ID: 903953302

View in Genome Browser
Species Human (GRCh38)
Location 1:27009013-27009035
Sequence GAGTCCTGATTTTGTAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903953299_903953302 24 Left 903953299 1:27008966-27008988 CCTCCATCCTTCTTTTTTTTTTT 0: 1
1: 35
2: 780
3: 5220
4: 25278
Right 903953302 1:27009013-27009035 GAGTCCTGATTTTGTAGCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 228
903953300_903953302 21 Left 903953300 1:27008969-27008991 CCATCCTTCTTTTTTTTTTTTTT 0: 131
1: 1925
2: 14373
3: 61996
4: 112810
Right 903953302 1:27009013-27009035 GAGTCCTGATTTTGTAGCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 228
903953298_903953302 29 Left 903953298 1:27008961-27008983 CCTTTCCTCCATCCTTCTTTTTT 0: 1
1: 3
2: 73
3: 978
4: 7948
Right 903953302 1:27009013-27009035 GAGTCCTGATTTTGTAGCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 228
903953301_903953302 17 Left 903953301 1:27008973-27008995 CCTTCTTTTTTTTTTTTTTTTTT 0: 2880
1: 30954
2: 37506
3: 74036
4: 136962
Right 903953302 1:27009013-27009035 GAGTCCTGATTTTGTAGCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903953302 Original CRISPR GAGTCCTGATTTTGTAGCTG AGG Intronic
900625459 1:3606495-3606517 GAGTCCTCATTTTACAGGTGAGG - Intronic
902651318 1:17839451-17839473 GTGTCCTCACTTGGTAGCTGGGG - Intergenic
903177454 1:21589533-21589555 GGGGCCTCATTTTGTTGCTGAGG - Intergenic
903271334 1:22190295-22190317 GAGTCCTGATGGGGCAGCTGAGG - Intergenic
903675428 1:25061747-25061769 GAGTCCTGGCTCTGAAGCTGAGG - Intergenic
903953302 1:27009013-27009035 GAGTCCTGATTTTGTAGCTGAGG + Intronic
904108479 1:28106271-28106293 AACTCCCCATTTTGTAGCTGAGG - Intergenic
905767473 1:40613327-40613349 GAGTCCTTATGTTGTACCTTAGG + Intergenic
907481955 1:54751075-54751097 GACTCCAGAGTCTGTAGCTGGGG + Intergenic
911313529 1:96327407-96327429 CTGTCCTTATTTTATAGCTGAGG - Intergenic
912581437 1:110724475-110724497 CAATCCTGTTTTTGTAGATGGGG - Intergenic
914376146 1:147075669-147075691 GAGTCCAGATTTTGGTGGTGGGG + Intergenic
914505601 1:148286556-148286578 GAGTCCAGATTTTGGTGGTGGGG + Intergenic
915557525 1:156668753-156668775 GAGTCCAGACTTTGAAGCGGAGG + Exonic
917483366 1:175432392-175432414 GATTCCTGGTTCTGGAGCTGAGG - Intronic
918043838 1:180929274-180929296 GACTCCTTATTTTGTTGCAGGGG + Intronic
920290109 1:204916004-204916026 GCGTCCTGCCTTTGTTGCTGGGG + Intronic
920979271 1:210817270-210817292 TAATCCTGACTTTGTTGCTGAGG + Intronic
921691653 1:218157862-218157884 AAGTCCTGCTTTTAGAGCTGAGG - Intergenic
924032205 1:239897038-239897060 TAATCCTCATTTTGTAGATGAGG + Intronic
924609470 1:245561946-245561968 GTGGCCTGATTTTCTTGCTGTGG + Intronic
1066181096 10:32961417-32961439 TAGTCCTTATTTTTTAGTTGGGG - Intronic
1066672470 10:37854968-37854990 AGGTTCTGATTTAGTAGCTGTGG - Intronic
1069535495 10:69249915-69249937 GTCTCCTGATTTTGCAGATGTGG + Intronic
1069802147 10:71088469-71088491 GAGGCCTGATTTTATTTCTGCGG + Intergenic
1070550563 10:77487865-77487887 GACTCCTGACTTTGTAGTTCTGG - Intronic
1070629981 10:78077550-78077572 TAGTCCTGATTCTGTCCCTGAGG - Intergenic
1072091402 10:92131244-92131266 GTGCCCTCATTTTATAGCTGAGG - Intronic
1073812123 10:107163730-107163752 GACTCCTCAGTTTGAAGCTGTGG + Intronic
1074783350 10:116818179-116818201 GAGACTTGATTCTGTAGCTCAGG - Intergenic
1079351891 11:19698709-19698731 GAGTCATGATTTGGCACCTGTGG - Intronic
1079805298 11:24923392-24923414 GAATCCTGTCTTTGTAGCTATGG - Intronic
1080194847 11:29597266-29597288 GAGTCCTAATTTTGGGGGTGGGG - Intergenic
1083472712 11:62894910-62894932 GACTCCTGAGTTTCTAGCTTAGG + Intergenic
1084682300 11:70673535-70673557 CATTTCTGGTTTTGTAGCTGTGG - Intronic
1084758514 11:71253279-71253301 GGGTCCTGAGCTTGGAGCTGTGG + Intergenic
1085066041 11:73496947-73496969 GTGTCCTGATTTAGTAGTTTTGG - Intronic
1085924173 11:80995836-80995858 GAGTTCTTTTTTTGAAGCTGGGG + Intergenic
1086936696 11:92753092-92753114 GAGTCCAGATTTAGGAGGTGGGG - Intronic
1087324924 11:96710051-96710073 GATTCCTCTTTTTGTAGCAGGGG - Intergenic
1087726899 11:101728892-101728914 CAGGACTGATTTTGAAGCTGTGG + Intronic
1089074931 11:115730368-115730390 GAGTTCTGATTTTGAACTTGAGG + Intergenic
1089166171 11:116478224-116478246 GAGTCCTGACTGTGTGGCTTTGG - Intergenic
1090788012 11:130067650-130067672 AGGCCCTGATTTTGTAGGTGAGG + Intergenic
1090934444 11:131329219-131329241 GTGTCCTGAATTTGTGGCTACGG + Intergenic
1091248294 11:134118992-134119014 GAGTCTTGCTTTTGTTGCTCAGG + Intronic
1092013597 12:5138234-5138256 GAGTCCTGACTCTGGAGATGGGG + Intergenic
1092243296 12:6848911-6848933 GAGTCCCAGTTTGGTAGCTGAGG + Exonic
1092667455 12:10818613-10818635 GAGTCCAGAGTTTCTATCTGTGG + Intergenic
1095544542 12:43349648-43349670 AATTTCTGATTTTATAGCTGAGG + Intergenic
1097312780 12:58139390-58139412 GAATCTTCATTTTGTAGATGAGG + Intergenic
1097998336 12:65914698-65914720 GAGTCTTGTTTTTGTTGCTCAGG + Intronic
1098002516 12:65960246-65960268 GAGTCCTGTTTCTGTAACTGAGG - Intronic
1101869241 12:108549544-108549566 GTGTCCTCATTTTATAGATGAGG - Intronic
1102176281 12:110877545-110877567 GAGTCCTGATGTTGTACCTTAGG + Intronic
1106716749 13:32397710-32397732 TTATCCTGATTTTGTAGATGAGG + Intronic
1106848396 13:33762321-33762343 CAGTCCTCATTTTGAAGATGAGG + Intergenic
1109174793 13:59142147-59142169 ATGTCCTGATTTTATAGTTGAGG + Intergenic
1111242722 13:85496706-85496728 CAGGACTGACTTTGTAGCTGGGG + Intergenic
1113985203 13:114309230-114309252 GAGTCATGTTTATGGAGCTGGGG + Intergenic
1115489462 14:33945160-33945182 GAGTGCTGAGTTTGAAGCTCTGG - Intronic
1116174071 14:41442944-41442966 GAGTCTTGCTCTTGTAGCTTAGG - Intergenic
1116648684 14:47562678-47562700 AAGTCCTGAATTTGTTGCTTTGG + Intronic
1117904178 14:60567121-60567143 GACTCCTGAGTTTCTAGCTTGGG + Intergenic
1118759080 14:68867786-68867808 GAGTCATTATTTGGGAGCTGGGG - Intergenic
1119053186 14:71390903-71390925 GAATTTTGATTTTGTTGCTGCGG + Intronic
1119660024 14:76444424-76444446 GAGTTCTGAGTTTGTCTCTGTGG - Intronic
1120126304 14:80747893-80747915 GCGTCCTGATTTTCTACTTGAGG + Intronic
1120756215 14:88246807-88246829 TAGTCCTCATTTTATAGATGAGG - Intronic
1121410262 14:93744533-93744555 GAGGTCTGATTTTGTATTTGTGG - Intronic
1122937129 14:104965373-104965395 GAGTTTTGCTTTTGTTGCTGAGG - Intronic
1125356504 15:38822046-38822068 GAGTGGTGATAGTGTAGCTGTGG + Intergenic
1125839234 15:42783274-42783296 GAGTCCTCATGTGGTAGATGGGG - Intronic
1127981081 15:64035599-64035621 AACTCCTCATTTTGTAGATGAGG - Intronic
1129494690 15:75967485-75967507 GAGTCTTGCTTTTGTTGCTCAGG + Intronic
1130288643 15:82577016-82577038 GAGTCCTGTTTTTGGAGACGGGG - Intronic
1130309280 15:82738887-82738909 TAGTCCTCATTATATAGCTGAGG + Intergenic
1130327320 15:82891303-82891325 AAGTCCTCATTTTACAGCTGAGG - Intronic
1133287726 16:4698329-4698351 TCCTCCTGATTTTGTAACTGAGG - Intronic
1133381355 16:5333284-5333306 AAGTCCTGCTTTTGTAAATGAGG + Intergenic
1134051345 16:11139964-11139986 TAGTCCTACTTTTATAGCTGGGG + Intronic
1134078528 16:11308968-11308990 GAGGCCTGAATCTGCAGCTGTGG + Intronic
1134597282 16:15505940-15505962 GAGTACAGAATATGTAGCTGGGG + Intronic
1135871473 16:26155384-26155406 GAGGCCTGAGTCTGCAGCTGGGG - Intergenic
1138129598 16:54468584-54468606 GCATCCTCATTTTATAGCTGGGG + Intergenic
1138654157 16:58481151-58481173 TTGTCCTCATTTTGTAGCTGAGG - Intronic
1139756132 16:69145114-69145136 GAGTCCTGCTTTTGTCGCCCAGG - Intronic
1141339421 16:83189248-83189270 GAGGCCTGAGCTTGCAGCTGAGG - Intronic
1141878445 16:86842193-86842215 AAGTCTTGATGTTGTAGTTGGGG + Intergenic
1144589880 17:16515024-16515046 GAGTCCTGCTTTTGTTGCCCAGG + Intergenic
1145996153 17:29106144-29106166 GATTTATGATTTTGGAGCTGGGG + Intronic
1146084664 17:29816151-29816173 GAGCCCTGATTTTTAAACTGGGG + Intronic
1146276564 17:31519767-31519789 GAGTCCTGATGTTCTTGGTGGGG + Intronic
1147158623 17:38558386-38558408 GACTCCTGGTTCTGTAGCTGCGG + Exonic
1147288283 17:39420819-39420841 GAGTCTTGCTCTTGTAGCTCAGG + Intronic
1148031400 17:44623785-44623807 GAGCCCTCATTTTGTAGTTTTGG + Intergenic
1148370652 17:47097357-47097379 GAGTTCTGCTTTTGTCGCTCAGG - Intergenic
1149297923 17:55277485-55277507 GAGTCCTGACCTTGTATTTGTGG + Intronic
1149364038 17:55922807-55922829 GAGTGCTGATTTGGTAACTGTGG + Intergenic
1149630500 17:58118062-58118084 GGATCCTCATTTTGCAGCTGAGG + Intergenic
1150968627 17:70000885-70000907 GAGTCTTGCTTTTGTTGCTCAGG - Intergenic
1155255728 18:23996658-23996680 AAGTCCTGATTTAGTAGGTATGG - Intronic
1157999202 18:52596511-52596533 AAGTCTTGATTTAGTAGATGTGG - Intronic
1159014057 18:63087385-63087407 TAGTCCTGTTTTGGTAGCTAAGG + Intergenic
1159116918 18:64125193-64125215 TTGTCCTGGTTTTCTAGCTGAGG + Intergenic
1160315309 18:77838541-77838563 GACTCCTGTTTTTGTCTCTGCGG + Intergenic
1160548445 18:79678059-79678081 GAGTGCATTTTTTGTAGCTGTGG - Intergenic
1160799806 19:962538-962560 GAGTTTTGCTTTTGTTGCTGAGG + Intronic
1160835766 19:1123807-1123829 GAGTGCCCATTTTATAGCTGAGG - Intronic
1161303452 19:3554560-3554582 CAGTCCTCACTTTGAAGCTGCGG - Intronic
1162461191 19:10815423-10815445 GAGTCCTGACTTTATAGGTGGGG - Intronic
1162901155 19:13796037-13796059 GTGTCCTGATTTGGGATCTGGGG - Intronic
1163371917 19:16905888-16905910 GGGTGATGATTTTGTAGGTGGGG + Intronic
1167828101 19:51992991-51993013 GAGCCCTGATTTTGTAGTGAAGG + Exonic
1167887599 19:52514986-52515008 GAGTTTTGCTTTTGTTGCTGAGG + Intergenic
926179696 2:10630753-10630775 CAGCCCTTAATTTGTAGCTGAGG - Intronic
927998273 2:27501914-27501936 GAGGTCTGATTTTGTAGGTTTGG + Intronic
928255595 2:29719624-29719646 TTGTCCTCATTTTGCAGCTGAGG + Intronic
930293715 2:49528281-49528303 GGCTCCTGGTTTTGTTGCTGGGG + Intergenic
930698121 2:54431899-54431921 GTGTCCTTATTTTGCAGATGAGG - Intergenic
932631646 2:73349004-73349026 GATTCATGATATTGTAGCTTTGG + Intergenic
934757943 2:96837981-96838003 GTGTCCTCATTTTCTAGATGAGG + Exonic
938906043 2:135836998-135837020 GAGTTCTAACTTTGTAGCAGGGG - Exonic
939612682 2:144330032-144330054 GAGTCCTGAAGTTCTTGCTGTGG - Intronic
940013321 2:149077910-149077932 AAGTCCTGATGGTGTAGCTTTGG + Intronic
940115398 2:150203117-150203139 TAGTCCTCATTTTGTAGATGAGG + Intergenic
940279928 2:151978555-151978577 GAATCCTCATTTTGTAAGTGAGG - Intronic
940955445 2:159721880-159721902 CAGGGCTGATTTTGTAGGTGTGG - Intronic
942968181 2:181922712-181922734 AAATCCTCATTTTGTAGATGTGG - Intronic
944284982 2:197939342-197939364 GAATTCTGATTTTGTAATTGCGG - Intronic
945194598 2:207226558-207226580 CTGTCCTCATTTTATAGCTGAGG + Intergenic
945893370 2:215454907-215454929 GAGTCCTGTTTTTGCACATGGGG + Intergenic
946724359 2:222647613-222647635 GAGTCCTTATCTTGGACCTGAGG - Intronic
947968955 2:234305820-234305842 AATTTCTGATTTGGTAGCTGTGG + Intergenic
1168775684 20:445463-445485 ATATCCTCATTTTGTAGCTGTGG - Intronic
1169518325 20:6342907-6342929 GAGTCATGATCTTTTTGCTGGGG + Intergenic
1170012841 20:11746398-11746420 CATCCCTGAGTTTGTAGCTGGGG + Intergenic
1170849340 20:19990175-19990197 GACCCCTGATTTTGTGGATGTGG + Exonic
1172355367 20:34276246-34276268 CAGTCCTGATTCTGTAGGTCTGG - Intergenic
1172772803 20:37391493-37391515 GAGTCCTTGCTTTGTAGCTTTGG + Intronic
1176176105 20:63725856-63725878 GAGTTTTGCTTTTGTTGCTGAGG + Intronic
1176699407 21:10024872-10024894 GGGTCCTGAGTTGGCAGCTGAGG - Intergenic
1177210752 21:18068220-18068242 GAGTCTTGCTTTTGTAGCCCAGG + Intronic
1178309135 21:31515168-31515190 GGGTCATGATTTTGGAGTTGGGG - Intronic
1179931825 21:44575713-44575735 GACTACTGATTTTGAAGCTAGGG - Intronic
1181372603 22:22430095-22430117 GTGTCCAGATTCCGTAGCTGTGG + Intergenic
1182972768 22:34593337-34593359 GAGAGCTGTTTTTGTGGCTGGGG - Intergenic
1184094251 22:42308148-42308170 GAGCCCTGGTCTGGTAGCTGGGG + Intronic
949692701 3:6658565-6658587 TAACCCTGATTTTGAAGCTGGGG + Intergenic
949733946 3:7148764-7148786 GAATCCTTATTTTTTAGCTGGGG - Intronic
955019333 3:55103999-55104021 AGATACTGATTTTGTAGCTGTGG - Intergenic
955874723 3:63476980-63477002 TAGTCTTGATTTGGTAGATGTGG + Intronic
957007432 3:74966257-74966279 GAGTCCTGCTTTTGTTGCCCAGG - Intergenic
957059720 3:75472284-75472306 GAGTTGTTGTTTTGTAGCTGGGG + Intergenic
957705018 3:83769989-83770011 GAGGCCTGATTCTGCAGCTGTGG - Intergenic
958487150 3:94727351-94727373 GAGTCAAGACATTGTAGCTGTGG + Intergenic
958812825 3:98881226-98881248 GAGTCTTGCTTTTGTAGCCCAGG - Intronic
958959609 3:100496359-100496381 GTGTCCTGTTTTTCTAGTTGAGG + Intronic
958978337 3:100691868-100691890 GAGTACTGATGTTCTAGTTGAGG - Intronic
960908470 3:122624899-122624921 GTGTCCCCATTTTGTAGATGAGG + Intronic
961293685 3:125867095-125867117 GAGTTGTTGTTTTGTAGCTGGGG - Intergenic
962183727 3:133235959-133235981 GAGTCTTGATTTAGCAGATGTGG + Intronic
962479285 3:135784896-135784918 GAGTCCTGATGTTGAAGTAGGGG - Intergenic
963133727 3:141881175-141881197 GAGTCCTGAGCTTGTCGCTCAGG - Intronic
964734617 3:159903744-159903766 GAGGTCTCACTTTGTAGCTGAGG + Intergenic
969055202 4:4397350-4397372 CTGTCCTGATTTTGTAGGTGGGG + Intronic
969194085 4:5547028-5547050 GATTCCTGAGTCTGCAGCTGTGG - Intronic
969329890 4:6468344-6468366 TTGTCCTGATTTTATAGTTGAGG - Intronic
971672694 4:29583434-29583456 AATTCCTGATTTTGGAGGTGGGG - Intergenic
971775218 4:30954864-30954886 GTCTCCTTATTTTGCAGCTGAGG - Intronic
976005330 4:80423463-80423485 AAGTCCTCATTTTGTTCCTGAGG + Intronic
980975725 4:139608378-139608400 GAGTCCTGCTTTTGTTGCCCAGG - Intergenic
981318283 4:143363308-143363330 GACTCCTGAGTCTGTAGCTCTGG - Intronic
982141196 4:152320310-152320332 GTGTTCTGATTTAGTAGCTTTGG + Intergenic
983910593 4:173234664-173234686 GAGTCCCAATTTTGGAGGTGAGG + Intronic
984288163 4:177760110-177760132 TAATCCTCATTTTGTAGATGAGG - Intronic
985012541 4:185599066-185599088 AAGACCTCATTTTGTTGCTGAGG - Intronic
985354734 4:189106366-189106388 GATTCCTGATGTTGAAGCTGTGG + Intergenic
987726703 5:21709941-21709963 GAGTACTGATATAGAAGCTGTGG + Intergenic
988521200 5:31947068-31947090 GAGCCCTGATTTTATGGATGAGG + Intronic
989005559 5:36807899-36807921 TAATCCTGATTTTATAGATGAGG - Intergenic
990197342 5:53333662-53333684 GAGTCAGGATTTTGTTTCTGTGG + Intergenic
990617588 5:57523158-57523180 GGGTCCTCATTTTATAGATGTGG - Intergenic
990816808 5:59795026-59795048 GAGTCCTGGTATTGCAGATGAGG - Intronic
990872127 5:60443813-60443835 GAATGCTGAGTGTGTAGCTGGGG - Intronic
993144896 5:84081271-84081293 CACTCCTGAATGTGTAGCTGTGG - Intronic
997553355 5:134772825-134772847 GAGTTCTGCTCTTGTTGCTGAGG + Intronic
998398969 5:141838019-141838041 GAATCCCCATTTTGTAGATGAGG - Intergenic
998482124 5:142471345-142471367 GAATCCTGATTGTGTAACTCTGG + Intergenic
999023408 5:148196102-148196124 GAGCTCTGATTTTGTATTTGTGG + Intergenic
999702817 5:154243954-154243976 GAGTCCTCATTTTATAGATGAGG + Intronic
999848158 5:155507825-155507847 GACACCTGATTTTGTAGCCCTGG - Intergenic
1000273662 5:159711941-159711963 AAGACCTGATTTTATAGGTGAGG + Intergenic
1001650396 5:173311686-173311708 GTTTCCTTATTTTGTAGCTAAGG + Intergenic
1001661626 5:173397531-173397553 GAGTCTTGATTTTCCTGCTGGGG + Intergenic
1003442525 6:6156966-6156988 GAGTCTTCATTTTATAGATGAGG + Intronic
1004323824 6:14655114-14655136 GACTCCTGATGTTGGAGGTGGGG - Intergenic
1005401161 6:25436176-25436198 GATACCTGAGTTTGTAGTTGGGG + Intronic
1006573839 6:35028231-35028253 CAGTCCTGGTTTTGCAGCTTGGG + Intronic
1007322101 6:41034881-41034903 GAGACCTCATTTTCTAGTTGGGG + Exonic
1007531727 6:42548562-42548584 GACTCCTCACTTTATAGCTGAGG + Intergenic
1007578060 6:42938817-42938839 GACCCCTGATTTTGAAGCTGAGG + Exonic
1011481958 6:87803371-87803393 GAGTCCTGGTGTTTTAACTGTGG + Intergenic
1013787424 6:113797132-113797154 AAGTGCTGATATTGTAGGTGTGG + Intergenic
1014722359 6:124933042-124933064 GTATCCTTATTTTGTAGATGAGG - Intergenic
1014779809 6:125551198-125551220 GAGTCTTTGTTTTGTAGATGTGG - Intergenic
1016115414 6:140278077-140278099 CAGTCTTGATTCTGTAGGTGTGG + Intergenic
1016739291 6:147510432-147510454 AAGTCTTGATTTTTAAGCTGAGG - Intronic
1021118629 7:16772219-16772241 GAATCCTTATCATGTAGCTGGGG - Intronic
1028841856 7:95437329-95437351 AAATTCTGATTTTGTATCTGAGG - Intergenic
1028910506 7:96202511-96202533 GAGGCCTGATTTTGAGGTTGTGG - Intronic
1031603871 7:123747185-123747207 GAGTCCTGGTTTTCTAGTTCTGG + Intronic
1032053367 7:128663965-128663987 GAGTCCTAATTTTGAAAATGAGG + Intergenic
1033801655 7:144909089-144909111 GAGCCCTGATCTTTGAGCTGTGG + Intergenic
1034761985 7:153681184-153681206 GAGTCTTAATTTTGTAGTTTAGG + Intergenic
1037696264 8:21226927-21226949 GAGCCCTCATTTTGTATATGAGG - Intergenic
1038402564 8:27296551-27296573 GAGTCCTGAGCTTTTTGCTGAGG - Intronic
1041406870 8:57509199-57509221 GAGTCTTGCTCTTGTAGCTCAGG - Intergenic
1041667671 8:60461642-60461664 CAGTTCTGATTTAGTAGCTGTGG + Intergenic
1043468101 8:80534307-80534329 GAGACCTAATATTTTAGCTGTGG + Intergenic
1045137665 8:99239047-99239069 CAGTCCTGTTTTTGTTGGTGAGG + Intronic
1048528408 8:135225677-135225699 TAGTCCTGATTCTGCAGTTGAGG + Intergenic
1048874343 8:138825221-138825243 GAGGCTTGATTTTGTAAGTGTGG - Intronic
1051393674 9:16594779-16594801 GAGCCCTGGATTAGTAGCTGTGG - Intronic
1051870544 9:21732410-21732432 GAGTCTTGATTTTCTAATTGAGG + Intergenic
1052396332 9:27942920-27942942 TATACCTGATTTTGTAACTGGGG + Intergenic
1053128070 9:35599014-35599036 GAGGCCTGAGTCTGCAGCTGTGG - Intergenic
1053307380 9:36994220-36994242 CTGTCCTGATCTTGTAGCTGTGG - Intronic
1056102492 9:83313142-83313164 GAATTCTGATTTAGTAGCTCTGG + Intronic
1057095985 9:92310129-92310151 GAGTCCTGATGTCATATCTGGGG - Intronic
1057686981 9:97243568-97243590 GACTCCTGAGTTTCTGGCTGGGG + Intergenic
1058005010 9:99905461-99905483 ACCTCCTGATTTTGTACCTGAGG + Intergenic
1059091696 9:111366187-111366209 GAGTCCTAATTTTAAAGCTAAGG - Intronic
1059303602 9:113335803-113335825 GTGTCCTAATTTTCTAGCTGGGG - Intronic
1059788843 9:117617828-117617850 CAGTCCTGACTCTGCAGCTGAGG + Intergenic
1188016612 X:25113659-25113681 GATTCCTGATGTTGGAGGTGGGG - Intergenic
1188252400 X:27913603-27913625 GAGGCCTGTCCTTGTAGCTGTGG - Intergenic
1188612605 X:32118595-32118617 GAGTTCTGATAAGGTAGCTGTGG - Intronic
1189169019 X:38891194-38891216 TAATCCTCATTTTGTAGATGAGG - Intergenic
1189358272 X:40327909-40327931 GAGTCATGGTTTTGAACCTGGGG + Intergenic
1192068357 X:67910803-67910825 GAAACCTGATTTTGTGTCTGGGG - Intergenic
1194100333 X:89695258-89695280 GAGTCATAATTTTTTTGCTGTGG + Intergenic
1197755799 X:129993818-129993840 GAGTCTTGCTTTTGTAGCTCAGG + Intronic
1197813831 X:130476357-130476379 GATTCCTGATGTTGGAGGTGGGG - Intergenic
1199328725 X:146533292-146533314 TATTCCTTATTTTGTAGCTAAGG - Intergenic
1200453336 Y:3356620-3356642 GAGTCATAATTTTTTTGCTGTGG + Intergenic