ID: 903953305

View in Genome Browser
Species Human (GRCh38)
Location 1:27009017-27009039
Sequence CCTGATTTTGTAGCTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903953299_903953305 28 Left 903953299 1:27008966-27008988 CCTCCATCCTTCTTTTTTTTTTT 0: 1
1: 35
2: 780
3: 5220
4: 25278
Right 903953305 1:27009017-27009039 CCTGATTTTGTAGCTGAGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 213
903953300_903953305 25 Left 903953300 1:27008969-27008991 CCATCCTTCTTTTTTTTTTTTTT 0: 131
1: 1925
2: 14373
3: 61996
4: 112810
Right 903953305 1:27009017-27009039 CCTGATTTTGTAGCTGAGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 213
903953301_903953305 21 Left 903953301 1:27008973-27008995 CCTTCTTTTTTTTTTTTTTTTTT 0: 2880
1: 30954
2: 37506
3: 74036
4: 136962
Right 903953305 1:27009017-27009039 CCTGATTTTGTAGCTGAGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903953305 Original CRISPR CCTGATTTTGTAGCTGAGGG TGG Intronic
900768791 1:4524101-4524123 CCTGAGTCTGTAGGTCAGGGTGG + Intergenic
901838732 1:11940429-11940451 CCTGCCTTGGTAGCTGCGGGGGG - Intronic
903177452 1:21589529-21589551 CCTCATTTTGTTGCTGAGGCTGG - Intergenic
903287354 1:22285486-22285508 CGTGAGTCTGTAGCTGAAGGAGG - Intergenic
903798990 1:25952503-25952525 CCTCATTTTGTAGATCAGGAAGG - Intergenic
903953305 1:27009017-27009039 CCTGATTTTGTAGCTGAGGGTGG + Intronic
904490829 1:30858067-30858089 TCTGATATCATAGCTGAGGGAGG - Intergenic
907203884 1:52752104-52752126 CCTGAATTGGCATCTGAGGGAGG - Intronic
907446771 1:54513188-54513210 CCTGATTTAGTAGAAGGGGGGGG + Intergenic
907681308 1:56566616-56566638 CCTGGTTTTGCAGCTCAGAGAGG - Intronic
909950687 1:81716657-81716679 ACTGATTTTGTTGTTGATGGTGG - Intronic
912956447 1:114156931-114156953 CCTGGCTCTGAAGCTGAGGGTGG + Intergenic
914956278 1:152165431-152165453 CCTCATTTTATAGATAAGGGGGG - Intergenic
917263712 1:173197051-173197073 CATGATCTTGTAGCTGATGAAGG - Intronic
918008421 1:180563599-180563621 CCTGATTCTTTCGTTGAGGGTGG + Intergenic
919115242 1:193273324-193273346 CCTGTTTTTGTTGCTTAGTGAGG + Intergenic
920172566 1:204080866-204080888 CCAGCTTCTGTAGCTGGGGGTGG + Intronic
921691651 1:218157858-218157880 CCTGCTTTTAGAGCTGAGGATGG - Intergenic
922616268 1:226962962-226962984 CCTGATTTGGTGCCTGAGTGTGG + Intronic
924215070 1:241812549-241812571 TCTCACTTTGTTGCTGAGGGTGG + Intergenic
1066672469 10:37854964-37854986 TCTGATTTAGTAGCTGTGGATGG - Intronic
1067955992 10:50791381-50791403 CCTGAGTTTGGAGCTGAGAAAGG - Intronic
1069535497 10:69249919-69249941 CCTGATTTTGCAGATGTGGAAGG + Intronic
1069817385 10:71207040-71207062 CCAGATTTGGTGCCTGAGGGAGG - Intergenic
1069870342 10:71529138-71529160 CCTGATTCAGTAGCTCTGGGTGG + Intronic
1074204631 10:111272188-111272210 CCTGATTCTGGAGATGAGAGAGG + Intergenic
1078337525 11:10475758-10475780 CCTGGTTTTGGAGATGAAGGGGG + Intronic
1080427836 11:32172516-32172538 CCTGGTTTTGGAGGGGAGGGAGG + Intergenic
1080618451 11:33966521-33966543 CCTGAATTTCTTGCTGATGGAGG - Intergenic
1081226812 11:40533878-40533900 CCTCATTTTGCAGTTGAAGGAGG - Intronic
1082062902 11:47875669-47875691 CCTGGTTTTGTGGCTCAGGTAGG - Intergenic
1083873882 11:65509630-65509652 TCTCATTTTGTAGCTCAGGTTGG + Intergenic
1084722734 11:70918276-70918298 CCTGACCTTGTAGCTGATGCAGG - Intronic
1084775810 11:71374342-71374364 CCTGATTCTGGAGCTGGAGGAGG - Intergenic
1084859829 11:72011122-72011144 CCTGATTTTGGAGGTGACGGGGG - Intronic
1086109519 11:83184038-83184060 CCTGATTGTGAGGCTGAGGCAGG + Intronic
1088096228 11:106104233-106104255 ATGGATTTTGTATCTGAGGGGGG - Intergenic
1089600674 11:119612700-119612722 CCTCAAATTGTAGCTGAGGAAGG - Intergenic
1091710793 12:2738573-2738595 CCTGCTATTGCAGCTGGGGGTGG + Intergenic
1095939340 12:47716015-47716037 CCTGAGACTGTAGCAGAGGGTGG + Intronic
1098643194 12:72863615-72863637 TCTGATTTAGTAGCTGGGGTGGG + Intergenic
1099318820 12:81119131-81119153 GCTGATTTTGTGGCTCAGGTGGG - Intronic
1099601129 12:84739146-84739168 CCTCATTTTAAGGCTGAGGGAGG - Intergenic
1102861396 12:116339332-116339354 CTGGCTTCTGTAGCTGAGGGAGG + Intergenic
1104343877 12:127978263-127978285 ACTGATTTTGTGGCTGGGTGCGG + Intergenic
1105630234 13:22156608-22156630 TCTGATTTAGTAGTTGAGGTTGG + Intergenic
1106420628 13:29582675-29582697 TCTGATTTGGGAGCTCAGGGAGG - Intronic
1109309247 13:60672504-60672526 CCTGGTTTTCTGCCTGAGGGTGG + Intergenic
1109502037 13:63250189-63250211 CATAATTATGTAGCTGAGAGGGG - Intergenic
1110225022 13:73110718-73110740 CCTGATTTTGGAGCTTAGCATGG - Intergenic
1110316762 13:74117236-74117258 GCTGATTTGGTAGCTGTGGCAGG + Intronic
1110352437 13:74525124-74525146 CCTTACATTGTATCTGAGGGAGG + Intergenic
1111581073 13:90224542-90224564 CCTGAGTTAGTAGCCCAGGGTGG + Intergenic
1111953060 13:94725762-94725784 CTTCATTTTGGAGGTGAGGGGGG - Intergenic
1115395868 14:32907619-32907641 TGTGAATTTGTAGCTGAGTGTGG - Intergenic
1115525964 14:34281094-34281116 ACTGGTTTTGTGGCTCAGGGGGG - Intronic
1116443357 14:44980031-44980053 CCTTATTTAGTAGCTGAAGCTGG + Intronic
1117098563 14:52322244-52322266 GCTGATTTTGCAGCTCAGGTGGG - Intronic
1118216303 14:63811767-63811789 GCTGGTTTTGTGGCTCAGGGGGG - Intergenic
1119607459 14:76032964-76032986 CCTGATTTAGGAGCTGATGGTGG + Intronic
1122237567 14:100340704-100340726 TCTGATTTTGGAGCTGAAGTCGG + Intronic
1126049656 15:44674365-44674387 GCTGACTTTGAATCTGAGGGAGG - Intronic
1130369723 15:83274811-83274833 CCCGATTTTATAGATGAGGAAGG + Intronic
1130921038 15:88344717-88344739 TGTGATTTTGTGGCTGAGTGCGG + Intergenic
1132002538 15:98194391-98194413 TCTGATTCTGTAGCTCTGGGAGG + Intergenic
1133188050 16:4114692-4114714 CCTGAGTTTGTGTCTGGGGGTGG - Exonic
1133423731 16:5669262-5669284 ACAGAGTTTGGAGCTGAGGGTGG - Intergenic
1133698043 16:8283528-8283550 CCTGACTTTATAGGTGAGGCTGG + Intergenic
1135310957 16:21404236-21404258 CCTGAGGGTGGAGCTGAGGGTGG + Intronic
1135796798 16:25452477-25452499 GTTGATTCTGTATCTGAGGGAGG - Intergenic
1136307427 16:29381807-29381829 GCTGAGGTTGGAGCTGAGGGTGG + Exonic
1139298273 16:65921892-65921914 CCTCATTTTGATGCTGTGGGAGG - Intergenic
1139335013 16:66225668-66225690 TCTGATTTAGTAGGTCAGGGTGG - Intergenic
1143676578 17:8436960-8436982 CCTTGTTTTGTAGCTGAGAAGGG - Intronic
1143861650 17:9895720-9895742 CCTCTTTTTTTAGCTTAGGGTGG - Intergenic
1144228993 17:13180667-13180689 CCTGAGTTTGCTGCTGATGGAGG + Intergenic
1144763099 17:17718351-17718373 CTTGATATTTTAGCTGATGGGGG - Intronic
1145993599 17:29093317-29093339 CCTGACCTGGTCGCTGAGGGTGG + Exonic
1149446125 17:56714636-56714658 CCTCATTTTATAGATGAGGAGGG - Intergenic
1149468289 17:56896637-56896659 TCTCATTTTGTTGCTGAGGCTGG - Intronic
1150759322 17:67945965-67945987 GCTGTATTTGTAGCTGAGGACGG - Exonic
1151173261 17:72266214-72266236 TCTGATTTAGTAGGTGTGGGTGG - Intergenic
1152131218 17:78477717-78477739 CAGGAGTTTGTGGCTGAGGGAGG - Intronic
1153331079 18:3875825-3875847 CCTCATTTTCTAGCAGAGGAAGG + Intronic
1153964873 18:10170262-10170284 GCTCATTTTGCAGATGAGGGAGG + Intergenic
1157734367 18:50033591-50033613 CCTGAGGTTGGAGCTGAGGAAGG + Intronic
1161423610 19:4189797-4189819 CTTCATTTTATAGATGAGGGAGG + Intronic
1161840591 19:6678005-6678027 CCCGATGATGTAGCTGAGGCTGG + Exonic
1163958514 19:20665580-20665602 GCAGATTTTGGAGCTGAGTGCGG - Intronic
1166463132 19:43007381-43007403 CCAGATTTTTTAGCTAAGTGCGG + Intronic
1166480409 19:43167468-43167490 CCAGATTTTTTAGCTAAGTGCGG + Intronic
1167504476 19:49863826-49863848 CCAGAATTTGTAGCTGATGATGG + Intronic
925023172 2:587777-587799 CCTGATTTTGCACCTGAGCCAGG - Intergenic
925446298 2:3929796-3929818 CCTGATTTTGTCCCTGCGGCAGG - Intergenic
927137554 2:20107926-20107948 CCTCATTCTGTAGCTCAGTGTGG + Intergenic
928313475 2:30229596-30229618 CCTCATTTTGGAGAAGAGGGTGG - Intergenic
928317324 2:30256206-30256228 CCTGATTTTATAGCTGGGTTTGG + Intronic
928422668 2:31151050-31151072 GCTGATTTTGCAGCTGGGCGCGG - Intronic
929791386 2:45025498-45025520 CCTGACCATTTAGCTGAGGGTGG + Intergenic
931500972 2:62865972-62865994 CCTGAGTCTTTAGCTGAGTGTGG + Intronic
933429969 2:82163629-82163651 TCTGATTTTGTGGCTGAGAATGG - Intergenic
935945290 2:108280627-108280649 CCTGATTTTGTACCTAGGTGTGG + Intergenic
937069979 2:119055816-119055838 CTTGCTTTTGGAGCTGAGGTCGG - Intergenic
937872932 2:126798814-126798836 CCTGATTCTGTGGTGGAGGGTGG - Intergenic
938315849 2:130327586-130327608 CATAATTTGGTAGCTGAGGGAGG - Intergenic
938525834 2:132129900-132129922 CCTGATTTTGTTGCGGGAGGGGG - Intergenic
939081968 2:137673489-137673511 CCTGATTTAGTGAGTGAGGGAGG + Intronic
939826560 2:147022839-147022861 GCTGATTTTGCAGCTCAGGTGGG - Intergenic
943625103 2:190189680-190189702 CCTGAACTTGTAGCTAAGGAGGG - Intronic
947295734 2:228628225-228628247 CTTGACTTTGTCGCTGAGGCTGG - Intergenic
1169186044 20:3618071-3618093 TCTGATCTTGTAGCTGTGTGTGG + Intronic
1169218945 20:3809899-3809921 TCTCATTTTGTTGCTGAGGCTGG + Intergenic
1169349333 20:4855582-4855604 CTTGATTTTACAGGTGAGGGTGG - Exonic
1169748191 20:8964248-8964270 CATGACCTTGTAGCTGAGGCTGG + Intronic
1171475125 20:25402782-25402804 CCTGATTCTGTCGCTGATCGGGG + Intergenic
1172350197 20:34233019-34233041 ACTGATTTTGTAGCTGTGGAAGG - Intronic
1173222167 20:41139140-41139162 CTGGAGTTTGTAGCTGAGGATGG - Intronic
1173513620 20:43649541-43649563 CCTGATTTAGAAGCTGAGCCTGG + Intergenic
1175444007 20:59007916-59007938 CGTGGTTTTGTAACTGGGGGAGG + Intergenic
1181536271 22:23547727-23547749 GCTGGTTTTGTGGCTCAGGGGGG + Intergenic
1184975156 22:48056452-48056474 CCTGAATTTACAGGTGAGGGTGG - Intergenic
949271485 3:2223060-2223082 CCTGATTTTGCAGCTAAGGTGGG - Intronic
950876980 3:16284736-16284758 TCTCATTTTATAGCTGAGGAGGG + Intronic
951420338 3:22476224-22476246 CATGATTATGAAGCTGATGGGGG + Intergenic
952878738 3:37969785-37969807 CATGGATTTGTGGCTGAGGGTGG - Intronic
954786170 3:53094065-53094087 CCTGATTCTGCAGGTGTGGGAGG + Intronic
955196597 3:56810168-56810190 ACTGAGTTTGTAGTTGATGGAGG - Intronic
956822514 3:72966657-72966679 TCTTATTTTGTTGCTCAGGGTGG + Intronic
958447595 3:94234390-94234412 CCTGATCTTGATGCTGATGGAGG + Intergenic
959496770 3:107060973-107060995 CCTGCTTTTGTGGAAGAGGGAGG - Intergenic
960392436 3:117094606-117094628 CTTGATTTTATAGATGAGGAAGG + Intronic
961054739 3:123778616-123778638 CCTGATTTTACTTCTGAGGGTGG - Intronic
961134507 3:124497160-124497182 CCGGAATTTGTAGCAGGGGGAGG + Intronic
962331268 3:134480818-134480840 CATGATTTTGTAGCTCAGCTGGG - Intronic
964734618 3:159903748-159903770 TCTCACTTTGTAGCTGAGGCTGG + Intergenic
967112256 3:186304231-186304253 CGTGTTTTTGGAGCTGGGGGTGG + Intronic
967765156 3:193271218-193271240 CCTGCCTGTGTAGATGAGGGTGG + Intronic
969886168 4:10217476-10217498 CCTGATTTTGTGGCAGTGGCTGG - Intergenic
970012484 4:11474586-11474608 CCTGATTTTGGAGGTCAAGGAGG + Intergenic
970854728 4:20638475-20638497 CCTGATTTGGTTTCTGATGGGGG + Intergenic
972927735 4:44032520-44032542 CATGATTTTCCAGCTGAGAGTGG + Intergenic
974369050 4:60990083-60990105 CCTGATTATTTAGCAGAGGTTGG - Intergenic
976005332 4:80423467-80423489 CCTCATTTTGTTCCTGAGGCTGG + Intronic
976766042 4:88598689-88598711 CCTGATTTTGGAGCTTAAGGTGG + Intronic
979544741 4:121926892-121926914 CCTGATTTAGAAACTGAGGAAGG + Intronic
981202534 4:141997578-141997600 CCTGAGATAGTAGCTGATGGTGG + Intergenic
981777717 4:148389150-148389172 CCTGGTTGTGTAGCTGAGAGAGG - Intronic
983412977 4:167422193-167422215 ACTGCTTTTGAAGCCGAGGGAGG - Intergenic
986503436 5:8425783-8425805 CCTGATGTTGTCAGTGAGGGAGG - Intergenic
992737167 5:79733950-79733972 CCTGCCTCTGTAGCTGAAGGAGG + Exonic
994955600 5:106527323-106527345 AGTGATTTTATAACTGAGGGAGG - Intergenic
995841134 5:116444319-116444341 CCTGAGTACTTAGCTGAGGGTGG - Exonic
998621514 5:143799738-143799760 CTCAATTTTGTAGCTGAGGAAGG - Intergenic
999034918 5:148337123-148337145 CATGATTTAGTAGCTGTGAGAGG + Intronic
999697134 5:154197111-154197133 CCTCAGTTTGTTGCTGAGGACGG + Intronic
1000401012 5:160827125-160827147 GCTGATTTTGCAGCTCAGGTGGG + Intronic
1000790434 5:165600351-165600373 CTAGATTTTGTACCTGAGGGTGG - Intergenic
1000880592 5:166692715-166692737 CCTGGTTTTGCAGCTCAGGTGGG - Intergenic
1001953634 5:175833298-175833320 CCTGATTTTGCAGATGAGAAGGG + Intronic
1005285363 6:24320620-24320642 ACTGAGTTTGTAGCCGAGTGTGG - Intronic
1006061560 6:31424078-31424100 ACTGATTTTGTAACTGATAGAGG - Intergenic
1006075047 6:31526984-31527006 CCTGATCTTTTTGCTGGGGGAGG + Intergenic
1008248672 6:49209661-49209683 CCTTTCTTTGTAACTGAGGGAGG + Intergenic
1009050488 6:58269679-58269701 CCTCATTTTGTCGGTGGGGGTGG + Intergenic
1009630895 6:66198565-66198587 GCTGCTTTTGTGGCTCAGGGGGG + Intergenic
1010698679 6:79012329-79012351 CCTTATTTTCTAGCTGTAGGTGG + Intronic
1013337342 6:109177222-109177244 CCAGATTTTGAAGCTGCAGGAGG + Intergenic
1014271998 6:119346957-119346979 CCTGATTTGGTAGCACAGGCAGG + Intronic
1014302133 6:119694815-119694837 CCTCATTTTATAGATGAGGAAGG - Intergenic
1015000393 6:128207281-128207303 CTTGATTTTGTAGCGGGGAGAGG - Intronic
1015166067 6:130201448-130201470 TCTGATTTAGTAGGTTAGGGTGG - Intronic
1015966302 6:138698143-138698165 ACAGATTTTTGAGCTGAGGGAGG - Intergenic
1016879685 6:148898828-148898850 CATGATTTTGTAACTGAGGCTGG - Intronic
1017080040 6:150659469-150659491 CATGCTTTTGTAGGTGAGGTTGG - Intronic
1018328625 6:162703654-162703676 CCCCATTTTGTAGATGAGGAAGG + Intronic
1020977633 7:15026550-15026572 CTGGATTTTGTATCTGACGGGGG + Intergenic
1021286573 7:18788102-18788124 CCTGAAGTTGAAGCTGAGGTCGG + Intronic
1023730713 7:43189306-43189328 TCTGATTCAGTAGGTGAGGGTGG + Intronic
1026459384 7:70600033-70600055 TCTGATTCAGTAGCTGTGGGTGG - Intronic
1027566640 7:79802538-79802560 GCTGATTTTGTGGCTCAGGTGGG + Intergenic
1027653044 7:80894936-80894958 CCTTATATTACAGCTGAGGGAGG - Intronic
1032472512 7:132188807-132188829 CCTGATTTTGTTGATGAGAGAGG - Intronic
1032522490 7:132556367-132556389 CCTGTTTTTGAAGCTCAGTGTGG - Intronic
1033067128 7:138166945-138166967 CCTCACTTTGTTGCTGAGGCTGG + Intergenic
1033159946 7:138986401-138986423 CTTAATTTTGTAGGTGACGGTGG + Intergenic
1033681209 7:143598460-143598482 CAGGAGTTTGTAGCAGAGGGTGG + Intergenic
1033686748 7:143647206-143647228 CAGGAGTTTGTGGCTGAGGGTGG - Intronic
1033688986 7:143720101-143720123 CAGGAGTTTGTGGCTGAGGGTGG + Exonic
1033697861 7:143810408-143810430 CAGGAGTTTGTGGCTGAGGGTGG + Intergenic
1033703682 7:143863353-143863375 CAGGAGTTTGTAGCAGAGGGTGG - Exonic
1037326345 8:17694915-17694937 CCTTATTTTGTAGCCGTGTGAGG + Intronic
1039503252 8:38033004-38033026 TCTGATTCTGTAGGTGGGGGTGG + Intronic
1041024111 8:53666445-53666467 CCTGAGTTTGTGGCTGTGAGTGG + Intergenic
1041667673 8:60461646-60461668 TCTGATTTAGTAGCTGTGGAGGG + Intergenic
1041826630 8:62102112-62102134 CCTGCTTTTAAAGCAGAGGGAGG + Intergenic
1048675612 8:136775796-136775818 CCTGGTTTTAAAGTTGAGGGAGG + Intergenic
1049142125 8:140964346-140964368 CGTGATGGTGTGGCTGAGGGAGG - Intronic
1050591218 9:7162148-7162170 CCTGGTTTTGGAGGTGGGGGAGG + Intergenic
1053356195 9:37447700-37447722 CCTGAGTTAATAGGTGAGGGGGG + Intronic
1055960559 9:81816616-81816638 CCTCATTTTACTGCTGAGGGCGG - Intergenic
1056905959 9:90648038-90648060 CAAGATTTTGCAGCTGAGAGGGG - Intergenic
1058171899 9:101691905-101691927 CCTCATTTTAGAGATGAGGGAGG - Intronic
1059249172 9:112872716-112872738 CCTAAGTTTGTAAATGAGGGTGG - Exonic
1060444271 9:123673501-123673523 CCTGATTCTGGGGCTGAGGCAGG - Intronic
1060666914 9:125437174-125437196 GTTGATTTTGTGGCTGAAGGAGG + Intergenic
1061769078 9:132903817-132903839 CCTGATTGTAAAGCAGAGGGAGG + Exonic
1185525085 X:772075-772097 CCGGCTTCTGTAGCTGAGGAGGG + Intergenic
1185829495 X:3286675-3286697 GCTGATTTTGTGGCTGACAGCGG + Intergenic
1186224977 X:7388739-7388761 TCAGATTTTGTAGGTGAGGAAGG - Intergenic
1187015611 X:15325152-15325174 CCTGATTTTTTAAATGAGAGGGG + Exonic
1187685092 X:21808103-21808125 GCTGATTTTGTGGCTCAGGTGGG - Intergenic
1189785751 X:44557544-44557566 CTTTATTTTGTAGTTAAGGGAGG - Intergenic
1190217975 X:48492798-48492820 CCAGAGTTTGGAGCTGGGGGCGG + Intergenic
1190360852 X:49646812-49646834 CCTGTTTTTGTTGCTGATGTTGG - Intergenic
1190465214 X:50719317-50719339 CCTGAAATTGTATCTGAAGGAGG - Intronic
1190886907 X:54538527-54538549 CTTCTTTTTGTATCTGAGGGAGG + Intronic
1192211069 X:69128478-69128500 CCTGTTTTTGAAGCTGGTGGAGG + Intergenic
1192934649 X:75846968-75846990 CTTGATTTTGTAGCTTAGTTTGG + Intergenic
1195400959 X:104460692-104460714 GCTGGTTTTGCAGCTGAGGTGGG + Intergenic
1197542111 X:127776747-127776769 CCTGGTTTTGCAGCTCAGGTGGG + Intergenic
1197755800 X:129993822-129993844 CTTGCTTTTGTAGCTCAGGTTGG + Intronic
1198875271 X:141217904-141217926 CTTCATTTTGTAGCTGAGAAAGG - Intergenic
1200024036 X:153240106-153240128 ACAGATTTTGTGGATGAGGGTGG - Intergenic
1200769988 Y:7115749-7115771 GCTGGTTTTGCAGCTCAGGGGGG - Intergenic
1201594535 Y:15652903-15652925 TCAGATTTTGTAGATGAGGAAGG - Intergenic