ID: 903960921

View in Genome Browser
Species Human (GRCh38)
Location 1:27057386-27057408
Sequence GCTCCAGGGTCAAACCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903960921_903960932 26 Left 903960921 1:27057386-27057408 CCCAGATGGTTTGACCCTGGAGC No data
Right 903960932 1:27057435-27057457 CACGGGCAGCATCTCAGGAAGGG No data
903960921_903960927 8 Left 903960921 1:27057386-27057408 CCCAGATGGTTTGACCCTGGAGC No data
Right 903960927 1:27057417-27057439 TTGTGTGGCTGCATTTGCCACGG No data
903960921_903960925 -7 Left 903960921 1:27057386-27057408 CCCAGATGGTTTGACCCTGGAGC No data
Right 903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG No data
903960921_903960928 9 Left 903960921 1:27057386-27057408 CCCAGATGGTTTGACCCTGGAGC No data
Right 903960928 1:27057418-27057440 TGTGTGGCTGCATTTGCCACGGG No data
903960921_903960931 25 Left 903960921 1:27057386-27057408 CCCAGATGGTTTGACCCTGGAGC No data
Right 903960931 1:27057434-27057456 CCACGGGCAGCATCTCAGGAAGG No data
903960921_903960929 21 Left 903960921 1:27057386-27057408 CCCAGATGGTTTGACCCTGGAGC No data
Right 903960929 1:27057430-27057452 TTTGCCACGGGCAGCATCTCAGG No data
903960921_903960933 29 Left 903960921 1:27057386-27057408 CCCAGATGGTTTGACCCTGGAGC No data
Right 903960933 1:27057438-27057460 GGGCAGCATCTCAGGAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903960921 Original CRISPR GCTCCAGGGTCAAACCATCT GGG (reversed) Intergenic
No off target data available for this crispr