ID: 903960918

View in Genome Browser
Species Human (GRCh38)
Location 1:27057372-27057394
Sequence AGCCATGCTTTTAGCCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903960917_903960918 -9 Left 903960917 1:27057358-27057380 CCAATCGGAGGCAGAGCCATGCT No data
Right 903960918 1:27057372-27057394 AGCCATGCTTTTAGCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903960918 Original CRISPR AGCCATGCTTTTAGCCCAGA TGG Intergenic
No off target data available for this crispr