ID: 903953303

View in Genome Browser
Species Human (GRCh38)
Location 1:27009014-27009036
Sequence AGTCCTGATTTTGTAGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 261}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903953300_903953303 22 Left 903953300 1:27008969-27008991 CCATCCTTCTTTTTTTTTTTTTT 0: 131
1: 1925
2: 14373
3: 61996
4: 112810
Right 903953303 1:27009014-27009036 AGTCCTGATTTTGTAGCTGAGGG 0: 1
1: 0
2: 1
3: 18
4: 261
903953299_903953303 25 Left 903953299 1:27008966-27008988 CCTCCATCCTTCTTTTTTTTTTT 0: 1
1: 35
2: 780
3: 5220
4: 25278
Right 903953303 1:27009014-27009036 AGTCCTGATTTTGTAGCTGAGGG 0: 1
1: 0
2: 1
3: 18
4: 261
903953301_903953303 18 Left 903953301 1:27008973-27008995 CCTTCTTTTTTTTTTTTTTTTTT 0: 2880
1: 30954
2: 37506
3: 74036
4: 136962
Right 903953303 1:27009014-27009036 AGTCCTGATTTTGTAGCTGAGGG 0: 1
1: 0
2: 1
3: 18
4: 261
903953298_903953303 30 Left 903953298 1:27008961-27008983 CCTTTCCTCCATCCTTCTTTTTT 0: 1
1: 3
2: 73
3: 978
4: 7948
Right 903953303 1:27009014-27009036 AGTCCTGATTTTGTAGCTGAGGG 0: 1
1: 0
2: 1
3: 18
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903953303 Original CRISPR AGTCCTGATTTTGTAGCTGA GGG Intronic
901649954 1:10737689-10737711 TGTGCTGATCTTGTAGCTGCAGG - Intronic
903271333 1:22190294-22190316 AGTCCTGATGGGGCAGCTGAGGG - Intergenic
903953303 1:27009014-27009036 AGTCCTGATTTTGTAGCTGAGGG + Intronic
907230497 1:52994158-52994180 AGTGTTGATTTTGTTGCTAATGG + Intronic
907386896 1:54131842-54131864 AGTCGTGAGATTGGAGCTGAAGG - Intergenic
907503772 1:54902597-54902619 AGTCCTGCTTTTCTAGGGGAGGG - Intergenic
907636504 1:56140308-56140330 AATCTTCATTTTGTAGATGAGGG - Intergenic
908461903 1:64354660-64354682 AGTCCTGCTTTTCTAGAGGAGGG - Intergenic
908873658 1:68645015-68645037 AGTCCTGAATTTGTATCGGCTGG + Intergenic
913395480 1:118366307-118366329 AACCCTCATGTTGTAGCTGAAGG + Intergenic
914973810 1:152338034-152338056 GCTCCTGATTTTGTTTCTGAAGG + Intergenic
917368825 1:174265403-174265425 AGTTCTCATTTTGTATTTGAAGG + Intronic
917483365 1:175432391-175432413 ATTCCTGGTTCTGGAGCTGAGGG - Intronic
918215243 1:182387693-182387715 TGTCCTTATTTTATAGATGAGGG + Intronic
918358659 1:183732134-183732156 ATTCCTGACTTTCTAGCTGGAGG - Intronic
919085025 1:192911262-192911284 TGTTATGATTTGGTAGCTGATGG + Intergenic
922425476 1:225488448-225488470 AGTCCCTATTATGTAGCTGGTGG - Exonic
923244545 1:232119136-232119158 AGTCCTGCTTTTCTAGAGGAGGG + Intergenic
923516722 1:234703917-234703939 AATCCTGAGGTTCTAGCTGAAGG + Intergenic
923997524 1:239512234-239512256 AGTCCTGGTTTTCAAGCTGCAGG + Intronic
1063027781 10:2199571-2199593 AGTGAATATTTTGTAGCTGAAGG + Intergenic
1063527871 10:6801776-6801798 AGTCCTGCTTTTCTAGAGGATGG - Intergenic
1064964104 10:20998295-20998317 TGTTCTCATTTTGTAGATGAGGG - Intronic
1065084361 10:22159727-22159749 AGTCCTGCTTTAGTAGTTGTTGG - Intergenic
1065255995 10:23868497-23868519 AGTCATGATTTGGTAACAGATGG - Intronic
1065485552 10:26233507-26233529 AGTCCTGCCTTTGAAGCTGCAGG + Intronic
1065588871 10:27246007-27246029 AGTCCTGCTTTTCTTTCTGATGG + Intergenic
1065848370 10:29765290-29765312 AGTCCTCTTTTTGTAGTTGCAGG - Intergenic
1070629980 10:78077549-78077571 AGTCCTGATTCTGTCCCTGAGGG - Intergenic
1074783349 10:116818178-116818200 AGACTTGATTCTGTAGCTCAGGG - Intergenic
1075469179 10:122675240-122675262 ATTCCTGATTTTTTAGCTAAAGG - Intergenic
1075596634 10:123735711-123735733 AGTCCTGATTTTTTTGCTAGTGG - Intronic
1078337521 11:10475755-10475777 ACTCCTGGTTTTGGAGATGAAGG + Intronic
1079155904 11:17947774-17947796 TATCCTTATTTTGTAGATGAGGG - Intronic
1080618453 11:33966524-33966546 AGACCTGAATTTCTTGCTGATGG - Intergenic
1083935778 11:65869325-65869347 TGTCCTCATTTTGTAGAGGAAGG + Intronic
1084682299 11:70673534-70673556 ATTTCTGGTTTTGTAGCTGTGGG - Intronic
1084859833 11:72011125-72011147 TCTCCTGATTTTGGAGGTGACGG - Intronic
1085473125 11:76770918-76770940 AGTCCTCGTTTTGGAGCTGCAGG - Intergenic
1086258065 11:84903674-84903696 TATCCTAATTTTGTAGTTGAGGG - Intronic
1087385859 11:97467714-97467736 AGAGCTGCTTTTGTAGATGATGG + Intergenic
1088151127 11:106746732-106746754 AGCCATGATTTTGTAGTTTATGG + Intronic
1090337599 11:125983392-125983414 AGCCCTGTTTCTGTACCTGATGG - Intronic
1090644373 11:128755845-128755867 AGTCCTGCTTTTGCACCAGAAGG - Intronic
1090899307 11:131013252-131013274 ACTCCTGATTCTGTGGCTGACGG - Intergenic
1092068302 12:5611521-5611543 ATTCCTGGTTATGTAGCTCAGGG + Intronic
1092474263 12:8805849-8805871 AGTCCCGCTTTTGTAGAGGAGGG + Intergenic
1094203318 12:27815371-27815393 AGTACAGAATTTGTTGCTGAAGG - Intergenic
1097860181 12:64511171-64511193 AGTCCTGTTTCTGCAGATGAAGG - Intergenic
1098389746 12:69956972-69956994 AGTCCTGATTTAGCAGCTCAAGG - Intronic
1098628857 12:72704305-72704327 AGTCCCGCTTTTCTAGATGAGGG + Intergenic
1100201007 12:92297783-92297805 AGGCCTCATTTTGTAGCAGTCGG - Intergenic
1100561134 12:95750046-95750068 AGTCCTGCTTTTCTAGAGGAGGG + Intronic
1100715316 12:97299556-97299578 AGACCTCATTTTATAGTTGAAGG + Intergenic
1100730981 12:97468948-97468970 TTTCCTGATTTTGTAGATTATGG + Intergenic
1101011445 12:100454498-100454520 AGTTCTTGTTTTGTGGCTGAAGG + Intergenic
1101781343 12:107840692-107840714 AGTCCTGCCTTTGTATATGAAGG - Intergenic
1102176282 12:110877546-110877568 AGTCCTGATGTTGTACCTTAGGG + Intronic
1104799726 12:131546262-131546284 AGTCCTGATCTTTTTGCTGGCGG - Intergenic
1105942445 13:25161087-25161109 AGACCTTTTTTGGTAGCTGATGG - Intergenic
1107075359 13:36317350-36317372 AGTCCTGCTTTTCTAGAGGAGGG + Intronic
1107978309 13:45711480-45711502 CATCCTGATTTTGTCACTGATGG - Intronic
1108947244 13:56041335-56041357 AGTCCTGCTTTTCTAGAGGAGGG + Intergenic
1109470317 13:62795600-62795622 AGACATGATGTTGTAGCTAAAGG + Intergenic
1109863365 13:68228848-68228870 AGTTCTGCTTCTGTAGCTGTAGG - Intergenic
1112220037 13:97479249-97479271 AGTCCCCACTTTGTGGCTGATGG - Intergenic
1114638982 14:24206416-24206438 AGTCCTAAGTCAGTAGCTGAGGG + Intronic
1116640097 14:47450734-47450756 ACTCCTTATTTTCAAGCTGAAGG + Intronic
1117098758 14:52323996-52324018 AGTCCTGAGTTTTTAGTTAAAGG - Intronic
1117148822 14:52864286-52864308 AGTCTTAATTTTGTATCAGATGG - Intronic
1118817410 14:69323241-69323263 AGTTTTGAGTTTGGAGCTGATGG - Intronic
1119607457 14:76032961-76032983 GGACCTGATTTAGGAGCTGATGG + Intronic
1119824343 14:77644637-77644659 TATCCTGATTTTGCAGATGAGGG + Intergenic
1120055469 14:79919002-79919024 AGGTCTGATTTTAAAGCTGAAGG + Intergenic
1120062218 14:79997325-79997347 AGTCCTGATTTTGATCGTGATGG - Intergenic
1120667275 14:87321653-87321675 AGTGCTTATTATGTAACTGAAGG - Intergenic
1120745603 14:88148252-88148274 ACTTCTGTTTCTGTAGCTGAAGG - Intergenic
1121590136 14:95099342-95099364 AATCTTGCTTTTGTAGCTCAGGG - Intronic
1126197036 15:45944013-45944035 AGCCTTGATTTTATATCTGAAGG + Intergenic
1127758008 15:62111897-62111919 AGACCTGAATTACTAGCTGATGG - Intergenic
1128663936 15:69524616-69524638 AGTCCAGGTATTGTAACTGATGG + Intergenic
1130309281 15:82738888-82738910 AGTCCTCATTATATAGCTGAGGG + Intergenic
1130854888 15:87832188-87832210 AGTCCTGCTTTTCTAGAGGAGGG + Intergenic
1132093659 15:98966155-98966177 AGTCCTGAGTTGGTAGCTGGTGG - Intergenic
1133287724 16:4698328-4698350 CCTCCTGATTTTGTAACTGAGGG - Intronic
1133620846 16:7524832-7524854 AGTTCTGATTTTGAAGCTGATGG + Intronic
1140726902 16:77821815-77821837 AGTTCTGCTTTTGTAGGGGAAGG + Intronic
1141293015 16:82737884-82737906 AGCCTTGATTATGAAGCTGATGG - Intronic
1141339420 16:83189247-83189269 AGGCCTGAGCTTGCAGCTGAGGG - Intronic
1141878446 16:86842194-86842216 AGTCTTGATGTTGTAGTTGGGGG + Intergenic
1142982781 17:3681103-3681125 AGTCCTGACTGTGCTGCTGAAGG - Intronic
1143926863 17:10378766-10378788 TTTTCTGATTTTGCAGCTGAAGG - Intergenic
1147158624 17:38558387-38558409 ACTCCTGGTTCTGTAGCTGCGGG + Exonic
1147807816 17:43144607-43144629 AGTCCTGCTTTTCTTTCTGATGG + Intergenic
1148169596 17:45508031-45508053 AGTCCTGCTTTTCTTTCTGATGG + Intergenic
1148365751 17:47054625-47054647 AGTCCTGCTTTTCTTTCTGATGG - Intergenic
1148538718 17:48462711-48462733 AGTCCTGAATTTCTACCTAAGGG - Intergenic
1149634509 17:58155968-58155990 GGTCATGACTGTGTAGCTGATGG - Exonic
1153129777 18:1841530-1841552 CGTCCTAATTCTGAAGCTGAAGG - Intergenic
1153890417 18:9509229-9509251 GGGCATGATTTTGTAGATGATGG - Intronic
1155255727 18:23996657-23996679 AGTCCTGATTTAGTAGGTATGGG - Intronic
1155588563 18:27397864-27397886 ATTCCTGATTCTATAGCAGATGG + Intergenic
1156012201 18:32508544-32508566 TGCTATGATTTTGTAGCTGATGG + Intergenic
1156944371 18:42810804-42810826 AGTTTAGATTTTGTATCTGAAGG - Intronic
1157696454 18:49727510-49727532 TTTCCTGATTTTATAGGTGAAGG + Intergenic
1157999201 18:52596510-52596532 AGTCTTGATTTAGTAGATGTGGG - Intronic
1158566974 18:58562235-58562257 AGTTATGATTTTGTGGATGATGG + Intronic
1159014058 18:63087386-63087408 AGTCCTGTTTTGGTAGCTAAGGG + Intergenic
1159780709 18:72657395-72657417 AGTCTTCAGTTTGTGGCTGAAGG - Intergenic
1164094611 19:21995648-21995670 CGTCCTGATTTGCTAGCTGTTGG + Intronic
1164114178 19:22201114-22201136 TGTCCTGATTTGCTAGCTGTTGG + Intergenic
1164198320 19:22992980-22993002 TGTCCTGATTTGCTAGCTGGTGG + Intronic
1164729929 19:30495869-30495891 AGTCCAGACTTTGTAGCGGATGG + Intronic
1166194258 19:41195704-41195726 AGTCATGCTTTTGTAGGTGCTGG - Intronic
1166543901 19:43623004-43623026 AGACCTGGTTTTGTAGCCTAGGG + Exonic
1168238298 19:55076881-55076903 AGCCCTGATTTTCTAGCAAAGGG - Intronic
925003235 2:422770-422792 CGTCCTGATGTTGTTGCTCAGGG + Intergenic
925111074 2:1338112-1338134 GTTCCTGATTTTAAAGCTGATGG - Intronic
925471627 2:4168591-4168613 AGTCTTCATTCTGTGGCTGAAGG - Intergenic
925773269 2:7305244-7305266 AGTCCTGACTTTGTTACTGCAGG + Intergenic
925797766 2:7565326-7565348 AATCATGATTTTGTAGCAGCTGG + Intergenic
928397670 2:30955473-30955495 AGTCCCGATTTTATTGATGAAGG - Intronic
928490181 2:31775254-31775276 AGTCTTCATTCTGTGGCTGAAGG - Intergenic
929076892 2:38085527-38085549 AGTCCTGCTTTTCTAGAGGAGGG - Intronic
929809968 2:45181490-45181512 AGTACTGATGGTGAAGCTGATGG - Intergenic
930125083 2:47789614-47789636 AGTCCTCCCTTTGTATCTGAGGG + Intronic
931755738 2:65372465-65372487 GGTGCTGATTATGTGGCTGATGG + Intronic
932295652 2:70621598-70621620 AGTCCTGCTTTTCTAGGGGAGGG + Intronic
932318175 2:70800351-70800373 AGTCGTGATTGTTTTGCTGATGG - Intergenic
932710157 2:74057095-74057117 AGAGCTGGCTTTGTAGCTGAGGG + Intronic
936535469 2:113307785-113307807 AATCCTGATTTTGAAGCTCCTGG + Intergenic
940013322 2:149077911-149077933 AGTCCTGATGGTGTAGCTTTGGG + Intronic
940955444 2:159721879-159721901 AGGGCTGATTTTGTAGGTGTGGG - Intronic
944387249 2:199180393-199180415 AGTCCTGCTTTTCTAGGGGAGGG + Intergenic
945345933 2:208716601-208716623 AGTCCTGATCTTTTTGCTGGTGG + Intronic
946295576 2:218781536-218781558 AGACCAGATTTCGTAGATGATGG - Intergenic
946809202 2:223505088-223505110 AGTCTTGACTTTGTAGTTGGTGG - Intergenic
947448183 2:230180547-230180569 TGTCCTCATTTTATAGATGAGGG + Intronic
947968956 2:234305821-234305843 ATTTCTGATTTGGTAGCTGTGGG + Intergenic
948482874 2:238261481-238261503 AGCCCTGAGTGAGTAGCTGAAGG - Intronic
948655071 2:239471472-239471494 AGTCCTGGGTTTCTAGCTGCAGG - Intergenic
1169519557 20:6356437-6356459 AGTCCTGCATTTCTAGATGAGGG - Intergenic
1169934765 20:10871496-10871518 GATCCTGATTTAGTAGGTGAGGG + Intergenic
1170364663 20:15585819-15585841 AGCCCTGAATTTGTATCTCAGGG + Intronic
1172355366 20:34276245-34276267 AGTCCTGATTCTGTAGGTCTGGG - Intergenic
1173781441 20:45760330-45760352 AGTCCTGCTTTTCTAGGGGAGGG + Intronic
1177448431 21:21231188-21231210 AGAGCTGATTTAGTAGATGAGGG + Intronic
1181308142 22:21928503-21928525 AGTCCAGCTTTTCCAGCTGAAGG + Intronic
1182077739 22:27506397-27506419 AGTCCTGACTTTGGCACTGATGG - Intergenic
1184082859 22:42236945-42236967 AGTCCTAATCTTTTTGCTGACGG + Intronic
949670946 3:6398617-6398639 AGTCCCGCTTTTGTAGGGGAAGG + Intergenic
951601588 3:24382184-24382206 GGTCTTAATTTTGTATCTGAAGG - Intronic
952819310 3:37472196-37472218 AGTCTTGATCTTGAAGGTGAGGG - Intronic
953176972 3:40561874-40561896 AGTCCTGCTTTTCTAGGGGAGGG + Intronic
955078741 3:55638188-55638210 TATCCTGATTTTATAGGTGAGGG - Intronic
955196598 3:56810171-56810193 ATTACTGAGTTTGTAGTTGATGG - Intronic
955874724 3:63476981-63477003 AGTCTTGATTTGGTAGATGTGGG + Intronic
956657066 3:71562850-71562872 AGTCCAGATTATGTATCTGTTGG - Intronic
957295000 3:78324676-78324698 AGTCCTGCTTTTCTAGAGGAGGG + Intergenic
957357382 3:79110100-79110122 TGTCCCCATTTTGTACCTGAAGG - Intronic
963456875 3:145555911-145555933 AGTCCTGCTTTTCTAGGGGAGGG - Intergenic
965146817 3:164915237-164915259 AGTCCTAATCTTTTTGCTGATGG + Intergenic
965457547 3:168922470-168922492 AGTTCTCCTTATGTAGCTGAGGG - Intergenic
965626551 3:170688205-170688227 AGTCCTGCTTTTCTAGGGGAGGG - Intronic
966066599 3:175828513-175828535 AGTCCTGCTTTTCTAGGGGAGGG + Intergenic
966501595 3:180648203-180648225 AATCCAGTTTTTGTAACTGATGG + Exonic
966639709 3:182176230-182176252 AGTCCTGATTTTACAGTTCAGGG + Intergenic
968266200 3:197365272-197365294 AGTCCTGAGATTGTAGCACATGG - Intergenic
969130273 4:4986021-4986043 AGTCCTTATTTTACAGCTGATGG + Intergenic
970135547 4:12918898-12918920 TGTGATGATTTTGTAGCAGATGG + Intergenic
970389926 4:15598457-15598479 TGTCCTGATTTTACAGATGAGGG - Intronic
970491791 4:16582615-16582637 AGTCATTATTTTGTTGCTGTTGG - Intronic
970866644 4:20766621-20766643 TGTCCTCATTTTGAAGGTGAGGG + Intronic
971061070 4:22970619-22970641 ACTGCTGAGTTTGCAGCTGATGG + Intergenic
972190084 4:36580458-36580480 AGTCCTGAGTTTTTCTCTGATGG - Intergenic
976766040 4:88598686-88598708 TCTCCTGATTTTGGAGCTTAAGG + Intronic
977276898 4:94988969-94988991 AGTCCTCATTTTTCACCTGAGGG - Intronic
977401379 4:96536624-96536646 AGTCATAATTTTTTTGCTGATGG - Intergenic
978257160 4:106706318-106706340 ACTCATAATTTTGTAGTTGACGG - Intergenic
979231067 4:118349513-118349535 AATCCTCATTTTGTAGTTTATGG - Intronic
979384201 4:120044742-120044764 AGTCCTGAACTTTTTGCTGATGG + Intergenic
979695650 4:123610179-123610201 AGTCTTGAATGAGTAGCTGAAGG + Intergenic
980196474 4:129595464-129595486 ACTCCTGATTATGTATCTAAAGG + Intergenic
980915508 4:139029835-139029857 AGTTTTGATTTTCTAGCTGATGG + Intronic
982525533 4:156473200-156473222 AGTCTTCAGTTTGAAGCTGAAGG - Intergenic
984443741 4:179806736-179806758 AGTCCTGAGTTTCTATCTGATGG - Intergenic
984448392 4:179867625-179867647 AGTCCCCATTGTGTAGCTGCTGG - Intergenic
984708743 4:182867072-182867094 AGACATGATTTTATAGATGAGGG - Intergenic
985986859 5:3523207-3523229 AGTGCTGATTTAGTGGCAGAGGG - Intergenic
987281832 5:16420957-16420979 AGTCCTGCTTTTCTAGGGGAGGG + Intergenic
987478538 5:18423080-18423102 GGTACTGATTTTCTAGCTGATGG - Intergenic
989462484 5:41716577-41716599 AGTAATGATTATGTAGCTCAAGG + Intergenic
990037701 5:51342312-51342334 GGTTCTGAATTTGTAGCTTAGGG - Intergenic
990773918 5:59283960-59283982 TGTCCTTATTTTGTAGAAGAAGG - Intronic
991742818 5:69699148-69699170 TGTCCTGATTTGTTAGCTTATGG + Intergenic
991754878 5:69856056-69856078 TGTCCTGATTTGTTAGCTTATGG - Intergenic
991794391 5:70278886-70278908 TGTCCTGATTTGTTAGCTTATGG + Intergenic
991822206 5:70574461-70574483 TGTCCTGATTTGTTAGCTTATGG + Intergenic
991834205 5:70731204-70731226 TGTCCTGATTTGTTAGCTTATGG - Intergenic
991886771 5:71278428-71278450 TGTCCTGATTTGTTAGCTTATGG + Intergenic
993144895 5:84081270-84081292 ACTCCTGAATGTGTAGCTGTGGG - Intronic
996527827 5:124497902-124497924 AGTCCTGCTTTTCTAGGGGAGGG + Intergenic
998973550 5:147619040-147619062 AGTCTTTCTTTTGTAGATGAAGG + Intronic
999208144 5:149864831-149864853 TGTCCTGATTTAATGGCTGAAGG - Intronic
999372181 5:151062630-151062652 AGTCCTGAGTTTGCAGTTGCTGG - Intronic
1000790435 5:165600354-165600376 AGACTAGATTTTGTACCTGAGGG - Intergenic
1001459014 5:171892392-171892414 ATTACTGATTTTGTGGCTGCAGG - Intronic
1001459095 5:171893330-171893352 AGTTCTGATTTGGTGGCAGATGG - Intronic
1002448325 5:179303565-179303587 AGCCCTGTTGTTGTAGCTCAAGG + Intronic
1002654554 5:180734245-180734267 AGTACTTACTTTATAGCTGAAGG + Intergenic
1003604706 6:7548648-7548670 AGTACTGTTTCTGTAGCTGCTGG + Intronic
1003683321 6:8277192-8277214 TGTCCTGTTTTTGCAGATGAAGG + Intergenic
1004437046 6:15606246-15606268 AGTCCTGTTTTTGTAGGGGCAGG + Intronic
1004566884 6:16806576-16806598 AATTCTGATTTCATAGCTGATGG + Intergenic
1007710756 6:43822517-43822539 AGTCCTGATTCTCTCACTGATGG - Intergenic
1008245659 6:49169355-49169377 AATGTTTATTTTGTAGCTGATGG + Intergenic
1010698677 6:79012326-79012348 ATTCCTTATTTTCTAGCTGTAGG + Intronic
1012315600 6:97780530-97780552 AGTCCTGCTTTTCTAGAGGAGGG + Intergenic
1013408105 6:109860567-109860589 AGTCCTGCTTTTCTAGAGGAGGG - Intergenic
1013787425 6:113797133-113797155 AGTGCTGATATTGTAGGTGTGGG + Intergenic
1014455107 6:121625259-121625281 AGTCCTGCTTTTCTGGGTGAGGG - Intergenic
1015967036 6:138704603-138704625 AGTCTTGAGTCTGTGGCTGAAGG + Intergenic
1016115415 6:140278078-140278100 AGTCTTGATTCTGTAGGTGTGGG + Intergenic
1018211834 6:161489755-161489777 AGACCTGATTTATTAGGTGAAGG + Intronic
1020591289 7:10140983-10141005 ATTCTTGATTTTGTTCCTGAAGG - Intergenic
1023606125 7:41932824-41932846 AGTACAGATTTAGGAGCTGAGGG - Intergenic
1027623881 7:80524897-80524919 AGACCTCTTCTTGTAGCTGAAGG - Intronic
1028129187 7:87150152-87150174 AGTCCTGTTAATATAGCTGATGG - Intergenic
1033909690 7:146248222-146248244 AGTCCTGCTTTTCTAGAGGAGGG - Intronic
1035455097 7:159003167-159003189 AGTCCTAATTTTCTTGCTGGTGG + Intergenic
1036476117 8:9095069-9095091 AATCCTCATCTTGCAGCTGATGG - Intronic
1036501229 8:9315983-9316005 ATTCCAGATTTTGTTTCTGATGG - Intergenic
1037154775 8:15686145-15686167 AGTCATTATTGTGTAGCTAAAGG + Intronic
1037435478 8:18858346-18858368 AGTCCTAATCTTTTTGCTGATGG + Intronic
1039794451 8:40900337-40900359 AGTCCTGAATTTTTAGCTCTTGG - Intergenic
1043718115 8:83509931-83509953 AGTCCTGCTTTTCTGGCGGAGGG - Intergenic
1044114448 8:88317367-88317389 AGTCCTCTTTTTGTGGCTGGAGG - Intronic
1044252204 8:90016836-90016858 TGTCCCCATTTTGTAGATGAAGG + Intronic
1044499253 8:92932070-92932092 AGTGCTGACTTGGAAGCTGACGG - Intronic
1045158151 8:99503292-99503314 AGTCATAATCTTGTTGCTGATGG + Intronic
1045480071 8:102584697-102584719 ACTGCTGATTTTGTAACTGCAGG - Intergenic
1046266381 8:111836723-111836745 GGTCCTAGATTTGTAGCTGAAGG - Intergenic
1046543149 8:115612596-115612618 AGACCTGTTTTTCCAGCTGATGG - Intronic
1046748691 8:117903837-117903859 AGTTCGGATTTTTTGGCTGAAGG - Intronic
1047188388 8:122656136-122656158 AGTCCTTGTTTTCTTGCTGATGG - Intergenic
1048528409 8:135225678-135225700 AGTCCTGATTCTGCAGTTGAGGG + Intergenic
1048535055 8:135285276-135285298 AGTCCAGATTTGTTAGCTGAAGG + Intergenic
1049869052 8:144959109-144959131 AGTCCTGCTTTTCTAGGGGAGGG - Intergenic
1050368027 9:4890459-4890481 ATTTCTGCTTTTGTAGCTGTAGG + Intergenic
1050640238 9:7659761-7659783 GGTCCTGAATAAGTAGCTGAAGG + Intergenic
1050958813 9:11700748-11700770 AATTCTGATCTTGTAGATGAAGG + Intergenic
1050986114 9:12085186-12085208 TGTCATGATTTTGTGGGTGAGGG + Intergenic
1051146246 9:14030597-14030619 AATCTTGATTTTGTAACTTAAGG + Intergenic
1051870545 9:21732411-21732433 AGTCTTGATTTTCTAATTGAGGG + Intergenic
1053132144 9:35621775-35621797 GGTCCTGATTTTGAAGGTGCAGG + Intronic
1053307379 9:36994219-36994241 TGTCCTGATCTTGTAGCTGTGGG - Intronic
1055500153 9:76895098-76895120 AGTCCTGTTTTTTCAACTGAGGG + Intronic
1055708645 9:79035433-79035455 AGTTCTTATTTTGCAGATGAAGG + Intergenic
1055798326 9:80001037-80001059 AGTCCTGTTTTTGTTACTGTTGG + Intergenic
1055876976 9:80954838-80954860 AGCTCTGATTCTGCAGCTGAAGG + Intergenic
1056607134 9:88095337-88095359 AGTGGTGATTTTCTAGCTGATGG - Intergenic
1056628964 9:88276909-88276931 AGTCCTGATGTTGAGGCTGGTGG - Intergenic
1058069585 9:100587924-100587946 AGTACTGATTCTGTACTTGAAGG + Intergenic
1058570820 9:106341068-106341090 AATACTGAATGTGTAGCTGAGGG + Intergenic
1058612217 9:106789264-106789286 AGTCCTGCTTTTCTAGAGGAGGG + Intergenic
1059598615 9:115751059-115751081 AGTACTTATTTTGTTGCTTATGG - Intergenic
1059621278 9:116008399-116008421 GGTCTTGATTTTGTCACTGATGG - Intergenic
1060666913 9:125437171-125437193 GGTGTTGATTTTGTGGCTGAAGG + Intergenic
1060898105 9:127232267-127232289 ACTCCTGCTTCAGTAGCTGAAGG - Intronic
1062330938 9:136044716-136044738 AGTCCTGAGTTTTGAGCTGCTGG + Intronic
1185858754 X:3559001-3559023 AGTCCTGCTTTTCTAGGGGAGGG - Intergenic
1185962041 X:4555000-4555022 AATCCTGGCTTTTTAGCTGATGG + Intergenic
1193914556 X:87350049-87350071 GGTCATGATTTTTTACCTGATGG + Intergenic
1196072857 X:111544830-111544852 AGTCCTGCTTTTCTAGAGGAGGG + Intergenic
1197922959 X:131614968-131614990 AGTTCTGGTTTAGTTGCTGAGGG - Intergenic
1198159646 X:133994860-133994882 AATCCTCATTTTGTAAGTGAAGG - Intergenic
1198598191 X:138259517-138259539 AGTCCTGCTTTTCTAGGGGAAGG + Intergenic
1199986152 X:152953064-152953086 AGTCCTCATTGAGGAGCTGAAGG + Intronic
1200831631 Y:7691935-7691957 AGTCCTGTTTTGGTACATGATGG + Intergenic
1200841408 Y:7785288-7785310 AGTCTTCATTTTGTAAATGAGGG - Intergenic
1201751695 Y:17438969-17438991 AATCCTGGCTTTTTAGCTGATGG + Intergenic