 1:201894740-201894762 CTTAGGGCAGGAATCTTGCCAGG + Intergenic
924674866 1:246165604-246165626 CTCAGGCCAGGAAAACTCCCAGG + Intronic
1062848440 10:725706-725728 CTCTGGGCAGGGCTGCTGCCTGG - Intergenic
1064403139 10:15037909-15037931 CACAGGCCAGGAACGCTGCCTGG + Intronic
1066049151 10:31619110-31619132 CTCAGGCCAGGAGAGCCGCCCGG + Intergenic
1067580614 10:47443319-47443341 TTGAGGCCAGGAATGCTGCTGGG - Intergenic
1069081864 10:64097101-64097123 CTGAGGAGAGGCATGGTGCCAGG + Intergenic
1070359231 10:75671287-75671309 TTCAGGACTGTACTGCTGCCTGG + Intronic
1070680739 10:78447424-78447446 CTCAGTACAAGAAAGCAGCCAGG + Intergenic
1072608289 10:97001219-97001241 CCCAGGCCAGGGCTGCTGCCAGG - Exonic
1073464862 10:103688710-103688732 CCCAGGTCAGGAAGGCAGCCAGG + Intronic
1074022831 10:109602030-109602052 TACAGGACACGAATGGTGCCAGG + Intergenic
1074298285 10:112210943-112210965 CTGAGAACAGGAACGCTGCGAGG - Intronic
1074393184 10:113074867-113074889 CACAGGGCAGGGATGCTGCTAGG + Intronic
1075039161 10:119093984-119094006 CTCCAGAGAGGAATGCGGCCTGG + Intergenic
1075852844 10:125603135-125603157 CTTAGGACAGGAAGGCTGGTTGG - Intronic
1076876384 10:133218256-133218278 CTCAGAATAGGAATCCTGCTGGG + Intronic
1077492541 11:2868804-2868826 TCCAGGAGAGGAAGGCTGCCTGG - Intergenic
1077811951 11:5647076-5647098 ATCAGGAGAGGAATCCTGTCTGG + Intergenic
1078414845 11:11156676-11156698 CTCAGGACAGGACTTGTGGCAGG - Intergenic
1081688165 11:45057002-45057024 CTCAGGACAGTCATTCTCCCTGG + Intergenic
1083577752 11:63804618-63804640 CCCAGGACATAAATGCTACCAGG - Intergenic
1084092024 11:66885024-66885046 GACAGGACATGAATGCTGGCTGG + Intronic
1084727140 11:70949324-70949346 CCCAGGCCTGGCATGCTGCCCGG + Intronic
1084962857 11:72726464-72726486 CGGAGGACAGGATTGCTGTCTGG - Intronic
1087501233 11:98956662-98956684 CACATGAAAGGAAAGCTGCCAGG + Intergenic
1088261728 11:107950339-107950361 CTCAGCATTTGAATGCTGCCTGG + Intronic
1088597017 11:111448487-111448509 CTCCGGACAGGAAAGTTCCCGGG - Intronic
1089354359 11:117840236-117840258 CTCAGGAAGGGACTGTTGCCAGG - Intronic
1089611537 11:119672198-119672220 AGCAGGACAGGGAGGCTGCCAGG - Intronic
1089807055 11:121099771-121099793 CTTGAGACAGGACTGCTGCCCGG - Intergenic
1090905243 11:131068929-131068951 CTTAGGACAGGGAAGCTGCTGGG - Intergenic
1091178777 11:133584371-133584393 CCCAGGACTTGAATGCTGTCTGG - Intergenic
1091346681 11:134859019-134859041 CTCAAGACAACAATTCTGCCTGG + Intergenic
1091445034 12:540130-540152 CGCAGGACATGAGTGCTGACTGG - Intronic
1091455815 12:606996-607018 CAAAGGACAGGATTGCAGCCGGG - Intronic
1096459516 12:51814512-51814534 CCCAGGACAGGGACGCGGCCTGG + Intergenic
1096594829 12:52688259-52688281 CTCCTGACAGGCCTGCTGCCAGG + Intergenic
1097094590 12:56536265-56536287 CTGAGGTCAGGAGTTCTGCCCGG + Intronic
1098613009 12:72485341-72485363 CTCAGGAATGGCATGCTACCAGG - Intronic
1099376686 12:81901858-81901880 CTGAGGACAAAATTGCTGCCAGG + Intergenic
1101658205 12:106742953-106742975 CACAGGACAGGAAGGGTGCTCGG - Intronic
1102720282 12:115010080-115010102 CTCAGGATAGGAAGGCTTTCTGG + Intergenic
1102797739 12:115703566-115703588 CTCCAGAAAGGAATGCAGCCTGG - Intergenic
1104136501 12:125944646-125944668 CTCAAGACAGGGAGCCTGCCAGG - Intergenic
1104423019 12:128652626-128652648 CCCAGGACAGGAGGCCTGCCTGG + Intronic
1112809960 13:103206859-103206881 AGCAGGACTGGAAGGCTGCCTGG - Intergenic
1113058503 13:106296020-106296042 CTCAGCACAGGACTCCTGCATGG + Intergenic
1113330631 13:109323544-109323566 CTCAGGATTGGAGTGCTGGCAGG - Intergenic
1116057848 14:39885817-39885839 AGCAGGTCATGAATGCTGCCAGG - Intergenic
1117279140 14:54220316-54220338 CTCATTACGGGAATGCAGCCGGG - Intergenic
1119731347 14:76953332-76953354 CTCAGGCCAGGCACCCTGCCAGG - Intergenic
1119734309 14:76971809-76971831 CTCAGTAAAGGAATTCTGTCAGG + Intergenic
1120968967 14:90191749-90191771 CTGAGGACAGGATTGCTCCTGGG - Intergenic
1121974692 14:98392083-98392105 CTCATTGCTGGAATGCTGCCTGG - Intergenic
1122288435 14:100666596-100666618 CCAAGGACTAGAATGCTGCCTGG + Intergenic
1124423386 15:29541478-29541500 CACAGGGCAGGAATGCGGGCTGG + Intronic
1126022726 15:44418358-44418380 ACAAGGACTGGAATGCTGCCAGG + Intergenic
1126401263 15:48273171-48273193 CTCCGGAAGGGAATGCAGCCTGG - Intronic
1127878549 15:63134370-63134392 CTCACCTCAGGAATGCTGCAAGG - Intronic
1128345864 15:66852076-66852098 CTCAGGACAGGCAGGCACCCTGG + Intergenic
1129235931 15:74223681-74223703 CTCAGCAGAAGCATGCTGCCTGG - Intergenic
1129252100 15:74314738-74314760 CTCCTGGCAGGAATGCTGCTGGG - Intronic
1131085544 15:89572885-89572907 ATTAGGGCAGGAATGGTGCCTGG + Intergenic
1131411403 15:92210930-92210952 CTGAGGCCAGAATTGCTGCCAGG + Intergenic
1132930482 16:2456591-2456613 CCCAGAACAGCATTGCTGCCAGG + Exonic
1135328940 16:21545481-21545503 CACAGGGGAGGAATGATGCCCGG - Intergenic
1136132910 16:28235277-28235299 CTCAGGACAGAATTGGTGGCAGG + Intergenic
1136339284 16:29631458-29631480 CACAGGGGAGGAATGATGCCCGG - Intergenic
1136656807 16:31713934-31713956 CTCAGCTTAGGAATGCTGCTGGG + Intronic
1139507176 16:67404622-67404644 CTCAGGACAGTCAGGCTTCCTGG + Intronic
1140888586 16:79266168-79266190 CTCAAGACATGAATTCTGGCCGG - Intergenic
1141548616 16:84789133-84789155 CTCTGGACAGCAGTGATGCCAGG + Intergenic
1142041955 16:87900045-87900067 CACAGGGGAGGAATGATGCCCGG - Intronic
1142309400 16:89303554-89303576 CTGGGGACAGGAAGGCTGCAGGG - Intronic
1142844989 17:2667479-2667501 CTCCTGAGAGGCATGCTGCCAGG + Intronic
1144761416 17:17709623-17709645 CTCAGGACCAGAATGAGGCCAGG - Intronic
1144888178 17:18477893-18477915 CTGAGGGCAGGGAAGCTGCCAGG + Intronic
1145037451 17:19551264-19551286 CTCAGGACAGGGCTGGGGCCAGG - Intronic
1145144028 17:20466410-20466432 CTGAGGGCAGGGAAGCTGCCAGG - Intronic
1145210151 17:21006825-21006847 ATCAGGACAGGAATCCAGCTCGG - Intronic
1146561619 17:33874915-33874937 ATCAGGACAGGAATACTGCTGGG - Intronic
1147997445 17:44368608-44368630 CTCAGCACTGGAATAGTGCCAGG + Intergenic
1150229532 17:63542474-63542496 CTCAGGCCAGGCAGGCTGCCTGG - Intronic
1151517672 17:74606732-74606754 CACAGCACAGGGATGCTGACGGG + Intergenic
1151976606 17:77487173-77487195 CTCAGGAGAGGACTGTGGCCTGG + Intronic
1152074516 17:78150661-78150683 CCCATGACATGAAGGCTGCCGGG + Intronic
1152147948 17:78580499-78580521 CACATGGCAGGGATGCTGCCGGG - Intergenic
1152603383 17:81276789-81276811 CTCAGGTCAGGAGAGCTTCCTGG + Intronic
1152737407 17:82004280-82004302 CTAAGGACAGGGACGCTGTCCGG - Intronic
1154258924 18:12811736-12811758 CTCAGGTCATTAATGCTGACTGG + Intronic
1154963812 18:21336559-21336581 CTTATGACAGTAATGCTGCAAGG + Intronic
1157128062 18:44976442-44976464 CTCAGGAAAGGCAGGCTGCTGGG + Intronic
1157809671 18:50685598-50685620 GCCAGGACAGGAGTCCTGCCTGG - Intronic
1157999233 18:52596837-52596859 CTCAGGTCAGCAATCTTGCCTGG + Intronic
1161057376 19:2197463-2197485 CTCAGGAGAGGGGTGCTGTCGGG + Intronic
1161678474 19:5666924-5666946 CTCGGGACAGAAGTGCTGGCAGG - Intronic
1161804015 19:6431935-6431957 TTCAGGATAGGAGTGCTGGCTGG - Intronic
1162716554 19:12638089-12638111 CTGAGGACAGGATCGCAGCCAGG - Intronic
1163151852 19:15419818-15419840 CTGAGGACATGACTGGTGCCCGG - Intergenic
1164594384 19:29524407-29524429 CTGAGGACAGCAATGGGGCCTGG + Intergenic
1165095412 19:33407269-33407291 CTCAGGCCCGGAGTGCTGCAAGG + Intronic
1165124940 19:33587476-33587498 CTGTGGACAGGAATCCAGCCAGG + Intergenic
1166071962 19:40393138-40393160 CCCAGGACAGGCAGGCTTCCTGG + Intergenic
925271107 2:2608238-2608260 CTCAGGACTGGATTGGTGCATGG - Intergenic
925362665 2:3290223-3290245 CCCAGGCCTAGAATGCTGCCGGG + Intronic
925958669 2:8994585-8994607 CTCATGACATAAATGCTGCATGG + Intronic
926356277 2:12043612-12043634 CTGAGGACAGGAGTGGTGCTAGG + Intergenic
927523806 2:23719739-23719761 ATAAGGACAGGACTCCTGCCAGG - Intergenic
927560188 2:24065392-24065414 CTCAGCAAAGGAATACAGCCAGG - Intergenic
928423635 2:31159946-31159968 CCCAGGCCAGGAAGGCTTCCAGG - Intergenic
929049890 2:37827419-37827441 TTTAGGACAGAAATGCTGCCAGG + Intergenic
929116328 2:38447459-38447481 CTCAGGACTGTCATGCTACCTGG + Intergenic
931105055 2:59046390-59046412 CGTAAGACAGGAATCCTGCCAGG + Intergenic
932284092 2:70518183-70518205 CTCGGGACAGGAAGGCTTCTAGG + Intronic
932415057 2:71568497-71568519 TTCTGGAAAGGACTGCTGCCTGG - Intronic
935176792 2:100655821-100655843 TTCAGGAAAGAAATGCTGGCTGG + Intergenic
935311168 2:101785041-101785063 CTCAGGACTGTAATGCTCTCCGG + Intronic
937609333 2:123840985-123841007 CTCTGCACAGGAATGCTGTGGGG - Intergenic
939379244 2:141413475-141413497 CTCCAGAAAGGAATGCAGCCCGG + Intronic
940783910 2:157961577-157961599 CTCATGTTAGAAATGCTGCCAGG - Intronic
944624790 2:201559519-201559541 CTCTGGGCAGGAATACTCCCAGG + Intronic
946199948 2:218065560-218065582 CCCAGGACAGGAGTGGTGGCTGG + Intronic
946364906 2:219243057-219243079 GTCGGGACAGGAAGACTGCCAGG - Intronic
946679504 2:222198278-222198300 TACATGAGAGGAATGCTGCCAGG - Intergenic
947593874 2:231399185-231399207 CCCAGGTCAGGAGGGCTGCCAGG - Exonic
1169116278 20:3068166-3068188 CTCTGGAAATGAATGCAGCCTGG + Intergenic
1169321408 20:4636027-4636049 CTCAGCAGAGGAGAGCTGCCTGG + Intergenic
1169430438 20:5531521-5531543 CTCAGCACAGGGAGGGTGCCAGG + Intergenic
1170792617 20:19520568-19520590 CTCAGCACAAGAATCCTGCTTGG - Intronic
1171337874 20:24402528-24402550 CCCAGGACAGCATTCCTGCCAGG + Intergenic
1172579679 20:36037024-36037046 CTCAGGAAAGGGATGGAGCCTGG - Intergenic
1172732701 20:37101285-37101307 CTCAAGACTGGAATTCTGCTGGG + Exonic
1173532334 20:43779883-43779905 CTCAATACAGGAATGCAGCTTGG - Intergenic
1174048610 20:47751543-47751565 GTGATGCCAGGAATGCTGCCTGG + Intronic
1175579132 20:60085777-60085799 CTGAGGACAGGAATGGGGCTAGG + Intergenic
1179067290 21:38037476-38037498 CTGAGGAAAGGAAGGCAGCCAGG - Intronic
1179553954 21:42160637-42160659 CTCAGGCCAGTAAAGCTTCCTGG - Intergenic
1181423107 22:22815455-22815477 GTCAGGACAGGAAGGCTCCTGGG - Intronic
1181992510 22:26848094-26848116 TTCAGCACAGGAATGCTGGAGGG - Intergenic
1183307971 22:37093069-37093091 CTCAGCGCAGGAATGGGGCCTGG + Intronic
1184239610 22:43205229-43205251 CTCAGTACAGGTTTGCTGCAGGG + Intronic
950649981 3:14401284-14401306 CTCAGGCCAGGATCCCTGCCTGG - Intergenic
950747445 3:15101785-15101807 CCCAGTACAGGAGTGGTGCCTGG - Intergenic
955918003 3:63925766-63925788 ATCAGGAAAGGAAGGCTTCCTGG + Intronic
956720890 3:72116651-72116673 CTCAGGGCAGGAGGACTGCCAGG + Intergenic
960584216 3:119305791-119305813 CTGAGGACAGAAACGCTGCTTGG + Intronic
962373171 3:134838012-134838034 TGCAGAACAGGAGTGCTGCCTGG + Intronic
962527204 3:136247559-136247581 CTAAGGACAGGAAAGCAGCCTGG + Intergenic
962689668 3:137881424-137881446 CTCCAGACAGGATGGCTGCCTGG - Intergenic
963989236 3:151634053-151634075 CTCAGGGCAGTACTGCTGTCTGG + Intergenic
964976192 3:162623130-162623152 AGCAGGAGATGAATGCTGCCAGG + Intergenic
965484028 3:169256749-169256771 CATAGGACAGGAAAGATGCCTGG + Intronic
969573605 4:8024201-8024223 CTCAGCACATGGAGGCTGCCTGG + Intronic
969711599 4:8847510-8847532 CTCGGGACAGGAGTTGTGCCCGG - Intronic
970335396 4:15034555-15034577 CTCAGTACAGGAAGCCAGCCTGG + Intronic
971370859 4:26017704-26017726 CTCCAGACAGCAATGCTGTCCGG + Intergenic
973969900 4:56203067-56203089 ATTAGGACAGAAATGCTGCAAGG + Intronic
977288998 4:95143183-95143205 CTTAGCACAGCACTGCTGCCTGG - Intronic
978049335 4:104176591-104176613 CTCAGGACCAGAGTGCTACCTGG - Intergenic
979302766 4:119106516-119106538 CCCAGGGTAGGAATGCTGCTGGG + Intergenic
984176343 4:176422848-176422870 CTCAGGGCAGAACTTCTGCCAGG - Intergenic
985025271 4:185733893-185733915 CTCAAGACAGACATGCTGCTGGG + Intronic
985549787 5:527178-527200 CACAGGACAGGAATGTTCTCAGG - Intergenic
986051854 5:4097539-4097561 CTCAGGATAAGAATGATGCCCGG - Intergenic
986427685 5:7650983-7651005 CTGTGGAGAGGAATGCAGCCTGG + Intronic
987308298 5:16658855-16658877 CTGAGGTCAGGAGTGCAGCCTGG + Intergenic
987456167 5:18149850-18149872 CCCAGCACAGGAATGCTGGCAGG + Intergenic
990764632 5:59168502-59168524 CTAAGGAAAGGATTCCTGCCAGG - Intronic
996082968 5:119275513-119275535 CTCAGGACAGGAAACAGGCCTGG - Intronic
997953068 5:138257563-138257585 CTCAGCACAGGAACGTGGCCAGG + Intronic
998175963 5:139902306-139902328 CTCAGTGCAGGAGTGCTGGCTGG - Intronic
998532469 5:142898648-142898670 CTTAGCACAGGAGTGCTGTCAGG - Intronic
1003232911 6:4270969-4270991 CTCAGGCAAGGAATGAAGCCAGG + Intergenic
1003619960 6:7691217-7691239 CTGAGGCCAGGGAAGCTGCCGGG + Intergenic
1006435502 6:34023918-34023940 ATCAGGGCAGTATTGCTGCCTGG + Intronic
1009244093 6:61213668-61213690 CTCTGGAGGGGAATGCTCCCAGG + Intergenic
1009390717 6:63140255-63140277 AGCAGGAAATGAATGCTGCCAGG - Intergenic
1009733355 6:67639370-67639392 CTCAGGACAGTACATCTGCCAGG + Intergenic
1012928028 6:105287281-105287303 CTCATGTCTGGAATGTTGCCTGG + Intronic
1015873685 6:137801751-137801773 CTCCAGAAAGGAATGCAGCCTGG - Intergenic
1020188228 7:5974698-5974720 CTCAGGACATCAAAACTGCCCGG + Intronic
1020294689 7:6750070-6750092 CTCAGGACATCAAAACTGCCCGG - Intergenic
1020615306 7:10452435-10452457 CTCCAGACAGGATGGCTGCCTGG - Intergenic
1021607074 7:22418884-22418906 CTCAGGAAAGAAAGGCAGCCAGG - Intergenic
1022040816 7:26579769-26579791 CGCAGGCCAAGGATGCTGCCAGG - Intergenic
1022326382 7:29335933-29335955 CTGAGGAGAGTAAAGCTGCCAGG + Intronic
1023143901 7:37130076-37130098 GTCAGGTCAGGAAAGCTTCCTGG - Intronic
1025086731 7:56029423-56029445 CTCAGAACAGAACTTCTGCCTGG + Intronic
1030864160 7:114678313-114678335 CTCAGGACAGGCAGCCTGCCTGG + Intronic
1032739697 7:134726538-134726560 ATCAGGACACGGATGCTGCCAGG + Intergenic
1036677393 8:10846322-10846344 CTCAGGCCGGAATTGCTGCCAGG - Intergenic
1037501146 8:19486532-19486554 CTCTGGGCAGGAATGCTTCGAGG - Intronic
1039729066 8:40255180-40255202 CCCAGGACAGAAATGATGACCGG + Intergenic
1039915705 8:41858933-41858955 CTCAGCTCAGGAAGGCTGCAAGG + Intronic
1039999279 8:42562718-42562740 CTCAGGCCAAAATTGCTGCCAGG - Intergenic
1040854336 8:51933138-51933160 ATAAGGACAGGACTGTTGCCAGG + Intergenic
1045928940 8:107601328-107601350 CTTAGGACAAAATTGCTGCCAGG - Intergenic
1046813199 8:118554853-118554875 CATAGGACAGGCATGCTGTCTGG - Intronic
1048679934 8:136829973-136829995 CTCAGGACACTGATGCTTCCAGG + Intergenic
1048706486 8:137159255-137159277 CTGACAACAGGAATGCAGCCAGG - Intergenic
1051508903 9:17856063-17856085 CTGAGGCCGGAAATGCTGCCTGG - Intergenic
1053510746 9:38686112-38686134 CGCAGGACAGGGTTCCTGCCAGG - Intergenic
1056112472 9:83409221-83409243 CTCAGGACAAGAAGGAAGCCAGG + Intronic
1056402672 9:86243120-86243142 CTCCAAACAGGAAGGCTGCCTGG - Intronic
1057219108 9:93246317-93246339 GCCAGGACAGGAATGCAGCGCGG - Intronic
1057477535 9:95415564-95415586 ATCTGGCCAGGAATGCTGCTGGG - Intergenic
1057938167 9:99257982-99258004 CCCAGGAAAGGGACGCTGCCTGG + Intergenic
1059444908 9:114331993-114332015 CCCAGAGCAGGAAAGCTGCCAGG + Intronic
1059885032 9:118736433-118736455 TTCAGGAGAGGAATTCTGGCAGG + Intergenic
1061014385 9:127973492-127973514 CTCGGGTCAGGGCTGCTGCCAGG + Intronic
1061169172 9:128942062-128942084 CTCTGGAAAGCAATGCTGCTTGG - Intronic
1061711988 9:132494305-132494327 TAAAGGCCAGGAATGCTGCCAGG - Intronic
1061811717 9:133166190-133166212 CTCAGGACAGGGATGGTGTCTGG + Intergenic
1061814716 9:133187827-133187849 CTCAGGCTGGGCATGCTGCCTGG + Intergenic
1062681614 9:137785048-137785070 TTCAGGGCAGGAGTGATGCCAGG + Intronic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1187146529 X:16642505-16642527 CTCAGGCAAAGAACGCTGCCAGG + Intronic
1188027597 X:25226674-25226696 CACAGGTGAGGAATCCTGCCAGG - Intergenic
1192221029 X:69197462-69197484 ATAAGGACAGGAATGTAGCCAGG - Intergenic
1192498989 X:71636313-71636335 CTCAGGAGAGGTATACAGCCTGG + Intergenic
1196441097 X:115720945-115720967 CTCAGTACAGGATGCCTGCCTGG - Intergenic
1197532294 X:127644578-127644600 CTTAGGCGTGGAATGCTGCCAGG + Intergenic
1199438987 X:147846814-147846836 ATCTGGACAGGAATGCAGCATGG - Intergenic
1200110107 X:153736646-153736668 CCCAGGACGGGAGGGCTGCCGGG + Intronic
1200257764 X:154593813-154593835 CCCAGGACAGGACTGCAGCTGGG - Intergenic