ID: 903960919

View in Genome Browser
Species Human (GRCh38)
Location 1:27057374-27057396
Sequence AACCATCTGGGCTAAAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903960919_903960927 20 Left 903960919 1:27057374-27057396 CCATGCTTTTAGCCCAGATGGTT No data
Right 903960927 1:27057417-27057439 TTGTGTGGCTGCATTTGCCACGG No data
903960919_903960928 21 Left 903960919 1:27057374-27057396 CCATGCTTTTAGCCCAGATGGTT No data
Right 903960928 1:27057418-27057440 TGTGTGGCTGCATTTGCCACGGG No data
903960919_903960925 5 Left 903960919 1:27057374-27057396 CCATGCTTTTAGCCCAGATGGTT No data
Right 903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903960919 Original CRISPR AACCATCTGGGCTAAAAGCA TGG (reversed) Intergenic
No off target data available for this crispr