ID: 903953299 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:27008966-27008988 |
Sequence | AAAAAAAAAAAGAAGGATGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 31314 | |||
Summary | {0: 1, 1: 35, 2: 780, 3: 5220, 4: 25278} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
903953299_903953302 | 24 | Left | 903953299 | 1:27008966-27008988 | CCTCCATCCTTCTTTTTTTTTTT | 0: 1 1: 35 2: 780 3: 5220 4: 25278 |
||
Right | 903953302 | 1:27009013-27009035 | GAGTCCTGATTTTGTAGCTGAGG | 0: 1 1: 0 2: 0 3: 17 4: 228 |
||||
903953299_903953305 | 28 | Left | 903953299 | 1:27008966-27008988 | CCTCCATCCTTCTTTTTTTTTTT | 0: 1 1: 35 2: 780 3: 5220 4: 25278 |
||
Right | 903953305 | 1:27009017-27009039 | CCTGATTTTGTAGCTGAGGGTGG | 0: 1 1: 0 2: 0 3: 11 4: 213 |
||||
903953299_903953303 | 25 | Left | 903953299 | 1:27008966-27008988 | CCTCCATCCTTCTTTTTTTTTTT | 0: 1 1: 35 2: 780 3: 5220 4: 25278 |
||
Right | 903953303 | 1:27009014-27009036 | AGTCCTGATTTTGTAGCTGAGGG | 0: 1 1: 0 2: 1 3: 18 4: 261 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
903953299 | Original CRISPR | AAAAAAAAAAAGAAGGATGG AGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |