ID: 903953299

View in Genome Browser
Species Human (GRCh38)
Location 1:27008966-27008988
Sequence AAAAAAAAAAAGAAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31314
Summary {0: 1, 1: 35, 2: 780, 3: 5220, 4: 25278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903953299_903953302 24 Left 903953299 1:27008966-27008988 CCTCCATCCTTCTTTTTTTTTTT 0: 1
1: 35
2: 780
3: 5220
4: 25278
Right 903953302 1:27009013-27009035 GAGTCCTGATTTTGTAGCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 228
903953299_903953305 28 Left 903953299 1:27008966-27008988 CCTCCATCCTTCTTTTTTTTTTT 0: 1
1: 35
2: 780
3: 5220
4: 25278
Right 903953305 1:27009017-27009039 CCTGATTTTGTAGCTGAGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 213
903953299_903953303 25 Left 903953299 1:27008966-27008988 CCTCCATCCTTCTTTTTTTTTTT 0: 1
1: 35
2: 780
3: 5220
4: 25278
Right 903953303 1:27009014-27009036 AGTCCTGATTTTGTAGCTGAGGG 0: 1
1: 0
2: 1
3: 18
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903953299 Original CRISPR AAAAAAAAAAAGAAGGATGG AGG (reversed) Intronic
Too many off-targets to display for this crispr