ID: 903960917

View in Genome Browser
Species Human (GRCh38)
Location 1:27057358-27057380
Sequence AGCATGGCTCTGCCTCCGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903960917_903960925 21 Left 903960917 1:27057358-27057380 CCAATCGGAGGCAGAGCCATGCT No data
Right 903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG No data
903960917_903960920 2 Left 903960917 1:27057358-27057380 CCAATCGGAGGCAGAGCCATGCT No data
Right 903960920 1:27057383-27057405 TAGCCCAGATGGTTTGACCCTGG No data
903960917_903960918 -9 Left 903960917 1:27057358-27057380 CCAATCGGAGGCAGAGCCATGCT No data
Right 903960918 1:27057372-27057394 AGCCATGCTTTTAGCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903960917 Original CRISPR AGCATGGCTCTGCCTCCGAT TGG (reversed) Intergenic
No off target data available for this crispr